ID: 987212303

View in Genome Browser
Species Human (GRCh38)
Location 5:15695286-15695308
Sequence CCCTGGACACCAAGGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 213}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987212296_987212303 -7 Left 987212296 5:15695270-15695292 CCCTGTGTCAGACCCTCCCTGGA 0: 1
1: 0
2: 0
3: 28
4: 215
Right 987212303 5:15695286-15695308 CCCTGGACACCAAGGATGGAAGG 0: 1
1: 0
2: 3
3: 28
4: 213
987212291_987212303 7 Left 987212291 5:15695256-15695278 CCCCCAAAACAGCTCCCTGTGTC 0: 1
1: 0
2: 0
3: 21
4: 244
Right 987212303 5:15695286-15695308 CCCTGGACACCAAGGATGGAAGG 0: 1
1: 0
2: 3
3: 28
4: 213
987212297_987212303 -8 Left 987212297 5:15695271-15695293 CCTGTGTCAGACCCTCCCTGGAC 0: 1
1: 0
2: 1
3: 18
4: 201
Right 987212303 5:15695286-15695308 CCCTGGACACCAAGGATGGAAGG 0: 1
1: 0
2: 3
3: 28
4: 213
987212290_987212303 10 Left 987212290 5:15695253-15695275 CCTCCCCCAAAACAGCTCCCTGT 0: 1
1: 0
2: 0
3: 60
4: 692
Right 987212303 5:15695286-15695308 CCCTGGACACCAAGGATGGAAGG 0: 1
1: 0
2: 3
3: 28
4: 213
987212294_987212303 4 Left 987212294 5:15695259-15695281 CCAAAACAGCTCCCTGTGTCAGA 0: 1
1: 0
2: 1
3: 17
4: 236
Right 987212303 5:15695286-15695308 CCCTGGACACCAAGGATGGAAGG 0: 1
1: 0
2: 3
3: 28
4: 213
987212292_987212303 6 Left 987212292 5:15695257-15695279 CCCCAAAACAGCTCCCTGTGTCA 0: 1
1: 0
2: 6
3: 46
4: 302
Right 987212303 5:15695286-15695308 CCCTGGACACCAAGGATGGAAGG 0: 1
1: 0
2: 3
3: 28
4: 213
987212293_987212303 5 Left 987212293 5:15695258-15695280 CCCAAAACAGCTCCCTGTGTCAG 0: 1
1: 0
2: 4
3: 59
4: 282
Right 987212303 5:15695286-15695308 CCCTGGACACCAAGGATGGAAGG 0: 1
1: 0
2: 3
3: 28
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987212303 Original CRISPR CCCTGGACACCAAGGATGGA AGG Intronic
900589228 1:3452357-3452379 CCCTGGACACCTACCCTGGAAGG + Intergenic
900640259 1:3685040-3685062 CGCTGGACCCCAGGGAGGGAGGG + Intronic
901646653 1:10720513-10720535 CCCTGGACTGTAAGGCTGGAGGG + Intronic
901771839 1:11534558-11534580 TCCTGCCCACCCAGGATGGAGGG - Intronic
902383269 1:16062424-16062446 GGCTGGGCACAAAGGATGGAGGG + Intronic
903339352 1:22644147-22644169 CCCGGGGCACCAGGGAAGGATGG + Exonic
904783922 1:32971385-32971407 CTGGGGACACAAAGGATGGAGGG - Intergenic
909032152 1:70555003-70555025 TCCTGGACACCAATGGTGAAGGG + Intergenic
912377692 1:109225073-109225095 CACTGGAAACCCAGGCTGGATGG - Intronic
912547431 1:110460978-110461000 CCCTCGCCACCAAGGAGGAAGGG + Intergenic
913585217 1:120268113-120268135 CCCTGGCCACCAAAAATAGATGG - Intergenic
913622968 1:120630249-120630271 CCCTGGCCACCAAAAATAGATGG + Intergenic
914567219 1:148879974-148879996 CCCTGGCCACCAAAAATAGATGG - Intronic
914605604 1:149250268-149250290 CCCTGGCCACCAAAAATAGATGG + Intergenic
915020514 1:152774976-152774998 CCCTGAACACCAATGAAGGACGG + Intronic
915141760 1:153772446-153772468 CACTGGACGCCGAGGGTGGAAGG - Intronic
917680972 1:177366995-177367017 CCCCTGACACTATGGATGGAGGG + Intergenic
917738730 1:177943547-177943569 CCCTCGACACCAAGCACTGAAGG + Intronic
919290486 1:195623782-195623804 GCCTGGATCCCAAGGAGGGATGG + Intergenic
923070754 1:230562442-230562464 CCCTGAACACCAAGGCTTGAGGG + Intergenic
923558650 1:235021740-235021762 CCCTGGACACCCAGCAAGGATGG + Intergenic
924099364 1:240587939-240587961 CCCTTGACAGCCAGGCTGGAGGG - Intronic
1063675945 10:8140843-8140865 CCCTGGAAGCCAGGGATGGGTGG + Intergenic
1064251870 10:13712104-13712126 GCCAGGACTCCAAGGATAGAAGG - Intronic
1067017941 10:42771698-42771720 CCCTGGCCCCCAAGGGTGCAAGG - Intergenic
1067666806 10:48286071-48286093 CAGGGGACACCAAGGAGGGAGGG - Intergenic
1067691633 10:48505647-48505669 TCCTGGAAACCTAGGATGGGTGG + Intronic
1068388023 10:56358328-56358350 CCCTGGACTGCAAGTGTGGAAGG - Intronic
1070646527 10:78205669-78205691 CTTTGAACACCAAGGATGGAGGG - Intergenic
1071328427 10:84538958-84538980 ACCTGGACCCCAGTGATGGAAGG - Intergenic
1071345820 10:84691459-84691481 CCCTGGAAGCCAAGGAAAGAAGG + Intergenic
1072016262 10:91349737-91349759 CCCTGGGCACCAAGGAGGCCAGG - Intergenic
1075249204 10:120850659-120850681 CACTGAACACAAAGGAGGGAAGG + Intergenic
1075579208 10:123604072-123604094 CCCTGGACAGCTGGGAAGGAAGG - Intergenic
1075727954 10:124620279-124620301 CCCTGGGCCCCACGGGTGGACGG + Exonic
1077887153 11:6394714-6394736 CCCTGGGCCCCAAGGATGCCGGG + Exonic
1078083721 11:8221393-8221415 CCCAGGCCACCAAGGAAGGCAGG + Intergenic
1078964981 11:16328498-16328520 CACTGCATACCAAGGAAGGATGG - Intronic
1079950120 11:26791413-26791435 CTATGGACACCAAGGAAGGTAGG + Intergenic
1083384257 11:62295981-62296003 GCCTGGACACCAAGGCAGGCTGG + Intergenic
1083708754 11:64534569-64534591 CCCAGGACGGGAAGGATGGAGGG - Intergenic
1084461235 11:69297780-69297802 CCCCAGACACCAAGGATGGAGGG + Intronic
1084694951 11:70747308-70747330 CCCTGGGCAGCAGGGATGGGAGG + Intronic
1086096284 11:83053083-83053105 CCCTGGGCTCCATAGATGGAAGG + Intronic
1087791466 11:102410608-102410630 CCCTGGAGAGCAAGGATGCCAGG - Intronic
1087873133 11:103324473-103324495 TCCTTCACAGCAAGGATGGATGG - Intronic
1091692105 12:2604372-2604394 CTCAGGACTCCAAGGAAGGATGG - Intronic
1092490493 12:8940605-8940627 CACTGGACACAAAAGAGGGATGG - Exonic
1094108383 12:26836291-26836313 TCCTGGATACCAGGAATGGAAGG - Intergenic
1094848507 12:34372000-34372022 CCCTGGGCACCACGCATGCACGG + Intergenic
1094848880 12:34373513-34373535 CCCTGGCCCCCAAGCATGCACGG + Intergenic
1096228402 12:49883764-49883786 GCCTGGACACCAAGGGAAGAAGG + Intronic
1096945996 12:55410553-55410575 CACTGGACACAAAAGAGGGATGG + Intergenic
1097303587 12:58044351-58044373 CCCTGGACATACAGGATGTATGG - Intergenic
1099295397 12:80822783-80822805 CCATGGGCATCAAGGATGGCAGG + Intronic
1102089824 12:110176373-110176395 CCCTGTAAACCAGGAATGGAAGG + Intronic
1102574828 12:113849783-113849805 CCCTGGCCATCAATGATGGCAGG - Intronic
1104074948 12:125380752-125380774 CCATGGACACCATGGGTGGGAGG - Intronic
1105760559 13:23510188-23510210 GACTGGAGACTAAGGATGGAAGG + Intergenic
1105781116 13:23705974-23705996 CCCGGGACTCCCTGGATGGATGG + Intergenic
1108118707 13:47160209-47160231 CCCTGGCCCCCAAGAATGCAGGG - Intergenic
1109801111 13:67379980-67380002 ACATGGACTCCAAGGATGAATGG - Intergenic
1110002818 13:70227697-70227719 CCAAGGACACCAAGGATGAGTGG - Intergenic
1113200142 13:107858139-107858161 TCCTGGGCAACTAGGATGGATGG - Intronic
1113498245 13:110750902-110750924 CCCAGGACACAGAGCATGGAAGG + Intergenic
1113770419 13:112904624-112904646 CCCTGGAGTCCAGGGTTGGAGGG - Intronic
1115661894 14:35503854-35503876 CCCTGGAGACTAAAGAGGGAGGG - Intergenic
1116824598 14:49660232-49660254 CACTGTACACCAAGGCTGTATGG - Intronic
1116890964 14:50267855-50267877 CACTTCACACCAAGGATGGATGG - Exonic
1117435107 14:55708492-55708514 CCCTGGAAACCAAAGCTGTATGG + Intergenic
1118469078 14:66057757-66057779 CCCTGTCCACCAAGGATAGATGG + Intergenic
1119125763 14:72125098-72125120 CCCTGGAAAGAAAGGTTGGAGGG - Intronic
1120073324 14:80127277-80127299 CCCTGGCCAGCAAAGATGGAAGG + Intergenic
1120680156 14:87471411-87471433 CAAAGGACACCAAGGATTGAAGG - Intergenic
1121307681 14:92917285-92917307 CCCTGGACACCGAGGCTGGCTGG - Intergenic
1121430947 14:93888086-93888108 CCCTGGAAAGAAAGGAAGGAAGG - Intergenic
1122273531 14:100579400-100579422 CCCTTCACACAAATGATGGAGGG - Intronic
1122325142 14:100877371-100877393 TCCTGGCCATCAAAGATGGAGGG - Intergenic
1122774381 14:104110758-104110780 CCCTGCACACCATGGGTGGGTGG + Intronic
1123721671 15:23066415-23066437 CCCGGGAGACCAAGGCTGGCGGG - Intergenic
1124254559 15:28130301-28130323 CCCTGCACACAAAGGAAGCATGG + Exonic
1125507383 15:40274588-40274610 CCCTGGACAGCAGGGATTGCTGG - Intronic
1126109787 15:45168464-45168486 CCCTGGCCACAGAGGCTGGAGGG - Intronic
1130056467 15:80530570-80530592 CCCTGGCAACCAGGGAAGGATGG - Intronic
1131985819 15:98042121-98042143 CCCTGAACCCCCAGGAGGGATGG - Intergenic
1132178043 15:99731509-99731531 CCCTGGCCCCCAAAGAGGGAGGG - Intronic
1132841114 16:1978959-1978981 CCCTGGCCAGCAGGGATGGGAGG - Exonic
1134190083 16:12114270-12114292 CCCTGGATCCCAGGGTTGGATGG + Intronic
1134332937 16:13266766-13266788 CCTTGCACATCAAGGAGGGAAGG + Intergenic
1134570067 16:15283416-15283438 CCCTGGACACCAAGGCTTGGGGG - Intergenic
1134732309 16:16472633-16472655 CCCTGGACACCAAGGCTTGGGGG + Intergenic
1134935127 16:18239330-18239352 CCCTGGACACCAAGGCTTGGGGG - Intergenic
1136386098 16:29926801-29926823 GCCCGGGCACCAAGGATGGAAGG + Exonic
1136399589 16:30010332-30010354 CCCTCGACACCTAGGAAGGGAGG - Intronic
1137565068 16:49527585-49527607 CCGTGGACATTAAGGAGGGAGGG + Intronic
1137945538 16:52730407-52730429 CTCTGGACACCAAGGATGGTTGG + Intergenic
1138659655 16:58509639-58509661 CCCTGGACCCCCAGCACGGAAGG - Intronic
1139420912 16:66849046-66849068 CCCTGGTCACCCATCATGGAAGG + Intronic
1140245731 16:73246241-73246263 TCCTGAACACCAAGCATGGCTGG + Intergenic
1140580817 16:76228831-76228853 CACTGGACACAAAGGTTGCATGG + Intergenic
1141275711 16:82585964-82585986 CCTTGGAAAGCCAGGATGGAGGG + Intergenic
1142480731 17:216626-216648 CCCTGGAAACCGAGGCTGGCAGG + Intronic
1142854419 17:2721955-2721977 CCCTGGATGCCCAGGAGGGAAGG + Intergenic
1142995169 17:3755760-3755782 CCCAGGACACCTAGGATTCAGGG - Intronic
1143568481 17:7739790-7739812 CCCTGGGCACCAAAGAAGCAAGG - Exonic
1144991798 17:19238086-19238108 GCCTGGTCCCCAAGGACGGAAGG - Intronic
1146053488 17:29569377-29569399 GCGTGGACACCAAGGGTGGTGGG - Intronic
1146466222 17:33088833-33088855 CCCTGGGCTCCCAGGATTGATGG - Intronic
1147261465 17:39211779-39211801 CCCTCCCCACCAAGGGTGGAGGG + Exonic
1147497013 17:40926430-40926452 CCATGGACTCCGAGGAAGGATGG - Intronic
1148782101 17:50128350-50128372 CCCTGGACACAATGTAGGGAGGG - Intronic
1148797716 17:50205091-50205113 CCCTGGAAAGGAAGGAAGGAGGG - Intergenic
1148798423 17:50208680-50208702 CTCTGGACACAAAGGATGATGGG + Intergenic
1149854412 17:60067569-60067591 CTCTGGACACCCAGGGAGGAGGG + Exonic
1150506537 17:65704159-65704181 CCATGGACACCAAGGATTGCTGG + Intronic
1150708871 17:67512692-67512714 TCCTGGACACCAAAGATGTGAGG - Intronic
1151182785 17:72342097-72342119 CCCAGGAGACCAAGGTGGGAGGG - Intergenic
1151354721 17:73551496-73551518 CCCCTGACACCAGAGATGGAAGG - Intronic
1151965133 17:77427258-77427280 CCCAGGGCACCAAGGCTGGTTGG - Intronic
1154085547 18:11302050-11302072 CCCTGGGATCCAAGGATGGATGG - Intergenic
1154129794 18:11727082-11727104 CACTGAACAGCAAGGAGGGAGGG - Intronic
1155403994 18:25467771-25467793 TCCTAGACAGGAAGGATGGAGGG - Intergenic
1160294855 18:77628617-77628639 CACTGAACATTAAGGATGGATGG - Intergenic
1160315166 18:77837251-77837273 CCCTGGTCATCGAGGATTGATGG + Intergenic
1161286687 19:3472076-3472098 CCGAGGACACCGAGGATGGGGGG + Intergenic
1163126587 19:15247491-15247513 CCCTGGACAGCGAGGTTGAAAGG + Intronic
1166295559 19:41887734-41887756 GCCTGGACTCCCAGGTTGGAGGG - Intronic
1166739128 19:45103615-45103637 CCCAGGACAACAGGGAGGGAGGG + Intronic
1166871967 19:45876691-45876713 CCCAGGACAGCAAGGCTGGTGGG - Intergenic
1168185787 19:54698563-54698585 CTCTGGACACTAAGGAAAGAGGG + Intronic
925278706 2:2668610-2668632 CCCTGGCCACTGAGGGTGGAGGG - Intergenic
928261093 2:29767456-29767478 CCCTGGAAAACCAGGATGGCTGG + Intronic
928371575 2:30743770-30743792 CCCTGGACACAATGGATGCAAGG + Intronic
930971213 2:57397726-57397748 CCATGGGCACCATGGATGGCAGG - Intergenic
931375200 2:61701011-61701033 CTCTTGTCACCCAGGATGGAGGG + Intergenic
932460609 2:71879640-71879662 CCAGGGACACAAGGGATGGAGGG - Intergenic
933420807 2:82043182-82043204 ACCTGGGCACCATGGATGGCAGG + Intergenic
934714909 2:96537729-96537751 CCCTAGACACCGCGGAGGGACGG - Intronic
935618421 2:105108706-105108728 CCCTGGGGACCAAGGATGGGTGG - Intergenic
936500429 2:113062174-113062196 CCCTGGACACCCAGGATGACGGG - Exonic
937060587 2:118977832-118977854 CCCAGGACCCCAAGGAGAGAAGG + Exonic
940046596 2:149416512-149416534 CCCTGGACACAAAGAATCCAGGG + Intronic
940237480 2:151526831-151526853 CCAGGGACACCAGGGAAGGATGG - Intronic
940636212 2:156300157-156300179 CCCTGGACAGCCATGTTGGAAGG - Intergenic
942341943 2:174958103-174958125 GCCTGGGCACCAAGGAAGGAAGG + Intronic
942539368 2:176999519-176999541 TCCTGGGCCCCAAGGAGGGAAGG + Intergenic
946691442 2:222311667-222311689 ACCTGGACACGAAAGTTGGAGGG - Intergenic
946822585 2:223645782-223645804 CCCAGGACTCCAAGGCTGCAGGG + Intergenic
948279167 2:236733272-236733294 CCCTGAGCCCCAGGGATGGAAGG + Intergenic
948631769 2:239307130-239307152 TCGTGGGCACCCAGGATGGACGG - Intronic
1172749543 20:37240655-37240677 CCCTAGACTCTAAGGAGGGATGG - Intronic
1174776789 20:53350362-53350384 CACTGGAATCCAAGGTTGGATGG + Intronic
1175334089 20:58183933-58183955 CCCTGGACTCCCAGGGTGTATGG - Intergenic
1175854663 20:62113972-62113994 CCCTGGGCACAAGGGGTGGACGG + Intergenic
1176051425 20:63121497-63121519 CCCAGGTCACCCAGGCTGGAGGG + Intergenic
1178422774 21:32455568-32455590 GCCTGGGATCCAAGGATGGATGG - Intronic
1178820434 21:35970264-35970286 CCCTGGAGATCAAGGGTGTAGGG + Intronic
1178995294 21:37393809-37393831 CCCAGGGCACCAGGCATGGAAGG - Intronic
1179594067 21:42430579-42430601 CCCAGGCGACCAGGGATGGACGG - Intronic
1179996645 21:44977367-44977389 CCCTGGTCACTGAGGATGGCAGG - Intergenic
1181009786 22:20033370-20033392 CCCTGGCCAGCTAGGATGGTGGG + Intronic
1182280637 22:29216112-29216134 CCCTGGGCTCCAGGGATGGGAGG + Intronic
1182287993 22:29259354-29259376 CACTGGACAACAAGGAGGGAGGG - Exonic
1182316613 22:29451753-29451775 GCCTGGACACCATGAATGCATGG + Intergenic
1182436469 22:30333918-30333940 CCATGCAAACCAAGGATGGATGG - Exonic
1184288241 22:43483971-43483993 CCCAGTGTACCAAGGATGGAGGG + Intronic
1184593682 22:45502319-45502341 CCCGGGACACCAGGGCCGGAGGG - Intronic
1184941052 22:47765585-47765607 ACCTGACCACCAAGGAGGGAGGG + Intergenic
1185149805 22:49157760-49157782 CCCTGGGCACGGAGGAGGGATGG + Intergenic
1185280374 22:49967282-49967304 GTCAGGACACCAAGGCTGGACGG - Intergenic
950219495 3:11183653-11183675 CCCTGGAAATCAAGGAAAGAAGG - Intronic
950634395 3:14304603-14304625 CCAGGGACACCAAAGAGGGATGG - Intergenic
953688842 3:45100216-45100238 CCATGGGCACCAGGGAAGGAAGG + Intronic
953998093 3:47536120-47536142 TCCTGGACAGTCAGGATGGAAGG - Intergenic
954423705 3:50432271-50432293 CCCTGGGCTCCACGCATGGAGGG + Intronic
958584503 3:96069168-96069190 GCCTGGGCACCATGGATGGCAGG - Intergenic
961558459 3:127712570-127712592 GCCTGGATGCCAAGGCTGGAGGG - Intronic
962161656 3:133007158-133007180 GCCTGGATGCCAAGGATAGAAGG + Intergenic
969249799 4:5959602-5959624 GCGTGGACACCAAGGACAGAGGG + Exonic
969362127 4:6671603-6671625 CTCTGGCCATCAAGCATGGAGGG + Intergenic
971607465 4:28676454-28676476 CCTTTGTCACCAAGGCTGGAGGG - Intergenic
972618683 4:40724612-40724634 CCCTTGTCACCCAGGCTGGAGGG - Intergenic
974420124 4:61662606-61662628 CCATGGGCACCATGGATGGCAGG + Intronic
975292039 4:72688630-72688652 CCCTTGACACCCAGGGTAGAGGG + Intergenic
976586349 4:86801255-86801277 CCCTGAGTGCCAAGGATGGATGG + Intronic
976990636 4:91360597-91360619 CCTTGGACACAAAGGATGGAAGG - Intronic
978184059 4:105836495-105836517 CCATGGGCACCATGGATGGCAGG - Intronic
982957679 4:161792360-161792382 GCATGGACACCATGGATGGCAGG + Intronic
985709185 5:1418750-1418772 AGCTGGACAGCATGGATGGATGG - Intronic
987212303 5:15695286-15695308 CCCTGGACACCAAGGATGGAAGG + Intronic
992743482 5:79796473-79796495 CCCAGGAGATCAAGGATGCATGG - Intronic
996043139 5:118839428-118839450 CCCAGGACATCAAGGTTGCAAGG - Intronic
996633117 5:125661084-125661106 TCCTGAAGACCAAGGATTGAGGG + Intergenic
997294166 5:132759619-132759641 CCATTGCCACCAAGGAAGGAAGG + Intronic
999230209 5:150057362-150057384 ACCTGGACAAGGAGGATGGACGG - Exonic
1001055967 5:168450241-168450263 CCTTGGACTCCAAGGTTGGAAGG - Intronic
1001124526 5:169007394-169007416 CCCTGATCACCAAGGATGAAGGG + Intronic
1001655325 5:173344736-173344758 CCCTGGACACCTAGGAGGATGGG - Intergenic
1001666621 5:173438475-173438497 CCCTGCTCACCAAGGACAGACGG + Intergenic
1001923851 5:175621995-175622017 CTCTGGACACCAAGGCTTGGTGG - Intergenic
1002332605 5:178454971-178454993 CCAAGGACACCAAGGATGGCAGG - Intronic
1006845229 6:37056857-37056879 CCCTGGACACCATGGAGGACGGG - Intergenic
1007163541 6:39811846-39811868 CCTTAGACACCAGGGTTGGATGG + Intronic
1018910483 6:168098560-168098582 CCCCGGTCACCAAGGCTGGTGGG - Intergenic
1019119630 6:169792723-169792745 CCCTGGGCATCCAGGGTGGAGGG + Intergenic
1020090825 7:5339596-5339618 CTCTTGTCACCCAGGATGGAGGG + Intronic
1020763495 7:12294319-12294341 CCCTGGAACCCAAGAATGGGAGG + Intergenic
1021526351 7:21593175-21593197 CCCTGGAAACCAATAATAGAAGG + Intronic
1021621567 7:22555014-22555036 CCCTGGAGCCCAAGGAGGGTGGG - Intronic
1022459109 7:30587189-30587211 CCCTGGGAATCAAGGAGGGAGGG + Intergenic
1023521065 7:41050369-41050391 CCATGTACACCAAGGACAGATGG - Intergenic
1023976338 7:45033008-45033030 CTCTTGTCACCAAGGCTGGATGG - Intronic
1023981850 7:45075023-45075045 CCCTGCAAACCAAGGAAGGTGGG + Intronic
1024208573 7:47184428-47184450 CACTGGAAACCAAGGAGGGAAGG + Intergenic
1025145722 7:56501000-56501022 CTCTGGACACCCAGGATGACTGG + Intergenic
1027189021 7:75987325-75987347 CCCTGGACAGGATGGATGGGGGG - Intronic
1027575157 7:79922220-79922242 CTTTGGGCACCATGGATGGAAGG + Intergenic
1028039443 7:86030695-86030717 TACTGGAAACCAGGGATGGAAGG + Intergenic
1032087578 7:128891867-128891889 CTCTGGACTCCAGGGCTGGAGGG - Intronic
1033541286 7:142358281-142358303 CCCTTGACACCAAGGCTGCCAGG - Intergenic
1035359953 7:158305093-158305115 GCCTGGACACCAAGGGAGGAGGG + Intronic
1036626792 8:10479205-10479227 TCCTGCCCACCGAGGATGGAGGG + Intergenic
1037909870 8:22737987-22738009 CCCGGGGCTCCAAGGGTGGACGG - Intronic
1040890142 8:52308810-52308832 ACCTGGACAGCAAATATGGAGGG - Intronic
1049386283 8:142344604-142344626 CTCTGGACACCCAGCAGGGAGGG - Intronic
1051224956 9:14889514-14889536 ACCTGGAAACCAAGGCTGGATGG + Intronic
1051400970 9:16681937-16681959 CGCTGGTGACCAAGGATGTAAGG + Intronic
1056421049 9:86426582-86426604 TCCTGGAAAACTAGGATGGAAGG - Intergenic
1057748203 9:97769352-97769374 TCCTAGACAGCAAGGAGGGAAGG + Intergenic
1058226420 9:102370233-102370255 CCATGGACACCACAGATGGGTGG - Intergenic
1060539786 9:124421519-124421541 CCCTGGATACGAAGAAGGGAGGG - Intergenic
1061295631 9:129675388-129675410 CCCTGGCCACCAAAGCTAGAGGG - Intronic
1061790125 9:133054818-133054840 CCCTGGAGGCCAGGAATGGAGGG + Intronic
1061898008 9:133658540-133658562 CCCTGCACGCCCAGGATGAAGGG + Exonic
1062024476 9:134333944-134333966 TGCTGGGCACCAAGGATGGCAGG - Intronic
1062409918 9:136418417-136418439 CGCTGGACGCCAGGGACGGAGGG - Intronic
1062599984 9:137315312-137315334 GCCTGGACACCAAGGTCTGAGGG - Intronic
1185483893 X:467945-467967 CCCCAGACACCAAGGCTGGATGG + Intergenic
1188582173 X:31727580-31727602 CTCTGGACACAAAAGATGGAAGG + Intronic
1189297439 X:39929030-39929052 CCATGGACCCCAAGAGTGGATGG + Intergenic
1190321683 X:49183696-49183718 CACTGGACAGCAAGAGTGGAGGG + Intronic
1192587260 X:72328900-72328922 TCCTAGACAGCCAGGATGGATGG + Intergenic
1195156412 X:102127432-102127454 CCTTGGACCCCTAGGATAGAAGG - Exonic
1195939479 X:110156118-110156140 GCCTGGACACAAAGCAAGGAAGG - Intronic
1197974353 X:132150320-132150342 CTCTGATCACCAAGGAGGGATGG - Intergenic