ID: 987224075

View in Genome Browser
Species Human (GRCh38)
Location 5:15821470-15821492
Sequence ATTCCACCCCTGCTGCTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987224071_987224075 -4 Left 987224071 5:15821451-15821473 CCAGTGGCCCCAGCTTGGAATTC 0: 1
1: 0
2: 2
3: 16
4: 231
Right 987224075 5:15821470-15821492 ATTCCACCCCTGCTGCTGAATGG 0: 1
1: 0
2: 0
3: 22
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987224075 Original CRISPR ATTCCACCCCTGCTGCTGAA TGG Intronic
900583765 1:3422708-3422730 TCTCCAACCCTGCTGCCGAAAGG + Intronic
908749968 1:67412318-67412340 ATTCCACCCACCCTGGTGAAGGG + Exonic
910274940 1:85439165-85439187 ATTCCACCCCTGCTAATTAATGG - Intronic
913580190 1:120218948-120218970 ATTCCACTCCAGCTACTGAAGGG + Intergenic
913627986 1:120679445-120679467 ATTCCACTCCAGCTACTGAAGGG - Intergenic
914562115 1:148830389-148830411 ATTCCACTCCAGCTACTGAAGGG + Intronic
914610715 1:149299832-149299854 ATTCCACTCCAGCTACTGAAGGG - Intergenic
915124200 1:153651941-153651963 CATCCACACCTCCTGCTGAATGG + Intergenic
918528330 1:185489001-185489023 AAACCACCCCAGCTGCTAAAAGG - Intergenic
922899143 1:229122907-229122929 ATTCCTGCCTTGCTGCTGAGTGG + Intergenic
923912733 1:238467140-238467162 GTTCCATTCCTGCTTCTGAAAGG + Intergenic
1063216143 10:3927306-3927328 GAGCCAGCCCTGCTGCTGAAGGG - Intergenic
1064631996 10:17325776-17325798 ATTCCACACTTGCTGATGAGAGG - Intronic
1067060257 10:43074760-43074782 GTTTCACCCCTTCTTCTGAAAGG + Intergenic
1067432551 10:46253511-46253533 CGTCCCCTCCTGCTGCTGAAGGG - Intergenic
1067440708 10:46307936-46307958 TGTCCCCTCCTGCTGCTGAAGGG + Intronic
1067524518 10:47030111-47030133 ATTCCAACCCTCCTTCAGAAAGG - Intergenic
1074145980 10:110717597-110717619 ATCCCACCCCTGCCGTTGACTGG + Intronic
1076336012 10:129706805-129706827 AATCCACCCCTGCTGGAGATGGG + Intronic
1076611270 10:131727230-131727252 TTTCCGCCCCTGCTGGGGAAGGG + Intergenic
1083806614 11:65078254-65078276 CTTCCACCCCTGCAGCAGAGTGG + Exonic
1083864648 11:65446875-65446897 AGTCCACCCCTGCAACTGCAAGG + Intergenic
1084670044 11:70600699-70600721 ATTCCACCAATGCTGCTGGAAGG + Intronic
1089339921 11:117750339-117750361 ATTCCTCCCATTCTGCTAAAGGG - Intronic
1090568448 11:128021413-128021435 CTTCCTCGCCTGCTGCTGCAGGG - Intergenic
1091278409 11:134368042-134368064 CTTCAGCCGCTGCTGCTGAATGG + Intronic
1091305877 11:134535786-134535808 ATTCCAGCCCTGCTCCGGAAGGG - Intergenic
1093773059 12:23039577-23039599 TCTCAACACCTGCTGCTGAAAGG - Intergenic
1094624138 12:32106850-32106872 ATTCCGCACCGGCTGCTGCAGGG + Intronic
1096120938 12:49089179-49089201 ATTTCGCTCCTGCGGCTGAAGGG - Intergenic
1098149065 12:67527957-67527979 ATTCAACCGCTGCTACTGAATGG - Intergenic
1099198882 12:79652328-79652350 ATTCCACTAATGCTGTTGAAAGG - Intronic
1101258939 12:103009413-103009435 ATTCCACTCTTTCTGCTCAAGGG - Intergenic
1101574093 12:105981385-105981407 ATTCCAGCCCTGCTCTTCAATGG + Intergenic
1101818233 12:108162329-108162351 ATTCCACCCGTGAGTCTGAAGGG - Intronic
1102051315 12:109864113-109864135 ATTCCTCCCCTACTGTTGAGCGG - Intronic
1103072771 12:117958335-117958357 TTTCCAACACTGCTGGTGAAGGG + Intronic
1103505677 12:121441159-121441181 ATCACACCCCTGATGCTGAGTGG - Exonic
1104408004 12:128534519-128534541 CTTCCAGCCCTGCTTCTGGAGGG - Intronic
1105570791 13:21601353-21601375 ATTCAGCCACTGATGCTGAAAGG + Intronic
1105583979 13:21726847-21726869 TTTCCACTCCTGCTCCTGGAAGG + Intergenic
1107213227 13:37884191-37884213 AATCCACCCTGGCTGCAGAATGG - Intergenic
1108434100 13:50384900-50384922 TCTCCACCCCTGCTGCAGAGAGG + Intronic
1110124391 13:71924484-71924506 TTTAGACCCCTGCTGCTCAATGG - Intergenic
1114769507 14:25412240-25412262 ATCACACCCCTGCTGGTCAAGGG - Intergenic
1115387606 14:32815764-32815786 ATTCCACCCCTGCTGTGTACCGG + Intronic
1121399075 14:93656156-93656178 AACTCACCCCTGCTGCAGAAGGG - Intronic
1121634173 14:95442630-95442652 GTTCCATCCCTACTGCTGGAAGG + Intronic
1122208979 14:100162737-100162759 ACCCCACCCCTGCTGCTGCCTGG - Intergenic
1122526891 14:102392864-102392886 ATTCAAACTCTGATGCTGAATGG + Intronic
1124018947 15:25902698-25902720 ATCACACCCCAGCTGCTCAAGGG - Intergenic
1124653581 15:31489807-31489829 ATTCCAGCCCTGCTGTTGAGGGG - Intronic
1124904038 15:33851681-33851703 ATTCCACGAGTGATGCTGAAGGG - Intronic
1129661153 15:77553850-77553872 ATTCCAACCCTCTTGCTGGAAGG + Intergenic
1131258558 15:90876775-90876797 GTACCATCCCTGCTCCTGAAAGG - Intronic
1137062108 16:35800250-35800272 ATTTAACCCCTGCTGCAAAAAGG + Intergenic
1137730754 16:50687896-50687918 ATTCCAGCCCTGCTCCTTAGCGG - Intergenic
1137768522 16:50996278-50996300 AGTCGACACCTGGTGCTGAAGGG - Intergenic
1138381502 16:56606058-56606080 TATCCACCCCTGCAGCTAAAAGG + Intergenic
1141013696 16:80427402-80427424 AATCCAGCTCTGCTGTTGAAGGG - Intergenic
1141185136 16:81781567-81781589 ATTCCACCCCTGCTCCTTTAGGG - Intronic
1141185317 16:81782915-81782937 ATTCCACCCCTGCTCCTTTAGGG + Intronic
1141658986 16:85431542-85431564 TTTCCAGCCCTGATGCTCAAAGG - Intergenic
1147510749 17:41066983-41067005 CTTCTAACCTTGCTGCTGAAAGG - Intergenic
1148686806 17:49505734-49505756 ACTACCCCCATGCTGCTGAAGGG - Intronic
1149436413 17:56637350-56637372 ATTCCAGCCCTTCTCCTGCAAGG + Intergenic
1152877171 17:82793510-82793532 TTTCCTGCCCTGCTGCTGAGGGG + Intronic
1153368253 18:4284249-4284271 ATTATACCTCTGCTGCTGAAAGG - Intronic
1154356305 18:13625058-13625080 ATCCAACCCCAGCTGCTGACTGG - Intronic
1155621779 18:27787463-27787485 CTTCCACCTCTGCTGCTGTAGGG - Intergenic
1156613033 18:38750166-38750188 ATTCCAGCCATGCTGCTCATGGG + Intergenic
1157521858 18:48351093-48351115 ATTCCCCAGCTACTGCTGAATGG + Intronic
1157751154 18:50179665-50179687 AATGCACCCCTGCTGCTGATGGG + Intronic
1159479295 18:68966869-68966891 ATTCCACCACAGCTGGGGAAGGG - Intronic
1161045590 19:2132718-2132740 TTAGCACCCCTGCTGCTGAGGGG + Intronic
1161067973 19:2247848-2247870 CCTCCACCCCCGCTGATGAACGG + Exonic
1164382670 19:27748290-27748312 ATTTAACCCCTGCAGCAGAAAGG + Intergenic
1166385116 19:42376431-42376453 CTGGCACCCCTGCTGCTGACAGG + Exonic
925982087 2:9185080-9185102 AGTCCCCCCCAGCTACTGAAGGG - Intergenic
927687168 2:25179109-25179131 TTTCCATGCCTGCTGCTCAAAGG + Intergenic
928403112 2:30993499-30993521 ATTCCTCCTCTGCTGTAGAAGGG + Intronic
930157830 2:48123779-48123801 ATCCCACCCCTGCTGGTCCATGG - Intergenic
931954081 2:67397958-67397980 ACTCCACCACTGCTGCTGACTGG - Intronic
937481211 2:122261481-122261503 ACTCCATCTCTGCTGCTGACTGG + Intergenic
938146173 2:128836339-128836361 ATTCAACCCTTGATGCTGACAGG - Intergenic
942882774 2:180883021-180883043 ATCCCACCACTGCTGCTGCAGGG + Intergenic
946680716 2:222212460-222212482 ATTGCACCTCTGCTGATCAATGG - Intronic
946798878 2:223388181-223388203 ATTCCAACCACTCTGCTGAATGG - Intergenic
947377491 2:229511363-229511385 ATGCCATTCCTGCTCCTGAAGGG + Intronic
947740106 2:232481051-232481073 GCTCCACCCCTGCTGCAGGAGGG - Intronic
948352353 2:237351191-237351213 ATTCCTCCCCTCCTGCTCCAGGG - Exonic
1169908081 20:10623763-10623785 ATTGTACCCCTGGAGCTGAAAGG - Exonic
1172915530 20:38440661-38440683 ATTCCATCTCTTCTGGTGAAGGG - Intergenic
1173293924 20:41739060-41739082 AATCCAGCCTTGCTGCTGGAGGG - Intergenic
1175367831 20:58467651-58467673 CTTCCACCCCTGCAGCTGCGAGG - Exonic
1175627166 20:60499165-60499187 ATACACCCCCTTCTGCTGAAAGG + Intergenic
1175681219 20:60990140-60990162 AGTCCACTGCTGCTGCTGGAGGG + Intergenic
1176143536 20:63555328-63555350 TTCCTAACCCTGCTGCTGAAAGG - Exonic
1180099050 21:45575850-45575872 GTTCCCCACCTGCTGCTGGACGG + Intergenic
1183745819 22:39691120-39691142 ATTCCCCTCCTGCTGATGACCGG - Intergenic
1183857302 22:40643724-40643746 ATTCTGCTGCTGCTGCTGAAAGG + Intergenic
949994161 3:9603051-9603073 ATTTCTCCCATGCTGCTGCAGGG - Intergenic
952495291 3:33910605-33910627 ACCCCACCCCTGCCTCTGAAGGG - Intergenic
953302075 3:41787354-41787376 ATGCTACCCCGGCTGCTGAGGGG - Intronic
953343584 3:42156313-42156335 TTTCCTCCCCTCCTGCTGCAAGG - Intronic
953533429 3:43758474-43758496 CTTCCACAGCTGCTACTGAAGGG - Intergenic
954659521 3:52219510-52219532 ATTTCTCCCCTGCTCCTCAAAGG + Intergenic
954761219 3:52875824-52875846 CCTCCACCCCTGCTGGGGAATGG - Intronic
954806451 3:53223674-53223696 CTCCCACCCCTGCTGGTAAAGGG - Intergenic
954807011 3:53226494-53226516 ATTCCAACCTCGCTGCTAAATGG - Intronic
955650174 3:61185556-61185578 AAAGCACCTCTGCTGCTGAATGG - Intronic
956075764 3:65503544-65503566 TTTACACACCTGCTGTTGAATGG - Intronic
961386748 3:126527101-126527123 ATTCCACTCCCGCGGCTGCAGGG + Intronic
962821066 3:139047546-139047568 CGTCCACCCTTGCTTCTGAATGG - Intronic
964633181 3:158834578-158834600 ATTCCATTCCTACTGCTTAAAGG - Intergenic
965541650 3:169877624-169877646 ATTTCTCCCCTGCTGCTCTATGG + Intergenic
966375932 3:179295754-179295776 ATTAGTCCCCTGCTTCTGAACGG - Intergenic
967976147 3:195035736-195035758 CCCCCATCCCTGCTGCTGAAGGG - Intergenic
968348998 3:198036647-198036669 ATTCCCCTCCTGCTTCTAAAGGG - Intronic
969039022 4:4279471-4279493 ATTCCACACCTGGTCCAGAATGG + Exonic
969683011 4:8653549-8653571 ACTCCACCCCTGCTGCAGGAGGG - Intergenic
973777809 4:54259197-54259219 ATCCCACCTCAGCTGCTCAAGGG - Intronic
977386360 4:96344690-96344712 ATGCCACCCCTGATGGGGAAGGG + Intergenic
979490441 4:121320537-121320559 TTTCCACCCCTGGGCCTGAAGGG - Intergenic
979547670 4:121955720-121955742 ATCCCACCTCTGCTGCTCACAGG + Intergenic
985774176 5:1832024-1832046 CTTCCACTCCTGCTGTTGCAGGG + Intergenic
986588875 5:9347923-9347945 ATCCCACCCCTGTTTCAGAAAGG - Intronic
986632839 5:9791315-9791337 ATTGCACTCGTCCTGCTGAATGG - Intergenic
987224075 5:15821470-15821492 ATTCCACCCCTGCTGCTGAATGG + Intronic
987426047 5:17773835-17773857 ATTTGACCTCTGCTACTGAAAGG + Intergenic
987792269 5:22582951-22582973 ATGAAACCCCTGCTGCTAAAGGG + Intronic
987954008 5:24714531-24714553 ATTCCAACCCTTATGGTGAAAGG - Intergenic
991607559 5:68418972-68418994 ATTTCACCCCTCCTGCTGCCTGG + Intergenic
993423048 5:87725890-87725912 CTTCCATGCCTACTGCTGAAAGG - Intergenic
995660558 5:114478117-114478139 AATCTATCCCTGCTGCTGCAAGG + Intronic
997010996 5:129877130-129877152 ATTCAAACACTGCTACTGAAAGG + Intergenic
997560162 5:134839603-134839625 ATTCATACCCTGCAGCTGAAGGG + Intronic
999367143 5:151030462-151030484 ACTCCTTCCCTGCTGCTGAGTGG - Exonic
999432521 5:151536511-151536533 ATTCCTGCCCTGCTGCTGCAGGG - Intronic
1006255437 6:32829020-32829042 ATTCCAGTCCTGCAGCTGAAGGG + Intronic
1008540856 6:52545534-52545556 ATTCCTCCCCTACTCCTGCAAGG - Intronic
1010029092 6:71254503-71254525 CTTCTGCCGCTGCTGCTGAAAGG + Intergenic
1011310633 6:85975969-85975991 ACTCCACCCCTCATTCTGAAAGG + Intergenic
1012497352 6:99848609-99848631 GATGCACTCCTGCTGCTGAAAGG + Intergenic
1017632385 6:156409042-156409064 ATTGGAATCCTGCTGCTGAAGGG + Intergenic
1019597604 7:1865389-1865411 ATCCCAGCCCTGCTGCTGCCCGG + Intronic
1024089550 7:45923964-45923986 AGCCCACTCCTGCTGCTAAAGGG + Intergenic
1025734338 7:64133578-64133600 ATTCCACCCCTGTCTCTGCATGG - Intronic
1026585982 7:71656551-71656573 GTTCCACCCTGGCTGCTGAGCGG + Intronic
1028602895 7:92621701-92621723 ATGTTACCCCTGCTTCTGAATGG - Intronic
1029572068 7:101376590-101376612 AGCCCACCCTTGCTGCTGCAGGG + Intronic
1034498598 7:151436115-151436137 CTCCCACGCCTGGTGCTGAAGGG + Intronic
1035727864 8:1835620-1835642 CTTCCCACCCTGCTGCTGGATGG + Intronic
1035856392 8:2980634-2980656 GTTCCACCACGGCTGGTGAAGGG + Intronic
1038952505 8:32431365-32431387 ACTCCACCCTTGCTGATAAACGG + Intronic
1039595940 8:38789730-38789752 ATGCCACTCCTTCTGCTGGAAGG - Intronic
1039855953 8:41414384-41414406 ATTTCTCCCCTGCTTCAGAATGG + Intergenic
1041700347 8:60781886-60781908 ATTTCAACCCTGCTCCTGGAAGG - Intronic
1045659129 8:104418215-104418237 ATTGCACCCTAGATGCTGAAGGG - Intronic
1049046264 8:140154404-140154426 TTTGCACCCCAGCTGCTGGATGG - Intronic
1051378281 9:16427738-16427760 ATTCCATCTCTGCTGATGAATGG + Intronic
1057198749 9:93129437-93129459 CATGCACCCCTGCTGGTGAAGGG + Intronic
1057750868 9:97791922-97791944 TTTCCACCCTGGCTGCTGAGTGG + Intergenic
1059875440 9:118629260-118629282 TTTCCACCACTGCTGCTGATGGG - Intergenic
1060335290 9:122716395-122716417 CCTCCACCCCTGCTGCTGCATGG + Intergenic
1060681183 9:125566516-125566538 ATTGCACCCCTGCAGCAGCATGG + Intronic
1061357810 9:130119565-130119587 ATTCCAACTCTGCTGCTCACTGG - Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1062577824 9:137216749-137216771 ATGCCACCCCTGGTGCTCACTGG - Exonic
1195120068 X:101740582-101740604 ATACCACCTCTGCTACAGAAGGG + Intergenic
1195870019 X:109475787-109475809 TGTCCACACCTGCTGCGGAAGGG + Exonic
1198300227 X:135327203-135327225 ACTCCACCCCTGCTGTATAATGG - Intronic