ID: 987225252

View in Genome Browser
Species Human (GRCh38)
Location 5:15833146-15833168
Sequence CTTTATCAGCAGAATGAAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7095
Summary {0: 3, 1: 43, 2: 1640, 3: 2795, 4: 2614}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987225249_987225252 15 Left 987225249 5:15833108-15833130 CCTCTTTCTTTTGTAAATTGCGT 0: 1
1: 117
2: 1897
3: 1884
4: 2265
Right 987225252 5:15833146-15833168 CTTTATCAGCAGAATGAAAGCGG 0: 3
1: 43
2: 1640
3: 2795
4: 2614

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987225252 Original CRISPR CTTTATCAGCAGAATGAAAG CGG Intronic
Too many off-targets to display for this crispr