ID: 987225810

View in Genome Browser
Species Human (GRCh38)
Location 5:15840352-15840374
Sequence TTGGAAAAGAATGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1380
Summary {0: 1, 1: 1, 2: 9, 3: 121, 4: 1248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987225810_987225815 20 Left 987225810 5:15840352-15840374 CCCTCCTCCTCATTCTTTTCCAA 0: 1
1: 1
2: 9
3: 121
4: 1248
Right 987225815 5:15840395-15840417 TTACTCTTTCATATGAATTTTGG 0: 1
1: 2
2: 9
3: 79
4: 607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987225810 Original CRISPR TTGGAAAAGAATGAGGAGGA GGG (reversed) Intronic
900199182 1:1395687-1395709 TTGGGAAGGGATGAGGAGGTTGG - Intronic
900500858 1:3003844-3003866 TTTGACAATAATGAGAAGGAAGG - Intergenic
900522302 1:3111551-3111573 AAGGAAGAGAAGGAGGAGGAAGG + Intronic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901743740 1:11359079-11359101 TTGGAACAGATGGAGGAGGGAGG - Intergenic
901972731 1:12920539-12920561 TGGGAAAGGAATGAGGATGCAGG + Intronic
902012449 1:13281223-13281245 TGGGAAAGGAATGAGGATGCAGG - Exonic
902095416 1:13940167-13940189 TTCCAAAAGAATGAAGAGGAGGG - Intergenic
902131828 1:14268420-14268442 TTTGTATAGAATGAGAAGGATGG + Intergenic
902161250 1:14532159-14532181 CTGGGAAAGAAAGAGCAGGATGG - Intergenic
902391196 1:16107934-16107956 CTGGAAAAGAAAGATCAGGAGGG + Intergenic
902653840 1:17854073-17854095 GGGGAAAAGAAAGAAGAGGAAGG - Intergenic
903864758 1:26389912-26389934 TAGGAGCAGAATGAGGAGGAAGG + Intergenic
904145092 1:28384197-28384219 TTCCAAAAGAATGAAGAGGAGGG - Intronic
904262586 1:29298375-29298397 TTGGAAAAGAAGGAAGTGGAAGG - Intronic
904482074 1:30800414-30800436 CTGGAGCAGAGTGAGGAGGAAGG + Intergenic
905121640 1:35686819-35686841 TTGCAAAAAAACGAGGAGGTAGG - Intergenic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905942944 1:41878760-41878782 TAGGAAGAGAGGGAGGAGGAGGG - Intronic
906103570 1:43278399-43278421 CGGGAAGGGAATGAGGAGGAAGG + Intergenic
906192400 1:43906297-43906319 TAGGAAGAGAAACAGGAGGAGGG - Intronic
906273924 1:44501940-44501962 GAGAAAAAGAAGGAGGAGGAAGG + Intronic
906551031 1:46666668-46666690 TTGAAAAAGAATGGAGAGGAGGG - Intronic
906776239 1:48532112-48532134 TTAGAAAGGAATGAGGAGACTGG - Intergenic
906895650 1:49768130-49768152 TTCCAAAAAATTGAGGAGGAGGG + Intronic
907061811 1:51434628-51434650 TTGGAAATGAATGGTGATGATGG + Intronic
907190741 1:52645928-52645950 TTGGAAAACAAAGAAGAGGAGGG + Intronic
907535685 1:55153877-55153899 TTGGAAAAAAACAAGAAGGATGG - Exonic
907828331 1:58039604-58039626 CTGAAAAAGAATGTGGGGGACGG - Intronic
908185533 1:61649322-61649344 CTGGAAAATCATTAGGAGGAAGG - Intergenic
908752672 1:67439597-67439619 TAGGAAGAGAATGAGGAGGCTGG - Intergenic
908864693 1:68533832-68533854 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
909227231 1:73041472-73041494 TTGGAAAAGCCTCAGTAGGAAGG + Intergenic
909421781 1:75475305-75475327 AAGGAAAGGAATGATGAGGAAGG + Intronic
909733975 1:78933034-78933056 TTCCAAAAAATTGAGGAGGAGGG + Intronic
909882793 1:80901162-80901184 TTTCAAAAAATTGAGGAGGAGGG + Intergenic
909898720 1:81107246-81107268 TTCCAAAAAATTGAGGAGGATGG - Intergenic
910556030 1:88533979-88534001 TTGTATAAGAATTAGCAGGAAGG - Intergenic
910563924 1:88622176-88622198 TTCCAAAAAACTGAGGAGGAGGG + Intergenic
910581437 1:88829960-88829982 TTGGAAAAGGAGGAGAAGTATGG + Intronic
910657282 1:89632502-89632524 GTGGGATAGAATGAGGAAGATGG - Intergenic
910748061 1:90595330-90595352 TTTCAAAAGATTGAGGAGAAGGG + Intergenic
911044762 1:93619282-93619304 GTGGAAAAGAGGGATGAGGAAGG + Intronic
911125255 1:94335386-94335408 GTGGAGAAGAATGAGGCTGAGGG - Intergenic
911310410 1:96285851-96285873 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
911329454 1:96510399-96510421 TTTGAAAAGGATTAGGAGAACGG - Intergenic
911458271 1:98155218-98155240 TTACAAAAAATTGAGGAGGAGGG + Intergenic
911561272 1:99408897-99408919 TTGGAAAAAAAGGAAAAGGATGG - Intergenic
911667527 1:100570951-100570973 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
911932758 1:103925839-103925861 TCAGAAAAGTTTGAGGAGGATGG + Intergenic
911936581 1:103983039-103983061 TTAGATATGAATGTGGAGGAAGG + Intergenic
912156138 1:106922769-106922791 TTTGTTAAGATTGAGGAGGAGGG - Intergenic
912385279 1:109268368-109268390 TATGTAGAGAATGAGGAGGAGGG + Intronic
912601437 1:110938165-110938187 TTCTGAAAAAATGAGGAGGAAGG + Intergenic
912639094 1:111327389-111327411 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
912669895 1:111615996-111616018 TAGGCATAGAATGAGGAAGATGG + Intronic
913380005 1:118200124-118200146 TACGAAAAGCATGAGGAGGAAGG + Intergenic
913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG + Intergenic
914512950 1:148350971-148350993 TTTAAAAAGAAAGAGAAGGAAGG + Intergenic
914960780 1:152204536-152204558 TTCAAAAAGAATGAGGAGTCAGG + Intergenic
915000786 1:152588197-152588219 TTCCAAAAAATTGAGGAGGAAGG + Intronic
915005608 1:152632506-152632528 TTCCAAAATATTGAGGAGGAGGG + Intergenic
915138356 1:153750002-153750024 TTGGAAGGGAGTGAGAAGGAGGG - Intronic
915640746 1:157224005-157224027 TTCTAAAAGATTGAAGAGGAGGG - Intergenic
915779471 1:158530462-158530484 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
915803823 1:158823243-158823265 TTCAAAAAAATTGAGGAGGAAGG - Intergenic
915976730 1:160396074-160396096 TTGGAAAAGCATGTGGAGTGGGG + Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916593907 1:166223568-166223590 TTCCAAAAGATTGAGGAGGAGGG - Intergenic
916802943 1:168231611-168231633 AAGGAAAAGACAGAGGAGGAAGG - Intronic
916904386 1:169266069-169266091 TTCCAAAAAATTGAGGAGGAGGG + Intronic
917001320 1:170363828-170363850 TTGGAATAGTTTCAGGAGGATGG + Intergenic
917138555 1:171811524-171811546 TTGGAAGAGAAAGAGTGGGAAGG + Intronic
917148686 1:171921565-171921587 TTTAAAAAAAAGGAGGAGGAGGG - Intronic
917363725 1:174205321-174205343 TTCCAAAAAACTGAGGAGGAGGG - Intronic
917476214 1:175371552-175371574 ATGGAAAAGAATAATGACGAAGG + Intronic
917489008 1:175481640-175481662 TTGGAAAAGAAGGTGGTGGGTGG + Intronic
917551802 1:176040313-176040335 TCAGAAAAGAAAGAGAAGGAGGG - Intronic
917673278 1:177294616-177294638 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
918746977 1:188215051-188215073 TTCCAAAATATTGAGGAGGAAGG - Intergenic
918827100 1:189338094-189338116 TTTCAAAAAATTGAGGAGGAGGG + Intergenic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919207800 1:194439461-194439483 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
919330247 1:196161961-196161983 TTAGGAAAGAATGTGGAGTAAGG + Intergenic
919376946 1:196807070-196807092 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
919389481 1:196964410-196964432 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
919406978 1:197197516-197197538 TTGGAAAAAAAGGAAGGGGAAGG + Intronic
919568143 1:199215127-199215149 TTCCAAAATATTGAGGAGGAGGG - Intergenic
919570769 1:199244065-199244087 TTGGGAAAGATTGTGAAGGAAGG - Intergenic
920365098 1:205444125-205444147 ATGGAAAAGGAGGGGGAGGATGG - Intronic
920517533 1:206597372-206597394 TAGGAAAAGCAGGAGGTGGAAGG + Intronic
920725992 1:208435737-208435759 TAGGTACAGAATGAGGAAGATGG + Intergenic
920817485 1:209348537-209348559 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
920935324 1:210428217-210428239 TAGGAAAAAAATGATGTGGAAGG - Intronic
921148689 1:212382990-212383012 TTGGAAAAGGAAGAAGGGGAAGG - Intronic
921751640 1:218800975-218800997 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
921837946 1:219796860-219796882 TTGCAACACAATTAGGAGGAAGG + Intronic
921969339 1:221129203-221129225 ATGGGAAGGAAGGAGGAGGAGGG + Intergenic
922029827 1:221787209-221787231 TTGGAAAAGAAAAAAGAGAATGG + Intergenic
922171710 1:223161104-223161126 TGGGTAAAGAAGGAAGAGGAAGG + Intergenic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
922980892 1:229825934-229825956 TGGGAAAAAAATTAGGAGAATGG - Intergenic
923069020 1:230545880-230545902 CTAGAAAAGGTTGAGGAGGAGGG + Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923209889 1:231794132-231794154 TAGGAAAAGAGAGAGAAGGATGG - Intronic
923548853 1:234945397-234945419 GTGGAAAAGAATGAGTAGGCAGG + Intergenic
923649779 1:235863656-235863678 TGGGAAAAGAATGACTAGGTTGG + Intronic
923850164 1:237785632-237785654 TTAGATAAGAATGAAGAGGTAGG + Intronic
924307611 1:242707507-242707529 AGGGAAAAGACGGAGGAGGATGG - Intergenic
1063213180 10:3899765-3899787 TTGGAAAAGAAAGAAAAGAAAGG + Intergenic
1063500931 10:6553610-6553632 GTGGAGGAGAAGGAGGAGGAAGG - Intronic
1063922788 10:10948708-10948730 TAGGTAGAGAATGAAGAGGAAGG - Intergenic
1064443601 10:15373996-15374018 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1064462767 10:15551029-15551051 TTGGAGAAGAATGGGGTGGATGG + Intronic
1064652284 10:17521677-17521699 TTGGATATGAATGAGGGAGAAGG - Intergenic
1064731516 10:18335908-18335930 TTTGAAGAGAAGGATGAGGATGG - Intronic
1064777811 10:18798686-18798708 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1065059644 10:21886435-21886457 TTCCAAAAAACTGAGGAGGAAGG + Intronic
1065403612 10:25336090-25336112 TTGTAAAAAAATGTGGATGATGG + Intronic
1065469631 10:26064368-26064390 TTGGAAAGAATTGAGTAGGAGGG + Intronic
1065499991 10:26370729-26370751 TTCCAAAAAAATGAGGAGGAGGG - Intergenic
1065712173 10:28529252-28529274 TGGGAAAAGAATGAGAAAGCAGG + Intergenic
1065754833 10:28921812-28921834 TTGGAAAAAAAGGGAGAGGAGGG + Intergenic
1066008568 10:31171070-31171092 GTGGAAAAGAGGGACGAGGAAGG - Intergenic
1066144138 10:32539019-32539041 TTCAAAAAAACTGAGGAGGAGGG - Intronic
1066150707 10:32613613-32613635 TTGGAAACAAATGAGAAGAAAGG - Intronic
1066233716 10:33464946-33464968 TTGGAATAGATTGAGATGGAAGG - Intergenic
1066279371 10:33900230-33900252 TTAGAAAAAAATTAGCAGGAGGG - Intergenic
1066415080 10:35214266-35214288 AGGGAAAAGAATGAGGAGGAAGG - Intergenic
1066522856 10:36242154-36242176 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1066753033 10:38679198-38679220 TTCCGAAAAAATGAGGAGGAAGG + Intergenic
1067083823 10:43227921-43227943 ATGGCAGAGAAGGAGGAGGAGGG - Intronic
1067245907 10:44543256-44543278 TCCCAAAACAATGAGGAGGAGGG - Intergenic
1067730108 10:48804616-48804638 GTGGAGAAAAATGTGGAGGAGGG - Intronic
1067976486 10:51031527-51031549 ATGGGAAAGAATGAGGAAGAAGG + Intronic
1068033189 10:51728717-51728739 ATGGAATAGAATGATGAGAAAGG + Intronic
1068367609 10:56070900-56070922 ATGCAAAAGAATGTGGAGGTGGG - Intergenic
1068462666 10:57347952-57347974 TTTTAAAAAATTGAGGAGGAGGG - Intergenic
1068544573 10:58331424-58331446 TTGGAAAATGCTGGGGAGGAAGG - Intergenic
1068663975 10:59653117-59653139 TTGGATAAGAATAAGCAGGCAGG + Intronic
1069143156 10:64854018-64854040 TTGGAAAAAAATAAGGAATATGG - Intergenic
1069185645 10:65419043-65419065 TGGGAAAATAATGATGAGCAAGG - Intergenic
1069190933 10:65488780-65488802 TTCCAAAAGATTGAGAAGGAGGG + Intergenic
1069355984 10:67585371-67585393 TTACAAAAAATTGAGGAGGAAGG - Intronic
1069374008 10:67775479-67775501 TGGGAAAAGAAAGAGCCGGAAGG + Intergenic
1069612226 10:69781922-69781944 ATGGAAATGAATGAGGTGGGAGG + Intergenic
1069652993 10:70064691-70064713 CAAGAAAAAAATGAGGAGGAAGG - Intronic
1069718510 10:70535551-70535573 AAGGAAGAGAAGGAGGAGGAAGG - Intronic
1070189262 10:74096537-74096559 TTGCAAAACAATGAGGGTGATGG + Intronic
1070356601 10:75646084-75646106 TAGGAAAAGAATGTGGGGGGAGG - Intronic
1070434731 10:76379262-76379284 TTCCAAAAAATTGAGGAGGAAGG - Intronic
1070616222 10:77971389-77971411 TTAGCAAAGAAAGAGGGGGAGGG - Intronic
1070886963 10:79909107-79909129 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1071024559 10:81097465-81097487 GAGGGAAAGAATAAGGAGGAAGG - Intergenic
1071093286 10:81945270-81945292 AGGAAAAAGAAGGAGGAGGAAGG - Intronic
1071199492 10:83203050-83203072 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1071357826 10:84816156-84816178 TTTCAAAATATTGAGGAGGAAGG - Intergenic
1071388925 10:85150379-85150401 TAGGAAAAAGAGGAGGAGGAAGG - Intergenic
1071454036 10:85828914-85828936 TTCCAAAAAATTGAGGAGGAGGG + Intronic
1071611428 10:87034934-87034956 TTCCAAAAAAGTGAGGAGGAGGG - Intergenic
1071858415 10:89648452-89648474 TTGGAAGAGAGTGAGGGAGAAGG + Intergenic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1072368530 10:94740409-94740431 TTCCCAAAAAATGAGGAGGAGGG - Intronic
1072862138 10:99017560-99017582 TTTCAAAAAATTGAGGAGGAGGG - Intronic
1073029950 10:100517867-100517889 TTAGAAGAGAATGAGGGAGAAGG - Intronic
1073085739 10:100887493-100887515 TTGAGGAAGAATGAGGAGCAAGG - Intergenic
1073359659 10:102887849-102887871 CTGGAAAAAGAAGAGGAGGAAGG - Intronic
1073732042 10:106300513-106300535 TTGCAAAGGAATGAGAATGATGG - Intergenic
1074013887 10:109512908-109512930 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1075014135 10:118897720-118897742 TTGGAACAGAAAGAGGAGTGGGG - Intergenic
1075100906 10:119505480-119505502 TCGGACAAAAATGAGGAGGGAGG + Intronic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075828428 10:125381511-125381533 TTACAAAAAATTGAGGAGGAGGG - Intergenic
1076163993 10:128267783-128267805 GAGGAAAGGAAGGAGGAGGAAGG - Intergenic
1076318947 10:129564389-129564411 GAGGAAGAGAAGGAGGAGGAGGG - Intronic
1076323613 10:129602736-129602758 CTGGAAAGGAAGGAGGGGGAGGG - Intronic
1076772875 10:132676681-132676703 TTGGAGCAGAGTCAGGAGGAGGG - Intronic
1077143727 11:1035809-1035831 TTGGAGAGGAAGGAGGAGCACGG + Intronic
1077427261 11:2488407-2488429 TTGGGAAAGATTGAGAAGGATGG + Intronic
1077534722 11:3118244-3118266 TTGGAATAGAATGGGGGGGCAGG - Intronic
1077634373 11:3832032-3832054 CTGGAAAAGGATGATGAGTATGG + Intronic
1078244097 11:9557709-9557731 TTCAAAAAAATTGAGGAGGAGGG - Intergenic
1078304584 11:10171673-10171695 TTCCAAAAAATTGAGGAGGAGGG - Intronic
1078373729 11:10774866-10774888 TTGGGAAAGAAGGAAGAGGAAGG + Intronic
1078423900 11:11234031-11234053 TTGGAAATGAATGCGAAGGAGGG - Intergenic
1078619054 11:12891161-12891183 TAGGATAGGAATGAGAAGGAAGG - Intronic
1078648583 11:13166071-13166093 TTGGAAAAGAAAGAGCATGGGGG + Intergenic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1078816408 11:14826774-14826796 TTACAAAAAAATGAGGAGGAAGG + Intronic
1078850966 11:15163320-15163342 AGGGAAAAGAATGAGAAGGAAGG - Intronic
1078868582 11:15322823-15322845 TTGGAAAAGAATGCTGATGTTGG + Intergenic
1079091791 11:17485855-17485877 ATGGAAAATAATGGGGTGGAGGG + Intergenic
1079333579 11:19552491-19552513 TGGGAGAAAAGTGAGGAGGAGGG - Intronic
1079386858 11:19988164-19988186 AAAGAAAAGGATGAGGAGGATGG - Intronic
1079627328 11:22631850-22631872 TTGCAAAAGATTGAGAAAGAGGG - Intronic
1079777209 11:24546807-24546829 TTTTAAAAAATTGAGGAGGAAGG - Intronic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1079975011 11:27080022-27080044 TTTAAAAAGAAAGAGCAGGATGG - Intronic
1080018903 11:27537937-27537959 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1080119275 11:28657710-28657732 ATGGAAAAAGATGAAGAGGAGGG + Intergenic
1080264686 11:30388487-30388509 TTGGGAGAGAAGGAGCAGGAGGG + Intronic
1080384770 11:31804814-31804836 TTTGAAATGAGTGAGGAGGGAGG - Intronic
1081010058 11:37799826-37799848 TTCTCAAAAAATGAGGAGGAGGG + Intergenic
1081303044 11:41477024-41477046 CTGTTACAGAATGAGGAGGAGGG + Intergenic
1081389371 11:42511566-42511588 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
1081563862 11:44244092-44244114 TTTGAGCAGAATGAGAAGGATGG - Intronic
1081659487 11:44879267-44879289 TAGGGAAAGAAGAAGGAGGAAGG - Intronic
1081780121 11:45704654-45704676 TGGGAGAAGAAAGAGGAGGTGGG - Intergenic
1081850981 11:46275009-46275031 GTAGAAGAGAAAGAGGAGGAAGG - Intergenic
1081867234 11:46366596-46366618 GTGGGCATGAATGAGGAGGAGGG + Exonic
1081973488 11:47215903-47215925 TAGGAAAAGAAGGAATAGGAAGG - Intronic
1082757659 11:57093676-57093698 TAGGAAAAGTATGTGCAGGAGGG - Intergenic
1082886110 11:58084397-58084419 TTCTAAAAAATTGAGGAGGAGGG + Intronic
1083806317 11:65076461-65076483 TTGGAAGAAAAAGAAGAGGAAGG + Intronic
1083992003 11:66252145-66252167 TGGGAAAAGAATGAGAAATACGG - Intergenic
1084694288 11:70744537-70744559 TTGGAAAGGAGCAAGGAGGAGGG - Intronic
1085333968 11:75676640-75676662 TTGCAAAAGATTTAGGATGAAGG - Intergenic
1086048821 11:82565065-82565087 TTGTTAAAGAGAGAGGAGGAGGG + Intergenic
1086121840 11:83312594-83312616 TTGGAAAAGAAAGCTCAGGATGG - Intergenic
1086523160 11:87695046-87695068 TTCCAAAATATTGAGGAGGAGGG - Intergenic
1086952596 11:92906235-92906257 GAGGAAAAGGAAGAGGAGGAGGG + Intergenic
1087310075 11:96531209-96531231 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1087513236 11:99125071-99125093 TTACAAAAAATTGAGGAGGAAGG + Intronic
1087555856 11:99720131-99720153 TTTCAAAAAATTGAGGAGGAGGG + Intronic
1087726678 11:101725989-101726011 AAGGAAGAGAATAAGGAGGAAGG + Intronic
1087731689 11:101785380-101785402 TTCGTAAAAATTGAGGAGGAGGG - Intronic
1087981124 11:104615931-104615953 AAAGAAAAGAAAGAGGAGGAAGG - Intergenic
1088183201 11:107135341-107135363 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1088446939 11:109941020-109941042 TTTGAAAACAAGGAGGAGGAAGG + Intergenic
1088552725 11:111030337-111030359 TTTCAAAAGATTGAGAAGGAGGG + Intergenic
1088614262 11:111608097-111608119 TTCGAAAAGATGGAGGTGGAAGG - Intronic
1088673178 11:112164106-112164128 TGGGGAGAGAATGAGGAAGAAGG + Exonic
1088889093 11:114030707-114030729 TTGGATAAGATAGAGGAGAATGG - Intergenic
1089152087 11:116372094-116372116 TTGGACAAGTATGGGGAAGAGGG - Intergenic
1089458988 11:118641746-118641768 ATGGAAGCGAACGAGGAGGAGGG - Intronic
1089535756 11:119160092-119160114 TTGAACAAGAATGTGGAGGCAGG + Intronic
1089700353 11:120240569-120240591 CTGGAAAAGAATGAGGGTGGGGG + Intronic
1089787175 11:120916040-120916062 TCCTAGAAGAATGAGGAGGAAGG + Intronic
1089891324 11:121884256-121884278 ATGGGACAGAATGAGAAGGAGGG + Intergenic
1090105316 11:123848539-123848561 TTTCAAAAAACTGAGGAGGAGGG - Intergenic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090663388 11:128898094-128898116 TTGGAAAAGAATAAAGTGGAAGG - Intronic
1090678432 11:129027506-129027528 TTGGTAAAGGGTCAGGAGGAAGG - Intronic
1091094443 11:132806792-132806814 TTTGAAAAGAATGTGTATGATGG - Intronic
1091112185 11:132979814-132979836 TTGTAAGAGACTGAGAAGGAAGG + Intronic
1091259274 11:134221534-134221556 TTAGAAAAGAATGGGAAGGGGGG - Intronic
1091356111 11:134938853-134938875 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1091413506 12:259970-259992 ATGGAAAAGAAGGAGGAAGATGG - Exonic
1091632810 12:2174956-2174978 TAGGAAGAGGAGGAGGAGGAGGG + Intronic
1091833561 12:3568249-3568271 ATGGAATAGGCTGAGGAGGAGGG + Intronic
1091938664 12:4454562-4454584 TTGGAAAGGTCTCAGGAGGAAGG + Intergenic
1092511609 12:9162755-9162777 TTGGGAAAAAAAGAGTAGGATGG - Intronic
1092882691 12:12900265-12900287 TGGGGCAAGAATGAGGATGAGGG + Intronic
1092931479 12:13319912-13319934 ATGGAAAGAAAGGAGGAGGAAGG + Intergenic
1093146293 12:15570650-15570672 TTGGAAATGAATGAGGAGGATGG + Intronic
1093219729 12:16405521-16405543 TTCCAAAAAATTGAGGAGGAGGG + Intronic
1093452247 12:19329371-19329393 TTCCAAAAAAATAAGGAGGAGGG - Intronic
1093512588 12:19946739-19946761 TGGGGAAAGAATGATGAGGAAGG + Intergenic
1093548933 12:20383751-20383773 ATGGAAAAAGGTGAGGAGGAGGG + Intronic
1093637413 12:21488026-21488048 TTGGAAAAGAATGACTATGAAGG - Intronic
1093659116 12:21734107-21734129 TTCCAAAAAATTGAGGAGGAGGG - Intronic
1093773897 12:23049917-23049939 TTGAACAAAAATGAGAAGGAAGG + Intergenic
1093795126 12:23301975-23301997 GAGGAAAAGAATGAAGAGGGAGG - Intergenic
1093821807 12:23628629-23628651 TTGGATAAGAAAAAGGAGTACGG + Intronic
1094225920 12:28045963-28045985 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1094378423 12:29816368-29816390 TTAGAAAAAAATGAGAATGAAGG - Intergenic
1094619254 12:32064580-32064602 GAGGAAGAGAAGGAGGAGGAAGG + Intergenic
1094661998 12:32478752-32478774 TTGGTAAGGTATGAGGAGGACGG - Intronic
1095244969 12:39908833-39908855 TATGAAAAGCATGAGGAAGATGG + Intronic
1095300411 12:40578086-40578108 GGAGAAAAGAAGGAGGAGGAAGG - Intergenic
1095607641 12:44089176-44089198 TTTGAAATGAATGAAAAGGAAGG + Intronic
1095744409 12:45641546-45641568 TTGGTAGAGAGTGAGGAGGGAGG - Intergenic
1095856711 12:46867618-46867640 TTTGAATAGAATGAGGAGGCAGG + Intergenic
1096035320 12:48463524-48463546 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1096478028 12:51920632-51920654 TGGGAAGAAGATGAGGAGGATGG - Intronic
1096524221 12:52201034-52201056 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1096848293 12:54419512-54419534 CTGGAAAGGAATGGGGAGGAAGG - Intergenic
1097558950 12:61177180-61177202 TTTCAAAAAACTGAGGAGGAGGG - Intergenic
1097975089 12:65676934-65676956 TTAGAAAATGATGAGGAGAAGGG + Intergenic
1097989945 12:65824295-65824317 GAAGAAAAGTATGAGGAGGAGGG - Exonic
1098290254 12:68951417-68951439 AAGGAAAAGAAGGAGTAGGATGG + Intronic
1098890962 12:76010531-76010553 GTGGAAAAGAAGGAGGTGGCAGG - Intergenic
1099032343 12:77542530-77542552 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
1099130859 12:78828927-78828949 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1099174580 12:79406055-79406077 ATGGAAATGAAAGAGGAGAAAGG + Intronic
1099174958 12:79410433-79410455 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1099293561 12:80802534-80802556 TTGGAAAATAATATGGAGGAGGG - Intronic
1099376904 12:81903438-81903460 TAGGTAAAGAATAAGTAGGAAGG - Intergenic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1099497885 12:83375250-83375272 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1099559227 12:84151471-84151493 TTCTAAAAAATTGAGGAGGAGGG - Intergenic
1100129717 12:91476517-91476539 TTGGAAAAAAAAGTGGAGAAAGG - Intergenic
1100429315 12:94516341-94516363 ATAGAAGAGATTGAGGAGGAGGG - Intergenic
1100743309 12:97618958-97618980 TTGGAAAAGTATCAGGAAGGAGG - Intergenic
1100889106 12:99104135-99104157 TTTGAAAAGAATGAGATTGAGGG + Intronic
1101180141 12:102207439-102207461 TAGGGAAAGAATGAGTGGGAAGG - Intergenic
1101782751 12:107850059-107850081 GTGGAGAAGAAGGAGGAGCAGGG - Intergenic
1102682845 12:114702277-114702299 GTGGAAAAGAATGAGGACAGTGG + Intergenic
1102920013 12:116784855-116784877 AGGGAAAAGAATGAAGTGGAGGG - Intronic
1103058891 12:117842982-117843004 TTGGGAAGGAGGGAGGAGGAAGG + Intronic
1103104027 12:118206889-118206911 TTTAAAAACAATGAGGAGGCCGG - Intronic
1103245481 12:119453300-119453322 ATGGAAGAAAAGGAGGAGGAGGG - Intronic
1103302256 12:119937083-119937105 TTGGCAAAGAAGGAAGGGGAGGG - Intergenic
1103569904 12:121838185-121838207 TTGCAAAAGAATGAGGCAGCTGG - Intergenic
1103617449 12:122163508-122163530 TGAGAAAAGAAGGAGGAGAAGGG - Intergenic
1103885824 12:124199330-124199352 ATGAAAAAGAATAAGGAGGCTGG - Intronic
1104485241 12:129145876-129145898 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1104659244 12:130597927-130597949 TTGGAAAAGAAGGAGGAAAATGG + Intronic
1105063584 12:133176877-133176899 TTTCAAAAAATTGAGGAGGAGGG + Intronic
1105668709 13:22588728-22588750 TAAGAAAAGTATTAGGAGGAGGG + Intergenic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1106497867 13:30297163-30297185 AAAGAAAAGAAGGAGGAGGAAGG + Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106617382 13:31341818-31341840 TTGAAAAAGAATTAGAAGAATGG + Intergenic
1106621377 13:31374196-31374218 TGGGAAAAGAAGCAGGAGGAGGG - Intergenic
1106644621 13:31618743-31618765 TTGGAACAGACTGTGGAAGAGGG + Intergenic
1107211186 13:37856485-37856507 TTCCAAAAAACTGAGGAGGAGGG + Intronic
1107310948 13:39077035-39077057 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
1107392119 13:39976733-39976755 ATGGAAAACAATGGGGAGAACGG + Intergenic
1107776967 13:43854582-43854604 TTCCAAAAAATTGAGGAGGATGG + Intronic
1107789520 13:43987644-43987666 TTGGAAAAGGCTGAGCAGGGTGG + Intergenic
1107874557 13:44778765-44778787 TAGAAAGAGAAAGAGGAGGATGG + Intergenic
1108097516 13:46919296-46919318 TTTAAAAAAATTGAGGAGGAGGG - Intergenic
1109161365 13:58978871-58978893 TTAGAAGAGTATGAGGAGGGAGG - Intergenic
1109325816 13:60866595-60866617 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1109436038 13:62304021-62304043 TTCCAAAAAACTGAGGAGGAGGG - Intergenic
1109666753 13:65550037-65550059 TTCCAAAACATTGAGGAGGAGGG - Intergenic
1109695782 13:65955333-65955355 TTCAAAAAAATTGAGGAGGAGGG - Intergenic
1109960959 13:69629951-69629973 TTGAAAAAGATTGAGGAGCCAGG + Intergenic
1110192382 13:72745333-72745355 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1110754174 13:79152300-79152322 TTGGAGAAAAAGGAGGAGGGTGG - Intergenic
1110785948 13:79526174-79526196 TTGGATAAGGATGAGGGAGAAGG + Intronic
1110829309 13:80012137-80012159 TTAGTATAGAAAGAGGAGGAGGG - Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111722154 13:91959500-91959522 TTCCAAAAACATGAGGAGGAAGG + Intronic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1112254070 13:97812684-97812706 TTCTAAAAAATTGAGGAGGAGGG + Intergenic
1113390742 13:109893955-109893977 CTGGAAAGCAATGAGCAGGAGGG + Intergenic
1113540569 13:111104807-111104829 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1114263616 14:21057853-21057875 GTGGAACAGAGTGAGGAGGTAGG - Exonic
1114368366 14:22055703-22055725 TTCCAAAATATTGAGGAGGACGG + Intergenic
1114516029 14:23301106-23301128 AAGGAAAAGAATGGGGATGATGG - Intronic
1114753969 14:25237667-25237689 CAGGAAAAGAATGAGGAAGCAGG - Intergenic
1114782363 14:25552225-25552247 TTGAAAAATAATATGGAGGATGG + Intergenic
1114904869 14:27114869-27114891 TTTCAAAAGACTGAGAAGGAGGG - Intergenic
1115021545 14:28686888-28686910 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1115113207 14:29849216-29849238 GAGGAAAAGAAAGAGGAGGGAGG - Intronic
1115182599 14:30646654-30646676 TTCCAAAAAATTGAGGAGGAGGG - Intronic
1115474839 14:33802905-33802927 TGGGGAAGGAATGAAGAGGAGGG - Intronic
1115548165 14:34481647-34481669 TTTGAAAAGAATGAGTTGGCCGG + Intergenic
1115627569 14:35209351-35209373 ATGGAAATTTATGAGGAGGAAGG - Intronic
1115886569 14:37978302-37978324 TAGGAAAAGAATAAGGAAAAGGG + Intronic
1115958084 14:38804833-38804855 TTGGAATACTTTGAGGAGGACGG - Intergenic
1116077957 14:40136087-40136109 TTCCACAAAAATGAGGAGGAAGG - Intergenic
1116148432 14:41105422-41105444 TTTCAAAAAATTGAGGAGGATGG + Intergenic
1116431429 14:44849578-44849600 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1116456259 14:45123912-45123934 TTTTAAAAGAATGAGGGGGCTGG - Intronic
1116471649 14:45292640-45292662 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1116476735 14:45348866-45348888 TTGTAAGAGAATGTGGAGAATGG - Intergenic
1116796555 14:49397034-49397056 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1118092796 14:62500741-62500763 TTCTAAAAGAATGTGGAGGCAGG - Intergenic
1118209974 14:63756784-63756806 ATGAAAAATAATGAGGAGGCTGG + Intergenic
1118522970 14:66607536-66607558 TTCAAAAAAATTGAGGAGGAGGG - Intronic
1118613614 14:67560337-67560359 GTTAAAAAGAATGAAGAGGATGG - Intronic
1119918799 14:78427047-78427069 GAGGAAAAGACTGAGGGGGAAGG + Intronic
1120408510 14:84119934-84119956 TTGGAAAATAATGCAGAAGATGG - Intergenic
1120453541 14:84702226-84702248 TTGGAACAGAATGTTGAGGAAGG + Intergenic
1120512192 14:85428727-85428749 GAAGAAAAGAATGAGGTGGAAGG + Intergenic
1120960371 14:90119249-90119271 TTCCAAAATATTGAGGAGGAAGG + Intronic
1121310469 14:92932807-92932829 GAGGAGAAGAAAGAGGAGGAGGG + Exonic
1121803349 14:96793853-96793875 TTGGGAAAGTGTGAGGAGGTTGG - Intergenic
1122431495 14:101650938-101650960 ATGAAAAAGAATGAAGAGTATGG + Intergenic
1123986762 15:25653153-25653175 ATGGAGAAGAACGAGGAGAACGG - Intergenic
1124903101 15:33842712-33842734 TTGGAAAGGAATGAGGACTGAGG + Intronic
1124957841 15:34371151-34371173 GGGGAAGAGAAGGAGGAGGAAGG - Intergenic
1125104062 15:35950050-35950072 TGGGAAAAAAAGGAGGTGGATGG + Intergenic
1125247971 15:37663610-37663632 TTTCAAAAAAATGAGGAGGAGGG - Intergenic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1125511222 15:40293449-40293471 TGGGAAGAGGAGGAGGAGGAAGG + Intronic
1126502709 15:49364148-49364170 TTCCAAAACATTGAGGAGGAGGG - Intronic
1126504366 15:49387099-49387121 TTCCAAAAGATTGAGAAGGAAGG + Intronic
1126740456 15:51771839-51771861 TGGGAAACAAATTAGGAGGATGG - Intronic
1126880322 15:53087860-53087882 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1126976076 15:54182545-54182567 TTCCAAAAAACTGAGGAGGACGG - Intronic
1127021941 15:54757956-54757978 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1127097104 15:55523467-55523489 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1127237393 15:57069788-57069810 TGGGAAAAGAGAGAGGAGAAAGG + Intronic
1127240860 15:57112381-57112403 TTGGCAGATAATGTGGAGGAAGG + Intronic
1127489334 15:59447677-59447699 TGGTAAAAGAAGGAGGAAGAGGG - Intronic
1127494170 15:59493882-59493904 TTAGAAAAGAAGGAGGAGGCCGG - Intronic
1127658622 15:61079110-61079132 TTGGGAAATTAGGAGGAGGATGG - Intronic
1128123108 15:65169396-65169418 TTTGAAAAGAAAGAGTAGGCTGG - Intronic
1128288187 15:66456070-66456092 GGGGAAAAGACTGAGGAGGTAGG - Intronic
1128646087 15:69379941-69379963 TTGGAAAAGGCTGAGGATGCAGG - Exonic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129240978 15:74252121-74252143 AAGGCAAAGAATGAGGTGGAGGG - Intronic
1129564925 15:76611534-76611556 TTGCAAAAAATTGAGGAGGAGGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129695259 15:77737386-77737408 TTGTAAAAGAAAGAGAAGGGAGG + Intronic
1130185824 15:81680805-81680827 TTTCAAAAAACTGAGGAGGAGGG + Intergenic
1130366697 15:83247124-83247146 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1130441601 15:83960354-83960376 CTGGACCAGAATGAGGGGGAAGG + Intronic
1130605189 15:85309438-85309460 TTCCAAAAGAATGAGAAAGAGGG + Intergenic
1130619730 15:85449952-85449974 TTACAAAAAATTGAGGAGGAAGG - Intronic
1130789481 15:87137544-87137566 ATGGAAAAGAGTAAAGAGGATGG + Intergenic
1131589854 15:93736971-93736993 TTCCAGAAGATTGAGGAGGAGGG - Intergenic
1131621330 15:94071161-94071183 ATGGAAATAAATGAGGATGAAGG + Intergenic
1131636630 15:94239732-94239754 TTGGCAAAGAATGAGAAAGAAGG + Intronic
1131701663 15:94943097-94943119 GAGGAGAAGAATGAGGAGAATGG + Intergenic
1131701670 15:94943134-94943156 GAGGAGAAGAATGAGGAGAATGG + Intergenic
1131714086 15:95089717-95089739 TAGAAAAAGAAGGGGGAGGAGGG + Intergenic
1131736616 15:95339398-95339420 ATGGAAAAGAGGGAGGGGGAAGG + Intergenic
1131771199 15:95739470-95739492 AGGGAGAAGAATGAGGAGCATGG + Intergenic
1132828255 16:1915571-1915593 TTAGAAAAGCAAGAGGAGGGTGG - Intronic
1133110110 16:3542999-3543021 TTTGAAATGGAAGAGGAGGAAGG - Intronic
1133583220 16:7166501-7166523 TTGGAGAAGAAGGAACAGGATGG + Intronic
1133717884 16:8466870-8466892 GTGGGAAAGAAAGAAGAGGAAGG + Intergenic
1133725195 16:8530726-8530748 TTGGAAAAGAAGGAGGGGCCGGG + Intergenic
1133885359 16:9822457-9822479 TAGGAAAAGAAAGAGAAGGGAGG + Intronic
1134103007 16:11465746-11465768 TTGTAAAAGAAAGAGAAGGCGGG + Intronic
1134125303 16:11612326-11612348 TTTCACAAGAATGATGAGGACGG - Intronic
1134377512 16:13691257-13691279 TTTCAAAAAATTGAGGAGGAGGG + Intergenic
1134541034 16:15065745-15065767 TTGCAAAAGAATTAGAAGGTTGG + Intronic
1134649599 16:15898200-15898222 AGGGAGAAGAAAGAGGAGGAGGG - Intergenic
1134802994 16:17102868-17102890 TTTGAAAACAATGAAGGGGACGG + Exonic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135436486 16:22430289-22430311 TTGCAAAAGAATTAGAAGGTTGG + Intronic
1135509713 16:23071809-23071831 GTGGAAAATAATGAAGTGGAAGG + Intronic
1135833658 16:25802527-25802549 TTGAAAAAGAATGACAAGGAAGG - Intronic
1136263771 16:29101626-29101648 TTGCAAAAGAATTAGAAGGTTGG - Intergenic
1136729661 16:32397793-32397815 TTCTGAAAAAATGAGGAGGAAGG - Intergenic
1136774003 16:32861498-32861520 TTTGAAAAGCATGTGGAGGCTGG - Intergenic
1136896606 16:34000021-34000043 TTTGAAAAGCATGTGGAGGCTGG + Intergenic
1137004877 16:35266584-35266606 GTGGAAAAGAATGAGTAGAATGG - Intergenic
1137378903 16:47979490-47979512 TTGTAAAAGAGGCAGGAGGAGGG - Intergenic
1137854061 16:51775818-51775840 TTGGAAGAGAAGGAGGAGGTGGG - Intergenic
1137913808 16:52406246-52406268 TTGGTAAAGAATGAGGCAGAGGG - Intergenic
1138659109 16:58507438-58507460 TTGTAGAAGAATGAGAAGGAGGG - Intronic
1139119872 16:64003228-64003250 TTCCAAAAGATAGAGGAGGAGGG + Intergenic
1139221685 16:65188914-65188936 TTGGAAAAGGAGGAGGAAAATGG - Intergenic
1140245872 16:73248838-73248860 TTCCAAAAGACTGAGCAGGATGG + Intergenic
1140582548 16:76248685-76248707 TGGGAAGGGTATGAGGAGGAAGG + Intergenic
1140595306 16:76402077-76402099 TTCCAAAAAACTGAGGAGGAAGG - Intronic
1140612571 16:76619011-76619033 TCAGAAGAGTATGAGGAGGAAGG + Intronic
1141755899 16:85990640-85990662 TTGGAACAGAATGGAGACGAAGG + Intergenic
1141775746 16:86121705-86121727 AGGGACAAGGATGAGGAGGAAGG - Intergenic
1141845220 16:86603891-86603913 AAGGAAAGGAAGGAGGAGGAGGG - Intergenic
1142329833 16:89444702-89444724 TTGGAAAACAGGAAGGAGGATGG + Intronic
1202996735 16_KI270728v1_random:119501-119523 TTCTGAAAAAATGAGGAGGAAGG + Intergenic
1203023422 16_KI270728v1_random:431843-431865 TTCTGAAAAAATGAGGAGGAAGG + Intergenic
1203076425 16_KI270728v1_random:1123609-1123631 TTTGAAAAGCATGTGGAGGCTGG - Intergenic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1143257334 17:5570697-5570719 TTCCAAAAAATTGAGGAGGAGGG + Intronic
1143727522 17:8859632-8859654 TAGGAGAAGAGGGAGGAGGAAGG + Intronic
1143849182 17:9796826-9796848 CTGGAATAGAGTGAGGAGGAAGG + Intronic
1143915346 17:10288061-10288083 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1144083177 17:11783203-11783225 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1144325937 17:14179931-14179953 TTTGAAATGAATGATGAAGATGG + Intronic
1144474810 17:15576819-15576841 TTTGAAATGAATGATGAAGATGG + Intronic
1144595648 17:16568461-16568483 CTGGAAAAGAGTGAAGAGGTTGG + Intronic
1144771533 17:17762272-17762294 TTGGAGAAGACCCAGGAGGATGG + Intronic
1144819170 17:18059411-18059433 TGGGAAAAGGATGTGGTGGAGGG - Intronic
1144967346 17:19086028-19086050 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1144980573 17:19166038-19166060 AAGGAGAAGGATGAGGAGGAGGG - Intergenic
1144987649 17:19212195-19212217 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1146022807 17:29293480-29293502 TGGGAAAAGAATAATGAGGTTGG + Intronic
1146953155 17:36920561-36920583 ATGGAAAAGCAAGAGGAGAAAGG - Intergenic
1147512525 17:41083718-41083740 TTGGAAAGGAATTAGAAGGAAGG - Intergenic
1147513988 17:41098555-41098577 TTGGGAAGGAATTAGAAGGAAGG + Intronic
1147514690 17:41104900-41104922 TTGGAAAGGAATTAGAAGGAAGG - Intronic
1147795885 17:43042462-43042484 CTGGAAAGGAAGGAGGAGAAAGG - Intergenic
1148070714 17:44907055-44907077 TTGCGTTAGAATGAGGAGGAAGG - Intronic
1148173846 17:45547563-45547585 TTAAAAGAGAATGAGGAGAAGGG + Intergenic
1148245602 17:46027942-46027964 TTGGAGAACAAAGATGAGGAGGG - Exonic
1148249594 17:46064625-46064647 TTGGAGAGGGAGGAGGAGGAGGG - Intronic
1148271460 17:46265401-46265423 TAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1148275422 17:46297884-46297906 TTAAAAGAGAATGAGGAGAAGGG - Intronic
1148297527 17:46515463-46515485 TTAAAAGAGAATGAGGAGAAGGG - Intronic
1148528487 17:48365908-48365930 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1148787448 17:50152225-50152247 TAGGAAAAGGAGGAAGAGGATGG - Intergenic
1149127932 17:53257854-53257876 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
1149424907 17:56545777-56545799 TAGGAAAATAATGGCGAGGAGGG - Intergenic
1150405059 17:64894485-64894507 TTAAAAGAGAATGAGGAGAAGGG + Intronic
1150517822 17:65832809-65832831 TTTCAAAAAATTGAGGAGGAGGG + Intronic
1150533468 17:66010993-66011015 TTCCAAAAAATTGAGGAGGAGGG - Intronic
1150697600 17:67419211-67419233 TTGGCAAAGAGTCAGGAGCAGGG + Intronic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151160813 17:72164062-72164084 TAGGAAAAGAAGGGGCAGGATGG - Intergenic
1151660379 17:75515484-75515506 TTGGAAAAGGAGAAGGAGAAAGG - Exonic
1151843501 17:76634559-76634581 TTGGAAAAGAAAAAGCAGAATGG - Intronic
1151918394 17:77135862-77135884 ATAGAAAAGAAAGAGAAGGAAGG - Intronic
1151968617 17:77445401-77445423 TTGGAAAAGAGTTGGCAGGAAGG + Intronic
1152031248 17:77844902-77844924 TTGGAGAAGCATGGGGAGGCAGG - Intergenic
1152328569 17:79657134-79657156 GAGGAGAAGAATGAGGAGGAAGG + Intergenic
1152356848 17:79811658-79811680 TTTGAAGAGAAGGAGGACGAGGG - Intergenic
1152988157 18:338110-338132 GTGGAAAATACAGAGGAGGATGG - Intronic
1153014827 18:574070-574092 ATGGAAAAGTGTGAGGAGGAAGG - Intergenic
1153411047 18:4793251-4793273 TTCCAAAAAACTGAGGAGGAGGG + Intergenic
1153437267 18:5080943-5080965 TTAGAAATGAATGAGAATGAAGG + Intergenic
1153440307 18:5110453-5110475 TTATAAAAGAAGCAGGAGGATGG + Intergenic
1153462160 18:5347806-5347828 TTCCAAAAAAATGAGGAGGAGGG + Intergenic
1154965600 18:21352770-21352792 TTGGAAAATAATGAGCATAAAGG + Intronic
1155354574 18:24939951-24939973 CTGGAAAAGAATGAGGGAGATGG - Intergenic
1155384750 18:25265535-25265557 GTGAGAATGAATGAGGAGGATGG - Intronic
1155463525 18:26110220-26110242 TTCCAAAAAATTGAGGAGGAAGG - Intergenic
1155535723 18:26815221-26815243 TTTCAAAAGATTGAAGAGGACGG - Intergenic
1155615930 18:27721419-27721441 TTGGAAAGCAATGACGAGGGAGG - Intergenic
1155831405 18:30519326-30519348 TCTGAACAGAATGAGGAGTAAGG + Intergenic
1155851104 18:30775013-30775035 ATGGAAAAGAATGAGGCAGCAGG - Intergenic
1155881094 18:31149847-31149869 TTGGAGAAAAATGAGTAGGAAGG - Intronic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156650524 18:39221062-39221084 TTGAAAAAGAATAATGAGAATGG - Intergenic
1156685059 18:39634422-39634444 TTAGAGAAGAATGAAGAGGTAGG - Intergenic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157313805 18:46572136-46572158 TTGGACAAGGATAAGGATGATGG - Intronic
1157479185 18:48042193-48042215 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1157517287 18:48320139-48320161 CTGGAGAAGAAGGAGAAGGAGGG + Intronic
1157555044 18:48607979-48608001 TTGGAAATAAATCAGGACGAAGG - Intronic
1157729133 18:49988711-49988733 CTGGGAAGGAAAGAGGAGGATGG + Intronic
1157867107 18:51196977-51196999 CTGGAAGAGGACGAGGAGGAGGG - Exonic
1158129446 18:54136523-54136545 TGTGAAAACAATGAGGAAGAAGG + Intergenic
1158420313 18:57287351-57287373 TTGGAGAAGATGGAGTAGGAGGG - Intergenic
1158617984 18:59005433-59005455 CTGGGACAGAATGAGGAGGGAGG + Intergenic
1158623676 18:59053386-59053408 TTGGAAAAGAATGCAGAAGAAGG - Intergenic
1158748882 18:60235514-60235536 TGGGAAAAGAATGAATAGGATGG - Intergenic
1159146854 18:64465764-64465786 GTGGAAAAAAAAGAGGAGTAAGG + Intergenic
1159202176 18:65201707-65201729 TTGGAAAAGAAAGGGAAAGAAGG + Intergenic
1159469435 18:68832578-68832600 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1159486176 18:69060426-69060448 TTCCAAAACACTGAGGAGGAAGG - Intergenic
1159606758 18:70482451-70482473 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1159979279 18:74756259-74756281 TTGAAAAAGAATAAGGTTGAAGG - Intronic
1160046489 18:75391554-75391576 TTGCAAGAGGATGAGGAAGAAGG + Intergenic
1160231357 18:77052037-77052059 CTGGAAGAGGATGAGGAGGCTGG + Intronic
1160315881 18:77846741-77846763 TTGGAAAAGCTTGAGAAGGATGG + Intergenic
1160884305 19:1338202-1338224 TTCGGAAAAGATGAGGAGGATGG - Intergenic
1160965298 19:1744688-1744710 AGGGAAAAGGATGAGGAAGAAGG - Intergenic
1161528959 19:4775419-4775441 TTAAAAAAGAAAGAGGAGGCTGG + Intergenic
1161801626 19:6419470-6419492 AGGGAAAAGGATGAGGTGGAGGG + Intronic
1161881185 19:6954206-6954228 TTAGAAACGAGAGAGGAGGAAGG + Intergenic
1162053069 19:8046743-8046765 TGGGAAGAGAAGGAGGAGGAGGG - Intronic
1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG + Intronic
1162339204 19:10081729-10081751 GAGGAAGAGAAGGAGGAGGAGGG + Intergenic
1162422716 19:10574962-10574984 GTGGAAAAGGAAGAGGTGGAGGG - Exonic
1162563309 19:11430660-11430682 CTGGAAATGAAGGAGGAGGTGGG + Intronic
1162766512 19:12923054-12923076 TAGGAGAAGAGTGAGGAGGCTGG - Intronic
1163105781 19:15122435-15122457 AGGGAAAAGGAGGAGGAGGAGGG + Intronic
1163177171 19:15572466-15572488 TGGGGAAGGCATGAGGAGGATGG + Intergenic
1163207782 19:15816007-15816029 TTGGAGAAGAATGAAGGTGACGG - Intergenic
1163361856 19:16851741-16851763 TTTGAAAAGGAGGAGGAGGAAGG + Intronic
1163779540 19:19239351-19239373 AGGGAAAGGAAGGAGGAGGAGGG - Intronic
1163815367 19:19461786-19461808 TTTGGAGAGAGTGAGGAGGAGGG + Intronic
1164247007 19:23439703-23439725 TTGGAAAAAACAGAGGAAGAAGG + Intergenic
1164324601 19:24180503-24180525 GAGGAAGAGAAGGAGGAGGAAGG + Intergenic
1164423164 19:28115545-28115567 TATAAAAAGGATGAGGAGGAAGG - Intergenic
1164592065 19:29512643-29512665 GAGAACAAGAATGAGGAGGAAGG + Intergenic
1164929328 19:32163396-32163418 TTGGAAAAGAAATAGTAGCATGG - Intergenic
1165768543 19:38365218-38365240 TTGAGAAAGAATGAGAAGAAAGG - Intronic
1166176614 19:41077049-41077071 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1167189961 19:47979169-47979191 ATGGAAGAGGAGGAGGAGGAGGG - Intronic
1167448948 19:49556100-49556122 TTGAAAAGGAAGGAGGAGGCGGG + Intronic
1167567339 19:50264910-50264932 TTGGAAAGGAATGAGAAGGATGG + Intronic
1167589990 19:50399232-50399254 TTGGAAGAGAATGAGGGTCAAGG - Intronic
1168399753 19:56078551-56078573 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
926381516 2:12295239-12295261 TTGGTATAGCATGGGGAGGATGG - Intergenic
926505111 2:13704479-13704501 TTGGAAAAGAATGGAGTGGTTGG + Intergenic
926524712 2:13964425-13964447 CAAGAAAACAATGAGGAGGAGGG - Intergenic
927005493 2:18843843-18843865 GTGGAATAGAAAGGGGAGGAAGG + Intergenic
927048009 2:19299374-19299396 TGGGAAGAGAAAGAGGAGGTTGG + Intergenic
927565448 2:24108399-24108421 TTACAAAAAATTGAGGAGGAGGG + Intronic
928019472 2:27691074-27691096 TTCCAAAAGAATGAGAAAGAAGG - Intronic
928041249 2:27879946-27879968 TTCCAAAAAACTGAGGAGGAGGG + Intronic
928102962 2:28450104-28450126 GGGGGAAAGAAGGAGGAGGAGGG - Intergenic
928281642 2:29951680-29951702 TTGGAAGAGTATGAGGACCATGG - Intergenic
928485280 2:31724719-31724741 TTGGAAAAGATGTTGGAGGAAGG + Intergenic
928589067 2:32795041-32795063 TTCCAAAAAATTGAGGAGGAAGG + Intronic
928609608 2:32978743-32978765 TTCCAAAAGATAGAGGAGGAGGG - Intronic
928644869 2:33341289-33341311 TTGGAGAAGGATGAGCAGGTGGG + Intronic
928680310 2:33694450-33694472 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
928734251 2:34267289-34267311 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
928771352 2:34705540-34705562 GAGGAAGAGAAGGAGGAGGAAGG - Intergenic
928854308 2:35785822-35785844 ATGGACAAGAATGAGGAACAGGG + Intergenic
929341552 2:40825008-40825030 AAGGAAAAGAAACAGGAGGATGG + Intergenic
929361605 2:41098569-41098591 GAGAAAATGAATGAGGAGGAGGG - Intergenic
929368121 2:41186526-41186548 TTTTAACAGAATGATGAGGATGG - Intergenic
929588134 2:43128679-43128701 GTGGAGAGGAATGAGGAAGAGGG + Intergenic
929752317 2:44728454-44728476 TTCCAAAAAATTGAGGAGGAGGG - Intronic
929910953 2:46089182-46089204 TAGAATAAGAATGAGGAGGGAGG - Intronic
930028596 2:47044787-47044809 TTGGTAGAGAATGAAGAGGGTGG - Intronic
930211113 2:48638186-48638208 TTTCAAAAAATTGAGGAGGAAGG + Intronic
930241587 2:48941158-48941180 AAGGAAAAGAATGTGGAAGAGGG + Intergenic
930436415 2:51349421-51349443 TTGAAAAAGAATGAGGTTGGAGG + Intergenic
930592073 2:53340015-53340037 TTTTGAGAGAATGAGGAGGATGG - Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930735685 2:54776208-54776230 GTGGAAAAGGAGGAGGAGAAAGG + Intronic
930900347 2:56499116-56499138 TTCGAAAAGATTGAGGAGGAGGG - Intergenic
930935882 2:56950984-56951006 TTGCAAAAAATTGAGGAGAAGGG - Intergenic
931080707 2:58766903-58766925 TTAGAAAAGAAAAAGAAGGAGGG - Intergenic
931095122 2:58931019-58931041 GTGAAAGAAAATGAGGAGGAGGG - Intergenic
931132526 2:59353213-59353235 GTGGAAAGAAGTGAGGAGGAGGG - Intergenic
931168758 2:59779740-59779762 TTTCATCAGAATGAGGAGGAGGG + Intergenic
931236180 2:60414143-60414165 TTGGCAAAGGAGGAGGGGGAAGG - Intergenic
931527906 2:63178262-63178284 TTGGAAGAGTTTGAGGAGAATGG + Intronic
931545906 2:63387093-63387115 TTCCAAAAAAATGAGAAGGAAGG + Intronic
931581608 2:63781388-63781410 TGGGAAGAGAAAGAGAAGGAAGG + Intronic
932054167 2:68427980-68428002 TGGGAAGAGTATGAGTAGGAAGG - Intergenic
932115775 2:69045571-69045593 TTGGAAAAAGAAAAGGAGGAAGG + Intronic
932371730 2:71195256-71195278 TTCTAAAAAATTGAGGAGGAGGG - Intronic
932450886 2:71810169-71810191 AAGGGAAAGAAAGAGGAGGAGGG + Intergenic
932482823 2:72058078-72058100 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
932727215 2:74189765-74189787 ATGGAAAAGAAGGAAAAGGACGG + Intergenic
932977502 2:76621728-76621750 TTCCAAAACATTGAGGAGGAAGG - Intergenic
933118451 2:78503782-78503804 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
933371354 2:81419445-81419467 TTGTAACAGAAAGAGGAGCATGG - Intergenic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
933638805 2:84737362-84737384 TTCCAAAAAATTGAGGAGGAGGG - Intronic
933762921 2:85685837-85685859 TTGGAAAAGAATGATGAGTCGGG - Intronic
933884271 2:86703320-86703342 TTGGAAAATCATGGAGAGGAGGG + Intronic
934185966 2:89675836-89675858 TTCCAAAAAAATGAGGACGAAGG - Intergenic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
934987295 2:98896824-98896846 GTGGAAAAGAGGGATGAGGAAGG + Intronic
934987896 2:98900501-98900523 TTTGAAAAGCCAGAGGAGGAGGG - Intronic
935367116 2:102306328-102306350 AAGCAAAAGAATGATGAGGAAGG + Intergenic
935440647 2:103091541-103091563 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
935609629 2:105007808-105007830 GTGGAAAACAAGGATGAGGAAGG + Intergenic
935834977 2:107040652-107040674 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
936000450 2:108823229-108823251 TTCGAAGAATATGAGGAGGATGG - Intronic
936045153 2:109181711-109181733 CTGGAGAAGAAAGAGGAGGCAGG - Intronic
936390899 2:112072313-112072335 TTCCAAAAAATTGAGGAGGAGGG - Intronic
936402834 2:112178458-112178480 TTCCAAAAAACTGAGGAGGATGG + Intronic
936594652 2:113836245-113836267 TTAGAAAAGAAAGAAGAGGCCGG - Intergenic
936816055 2:116462268-116462290 TTGGAAAGGCAGGGGGAGGAGGG + Intergenic
936838277 2:116735616-116735638 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
937196126 2:120158203-120158225 TTTCAAAAAATTGAGGAGGAGGG + Intronic
937229312 2:120388316-120388338 TTGAAGGATAATGAGGAGGAAGG + Intergenic
938272825 2:129990256-129990278 AAGGAAGAGAAGGAGGAGGAGGG + Intergenic
938443405 2:131355852-131355874 AAGGAAGAGAAGGAGGAGGAGGG - Intergenic
938451240 2:131423384-131423406 TGGGAAAAAAATCAGGAGGGAGG + Intergenic
938507256 2:131899271-131899293 TTTGAAAAAAATGAGAAGGAAGG + Intergenic
938581506 2:132650697-132650719 TTTTAAAGGAAGGAGGAGGAAGG - Intronic
938764480 2:134451212-134451234 TTGGAAAAGAAGGGGAAGGTAGG - Exonic
939098289 2:137862875-137862897 ATGCAAAAGAAAGAGGAGGGAGG + Intergenic
939190891 2:138915481-138915503 TTAGAGAAAGATGAGGAGGAAGG - Intergenic
939273910 2:139974974-139974996 TTCCAAAAGATAGAGGAGGAAGG + Intergenic
939327996 2:140720000-140720022 TAGGAAAAGAATCAGGTTGAAGG + Intronic
939367793 2:141257224-141257246 TTGGAACAGAAAGAGGAAGCAGG + Intronic
939484280 2:142790438-142790460 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
939564648 2:143772631-143772653 TCTGAAAACAATGAGAAGGAAGG + Intergenic
939585766 2:144003656-144003678 TTGAGAAAGAATGAGGAGAGGGG + Intronic
940208501 2:151231669-151231691 TTCTAAAAAATTGAGGAGGAGGG + Intergenic
940403985 2:153279901-153279923 TTGCAAAAGTTTGAGCAGGAAGG - Intergenic
940438705 2:153687177-153687199 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
940440224 2:153706538-153706560 CTGGAAATGATTGAGGAGTAGGG - Intergenic
940456640 2:153909964-153909986 TTCCAAAAAAATGAGGAAGAGGG - Intronic
940489304 2:154337333-154337355 TTGGTAAATTATGATGAGGAAGG + Intronic
940535253 2:154932993-154933015 TTACAAAAAATTGAGGAGGAGGG - Intergenic
940628856 2:156211998-156212020 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
940665733 2:156606971-156606993 TTAGCAAATAAAGAGGAGGATGG - Intronic
940708224 2:157130236-157130258 TTTTAAAAAATTGAGGAGGAGGG + Intergenic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941045219 2:160667416-160667438 TTGGAATAGTAGGAGGATGAGGG + Intergenic
941048943 2:160709348-160709370 TTCCAAAAAAACGAGGAGGAGGG - Intergenic
941336921 2:164257207-164257229 TAGGAAAAAAATGAGTAGCAGGG + Intergenic
941338331 2:164272703-164272725 ATGGAAAAAAAAGAAGAGGAGGG - Intergenic
941392392 2:164930357-164930379 TTCCAAAAAATTGAGGAGGAGGG + Intronic
941406673 2:165098572-165098594 GTGGAAAAGAGGGATGAGGAAGG - Intronic
941428211 2:165377180-165377202 TTAGAAAAGAATAAGTAGAAAGG + Intronic
942601844 2:177648607-177648629 TTGAAAAAGAATAATAAGGAAGG + Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942759880 2:179385628-179385650 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
942819562 2:180096139-180096161 TTCCAAAAAACTGAGGAGGAGGG + Intergenic
942869145 2:180713903-180713925 TTCCAAAAAAATGAGGAAGAGGG + Intergenic
943188138 2:184640203-184640225 GGGGAAAAGAACGAGGAAGAAGG + Intronic
943246161 2:185453563-185453585 TTGCAAAAAATTAAGGAGGAGGG + Intergenic
943611660 2:190042052-190042074 TTCCAAAAAACTGAGGAGGAGGG - Intronic
943726341 2:191255475-191255497 GTGTTAAAGAATGAGGAGGATGG + Intronic
944142046 2:196467353-196467375 TTGGTATAGGATGAGGGGGAGGG + Intronic
944150637 2:196554520-196554542 TAATCAAAGAATGAGGAGGATGG + Intronic
944213883 2:197234603-197234625 ATTAAAAAGAATGAGGTGGATGG - Intronic
944338482 2:198566182-198566204 TTTGAAAAAATTAAGGAGGAGGG - Intronic
944471617 2:200059253-200059275 TTCCAAAATATTGAGGAGGAAGG + Intergenic
944601854 2:201311251-201311273 TTCCAAAAAAATGAGGAGGAGGG + Intronic
944609401 2:201386331-201386353 TTAGAAGAGGATGAAGAGGAGGG - Exonic
944636090 2:201677452-201677474 CTGTGAAAGAGTGAGGAGGAAGG - Intronic
944788837 2:203102842-203102864 TTCCAAAAAATTGAGGAGGAAGG - Intronic
944850445 2:203713943-203713965 TAGGAAAGAAAGGAGGAGGAGGG + Intronic
944900999 2:204216039-204216061 TTGGAGGAGAAGGAAGAGGAAGG - Intergenic
945268717 2:207917116-207917138 TTGAAGTAGAATGAGGAGAATGG + Intronic
945385678 2:209197490-209197512 TTGGAAAAGTTTGAAAAGGATGG - Intergenic
945521192 2:210829502-210829524 TTCCAAAAGACTGAGAAGGAAGG - Intergenic
945889517 2:215413569-215413591 ATGGAACAGAAAGATGAGGATGG - Intronic
946071217 2:217035888-217035910 GTGGAAGAAAATGAGGAGGGAGG - Intergenic
946103428 2:217348042-217348064 TTCCAAAAAATTGAGGAGGAAGG - Intronic
946313614 2:218896261-218896283 AGGGAAAAGTAGGAGGAGGAAGG + Intronic
946537501 2:220647445-220647467 TTGGACAAGAGCCAGGAGGATGG + Intergenic
946558775 2:220889536-220889558 ATGGAAGACAGTGAGGAGGAGGG - Intergenic
947438246 2:230091836-230091858 TTCAAAAACACTGAGGAGGAGGG + Intergenic
948330819 2:237163276-237163298 TTAGAAAAGAATGCGAAGAAAGG - Intergenic
948532740 2:238622194-238622216 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
948573497 2:238934114-238934136 TTGCAAAAGAATAAAGTGGAAGG + Intergenic
948746587 2:240099803-240099825 TTTGAAAAGATTGAGAAAGAAGG + Intergenic
948963662 2:241359349-241359371 TTGGGAAGCAATCAGGAGGATGG - Intronic
1169690856 20:8330074-8330096 TTGCAGAAGAATCAGGGGGATGG - Intronic
1170102142 20:12713901-12713923 TGAGAAGAGAATGAAGAGGAGGG - Intergenic
1171013311 20:21520304-21520326 TTGAAAAAGAATAGGGAGAAGGG - Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171373037 20:24673965-24673987 TTGGGAAACAAAGATGAGGAAGG + Intergenic
1172366335 20:34352699-34352721 TGGGAAAAGAGCAAGGAGGAAGG + Intergenic
1172734088 20:37112885-37112907 TTGGAGAAGTTGGAGGAGGAGGG - Intronic
1173057357 20:39628375-39628397 TTGGAATGGGATGAGGAAGATGG + Intergenic
1173134916 20:40431163-40431185 TTGGGACAGAAAGAAGAGGATGG + Intergenic
1173468724 20:43305676-43305698 TTGGAGAAGAGTAAGGAAGAGGG + Intergenic
1173909430 20:46653431-46653453 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1174166105 20:48584602-48584624 TAAGGAAAGAATGAGGAAGAAGG - Intergenic
1174264599 20:49322267-49322289 TTGGAAATGATTGGTGAGGATGG + Intergenic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1176260728 20:64178145-64178167 TTTGAAAATAATGAGGATGGGGG - Intronic
1176293639 21:5059280-5059302 TGGCAGATGAATGAGGAGGAGGG + Intergenic
1176753735 21:10710379-10710401 CTGGAATAGAATGTGGTGGAAGG - Intergenic
1176753820 21:10710973-10710995 TTGGAAATGAATGGGGGGAATGG - Intergenic
1176786373 21:13261055-13261077 TTTGAAAAAAATGAGAAGGAAGG - Intergenic
1177984983 21:27963126-27963148 TTTGAAAAAAATGAGAAGGAAGG - Intergenic
1178068030 21:28928113-28928135 TAGGGAAAGAAGGAGGAGAATGG + Intergenic
1178168082 21:30005610-30005632 TTTGAAATAAAAGAGGAGGAAGG - Intergenic
1178179390 21:30142773-30142795 TTGTGAAAGAATGAAGAGGAAGG + Intergenic
1178500666 21:33123442-33123464 TTGCCAGAGAATGAGGAGAACGG + Intergenic
1178580166 21:33831592-33831614 TTGGAACAGCAGGAGCAGGAAGG + Intronic
1179208580 21:39306446-39306468 GTGGTAAAGACAGAGGAGGAAGG + Intronic
1179272984 21:39865914-39865936 GTGGGAGAGAAGGAGGAGGAGGG - Intergenic
1179317555 21:40257897-40257919 TGTGAAAAGAATAAGGAGAAAGG - Intronic
1179356867 21:40667984-40668006 TTGGAAAGGTATTAGAAGGAAGG - Intronic
1179863621 21:44204368-44204390 TGGCAGATGAATGAGGAGGAGGG - Intergenic
1180109507 21:45641614-45641636 TTAGAAAAGGAGGAGGAGAAGGG - Intergenic
1180112265 21:45665726-45665748 TTCCAAAAAATTGAGGAGGAGGG + Intronic
1180542805 22:16467248-16467270 TCTGAAAAAAATGAGGAGGAAGG + Intergenic
1180691864 22:17723394-17723416 TTAGAAGAGATGGAGGAGGAAGG + Intronic
1181122262 22:20679041-20679063 TTTGAAAAGAAGGAAAAGGACGG - Intergenic
1181180164 22:21062024-21062046 TTCGAAAAGAAGGAAAAGGACGG + Intronic
1181489092 22:23250448-23250470 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1181737780 22:24895199-24895221 TGAGAAAAGAAAGAGCAGGAGGG - Intronic
1181780407 22:25188779-25188801 TGGGAAAACAATAAGGATGAAGG - Intronic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1182005680 22:26957513-26957535 TTGGCAAAGAAGGAAGAGTAGGG - Intergenic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1182986067 22:34718106-34718128 TTTGAAAATATTGAGGAGGAGGG + Intergenic
1182996110 22:34813862-34813884 CGGCAAAAGAATGAGGATGAGGG + Intergenic
1184238925 22:43201536-43201558 ATAGAAAAGAAGGAGGAGGAAGG + Exonic
949294541 3:2506109-2506131 ATGGAACAAAATGAGAAGGAAGG - Intronic
949530634 3:4951773-4951795 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
949601503 3:5603538-5603560 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
949661767 3:6287228-6287250 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
950358820 3:12435812-12435834 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
950727240 3:14924347-14924369 AGAGAAAAGAAAGAGGAGGAGGG - Intronic
950933765 3:16817835-16817857 TTGGAAATCAATAAGGAAGAAGG - Intronic
951296955 3:20949163-20949185 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
951309179 3:21103046-21103068 TTCCAAAATATTGAGGAGGAAGG - Intergenic
951722400 3:25714234-25714256 TTGGAAAATAATGTAGAGCATGG + Intergenic
951782036 3:26374400-26374422 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
951964986 3:28372024-28372046 CAGGAAGAGAAGGAGGAGGAGGG - Intronic
952572063 3:34729714-34729736 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
952740886 3:36733301-36733323 GTGGAAAGGAATGAGCAGGGTGG - Intronic
952834400 3:37591184-37591206 TGGGGAAAAAATGAGGAGAAAGG - Intronic
952913726 3:38214077-38214099 TTGGAACAGAGTTAGGAGGTGGG + Intronic
953812532 3:46126154-46126176 TTGGAAGAGTTTGAGAAGGATGG - Intergenic
954280290 3:49572492-49572514 TTGGACAAGAATGAGGAATCAGG + Intronic
954876509 3:53806143-53806165 AGGGAAAAGAAGGAGGAGGAGGG - Intronic
955121481 3:56064080-56064102 TAGGAAAAGATTGAGGATGTAGG - Intronic
955132079 3:56180056-56180078 TAGGAAGAGAATGAAGAGCATGG + Intronic
955412891 3:58667347-58667369 TTGGTCAAGAGTGAGGAAGATGG + Intergenic
955570241 3:60297082-60297104 TTGAAAAAGAATAAGGTGGTAGG - Intronic
955806511 3:62741230-62741252 TTCCAAAAAATTGAGGAGGAGGG + Intronic
955886428 3:63603886-63603908 TTTCAAAAAATTGAGGAGGAAGG - Intronic
956372579 3:68579581-68579603 TTGGAAAGGACAGAGCAGGATGG - Intergenic
956478504 3:69649077-69649099 TTTGAAAGGAATGAGTAGGCAGG + Intergenic
957235814 3:77588893-77588915 TTGGCGAAGAAAGAAGAGGAAGG + Exonic
957640782 3:82850422-82850444 TAGGAAGAGGAAGAGGAGGAGGG - Intergenic
957977393 3:87464618-87464640 TTCCAAAAGATTAAGGAGGAGGG + Intergenic
958002576 3:87769778-87769800 TTGGAAGAGTTTTAGGAGGATGG + Intergenic
958608323 3:96389642-96389664 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
958856994 3:99397673-99397695 AAGGAAGAGAAAGAGGAGGAGGG - Intergenic
958859090 3:99423609-99423631 TAGGAAGTGAGTGAGGAGGATGG + Intergenic
958878205 3:99639169-99639191 TTGGAAAAAAATGATGTGAACGG + Intronic
959015821 3:101132886-101132908 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
959155871 3:102665379-102665401 AAAGAAGAGAATGAGGAGGAAGG - Intergenic
959411303 3:106025951-106025973 ATGAAAAAGAAAGAGAAGGAAGG + Intergenic
959499908 3:107094316-107094338 TTGAAAAGGAATGATGAGAAGGG - Intergenic
959519842 3:107313022-107313044 TTGCAAAAACTTGAGGAGGAAGG - Intergenic
959558109 3:107746749-107746771 ATGGGAAAGAATCAGGAGGCTGG - Intronic
960012910 3:112852793-112852815 TTCTAAAACATTGAGGAGGAGGG + Intergenic
960044882 3:113187035-113187057 TTGGGGAAGAATGAGGGGAATGG - Intergenic
960329008 3:116334332-116334354 TTGGAAATGTTTGAGAAGGACGG - Intronic
960470297 3:118055971-118055993 TTGGAAAAGGATGTGGAAGACGG - Intergenic
960645186 3:119872532-119872554 TTTGACAGAAATGAGGAGGATGG + Intronic
960685967 3:120293950-120293972 TTCCAAAAAAGTGAGGAGGAGGG + Intergenic
961022989 3:123525219-123525241 TTGGAAAGGAAAAAGGTGGATGG + Intronic
961119449 3:124361218-124361240 TTAGAAAAAAATCAGAAGGAAGG - Intronic
961417484 3:126770862-126770884 TTTCAAAAAATTGAGGAGGAGGG - Intronic
962371177 3:134822006-134822028 GTTGAAAAGGAGGAGGAGGAAGG + Intronic
962464582 3:135645682-135645704 TTCCAAAAAACTGAGGAGGAGGG - Intergenic
962829701 3:139129171-139129193 TAGGAATGGAATGAGAAGGATGG + Intronic
962832156 3:139153171-139153193 TTCCAAAAAATTGAGGAGGAGGG + Intronic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963115849 3:141728329-141728351 ATGGGAAAGAATATGGAGGAGGG + Intergenic
963420819 3:145058994-145059016 TTTTAAAAGACTGAGGAAGAGGG + Intergenic
963532878 3:146493251-146493273 TTGCAAAAAATTGAGGAGGAGGG + Intronic
963632371 3:147749281-147749303 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
963722783 3:148882768-148882790 GTGGAAGGAAATGAGGAGGAAGG + Intronic
964057665 3:152481152-152481174 TTCCAAAACATTGAGGAGGAGGG - Intergenic
964239855 3:154579124-154579146 TTCGAAAAAATAGAGGAGGAGGG + Intergenic
965018611 3:163195290-163195312 TTGGAAGAAAATGAGTAAGATGG + Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965293532 3:166914736-166914758 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
965294004 3:166919486-166919508 TTGCAAAAAATTGAGGAGGAAGG + Intergenic
965325335 3:167295886-167295908 TTCCAAAAGATTGAAGAGGAGGG + Intronic
965365603 3:167795532-167795554 TTGGGAAAGAAATATGAGGAGGG - Intronic
965649774 3:170921578-170921600 TTCCAAAAAACTGAGGAGGAGGG + Intergenic
965748195 3:171947496-171947518 TTCCAAAAAATTGAGGAGGAAGG - Intergenic
965861233 3:173153391-173153413 TGGGCAAAGAATTAGAAGGAAGG - Intergenic
965888512 3:173479262-173479284 TTGGGCAAGAGTGAGGATGAAGG + Intronic
966058882 3:175731832-175731854 TTAAAAAAGAAAAAGGAGGAGGG - Intronic
966363562 3:179156197-179156219 TTGGAAAAGAATGGAGTGGAAGG + Intronic
966430055 3:179821894-179821916 TAGGAAAAGTATGAAGAGGCAGG - Intronic
966499470 3:180622955-180622977 TTCCAAAATATTGAGGAGGAGGG - Intronic
966644204 3:182225012-182225034 TTCCAAAACACTGAGGAGGAGGG - Intergenic
966666513 3:182477860-182477882 TAGAAAAAGACTGAGAAGGAGGG - Intergenic
967039755 3:185680410-185680432 TTCCAAAAAAATGAAGAGGAGGG + Intronic
967090371 3:186129872-186129894 TTAGAAAAGAATGGGCAGGGCGG - Intronic
967227068 3:187302210-187302232 CTGGATAAGAATGAAGAAGAGGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967575115 3:191080493-191080515 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
967693492 3:192504504-192504526 CTGGAAAAGAGTGAGAAGAATGG - Intronic
968437418 4:601137-601159 TTGGAATAGACTGAAGATGAGGG - Intergenic
968855919 4:3121939-3121961 AGAGAAAAGAATCAGGAGGAGGG - Intronic
968893966 4:3388114-3388136 TGGGAAAAGAAGGAGGAGCAGGG - Intronic
969089554 4:4683517-4683539 TGGGAAAGGAATGCGGAGGCTGG - Intergenic
970044861 4:11840620-11840642 TTGGAAAGCAAAGAGGAGGCAGG - Intergenic
970210106 4:13700900-13700922 TTCCAAAAAACTGAGGAGGAAGG - Intergenic
970229310 4:13892222-13892244 TTTGAAGAGTATGTGGAGGAGGG + Intergenic
970266729 4:14296530-14296552 TTGGAATTAGATGAGGAGGAAGG + Intergenic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
970668748 4:18371082-18371104 TTCTAAAAAACTGAGGAGGAGGG + Intergenic
970808206 4:20060880-20060902 TTAGATAAGACAGAGGAGGAAGG + Intergenic
971633851 4:29031456-29031478 AGGGAAAAGGAGGAGGAGGAGGG - Intergenic
971638746 4:29100792-29100814 TTTGAAAAGAAGCAGGAGAAAGG + Intergenic
971729406 4:30358033-30358055 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
971733772 4:30419237-30419259 TTGAAAAAGAATAAAGAAGAAGG + Intergenic
971799205 4:31266652-31266674 TAGTAGAAGAAAGAGGAGGATGG - Intergenic
972121330 4:35708140-35708162 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
972971911 4:44586856-44586878 TTCTAAAAAATTGAGGAGGAGGG + Intergenic
973078875 4:45964731-45964753 TTCCAAAAAACTGAGGAGGAGGG - Intergenic
973105127 4:46326157-46326179 TTACAAAAGAATGGGGAGGGTGG + Intronic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973145799 4:46824273-46824295 TTCCAAAAAACTGAGGAGGAGGG + Intronic
973571092 4:52240472-52240494 CTGAAAAAGAAGGAGGTGGAGGG - Intergenic
973877664 4:55236431-55236453 TTTCAAAAAATTGAGGAGGAAGG - Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974297191 4:60016059-60016081 TTTCAAAAAATTGAGGAGGAAGG - Intergenic
974640821 4:64627908-64627930 CTTGAAAAGATTGAGGGGGAGGG - Intergenic
974751100 4:66142365-66142387 ATAGATAAGAAAGAGGAGGAAGG - Intergenic
974858867 4:67495525-67495547 GTGGAAAAGAGGGATGAGGAAGG + Intronic
974889670 4:67865951-67865973 TTCCAAAATATTGAGGAGGAGGG + Intronic
975158616 4:71100059-71100081 TTCCAAAAAATTGAGGAGGATGG + Intergenic
975169366 4:71215493-71215515 TGGGAAAGGAACGAGGTGGATGG - Intronic
975471260 4:74771164-74771186 TAGAAAAAGAAAGAAGAGGAGGG + Intronic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976009242 4:80467492-80467514 TTTGAAAAGATTGAGGAGGCGGG - Intronic
976228945 4:82820490-82820512 TTAGAAAAGAATGGTGAGGTGGG + Intronic
976368781 4:84262656-84262678 TTACAAAAGATTGAGGAGGAGGG + Intergenic
976561967 4:86511893-86511915 AAGGAGAAGAATGAGGAGGAAGG + Intronic
976951667 4:90840243-90840265 GTGGAGAAGAATGAGGAGAAAGG + Intronic
977005657 4:91566423-91566445 TTCCAAAAAATTGAGGAGGAGGG - Intronic
977028509 4:91852072-91852094 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
977064530 4:92296841-92296863 ATGGGAAAGAATGAGGACCAGGG - Intergenic
977200785 4:94112910-94112932 ATGGAAAAGAGGGAGGGGGAGGG + Intergenic
977927324 4:102716011-102716033 ATTAAAAAGAATGAGGAGGCCGG + Intronic
977948300 4:102939510-102939532 TTCCAAAAAAATGAGGAGGAAGG + Intronic
978017931 4:103770899-103770921 CTGGAAAAGAATGAGCTTGAAGG + Intergenic
978566666 4:110089855-110089877 AAGGAAAAGAAAGAGGAGGAAGG + Intronic
978648617 4:110972663-110972685 TTAGAAAAGCATGAGGATCAAGG - Intergenic
978749169 4:112227831-112227853 TTTGAAAAGGATGGGGAAGAAGG + Intergenic
978952594 4:114579109-114579131 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
979363505 4:119792717-119792739 TTGGAAAAGAAACTGGAGGCTGG + Intergenic
979483413 4:121244239-121244261 TTGTAAAAGAAGGGGGAGAATGG - Intergenic
979737705 4:124108014-124108036 TTAGAAAGGCATAAGGAGGAAGG - Intergenic
979780787 4:124649360-124649382 TTGTAAAAGAATGTGGAGGCAGG + Intergenic
980017216 4:127663817-127663839 TAGGAAAAGAAAAAAGAGGAAGG + Intronic
980350297 4:131675401-131675423 TTGGGACAGAAAGAGGAGGAAGG - Intergenic
980555790 4:134402421-134402443 TTGTAAAAAATTGAGGAGGAGGG - Intergenic
980573791 4:134659369-134659391 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
980671914 4:136020206-136020228 TTAGGAAAAAATGAGGATGAAGG + Intergenic
981123864 4:141083410-141083432 GTAGAAAAGGAAGAGGAGGAGGG - Intronic
981358896 4:143824792-143824814 TTGGCATAGAATGAGGACGTTGG - Intergenic
981379415 4:144055617-144055639 TTGGCATAGAATGAGGATGTTGG - Intergenic
981676912 4:147353255-147353277 TTGTAAAAGAAACAGGGGGATGG - Intergenic
981850332 4:149222001-149222023 TTGAAAAAAAATGGGGAAGAGGG + Intergenic
982094103 4:151905314-151905336 CTGGAATAGAAAGAGGAAGAAGG + Intergenic
982143065 4:152347968-152347990 TTGGAAAAAAAGCAGCAGGAAGG + Intronic
982321731 4:154083917-154083939 TTGAAACAGCATGAGGAGAATGG - Intergenic
982939634 4:161533680-161533702 TTCAAAAAAATTGAGGAGGAGGG + Intronic
983351243 4:166592901-166592923 GAGGAAAAGAAAGAGGAGGGGGG - Intergenic
983472677 4:168176052-168176074 TTGGAAAGAAAGGAGGAGGATGG - Intronic
983473842 4:168190767-168190789 TTCCAAAAGACTGAAGAGGAGGG + Intergenic
983734356 4:171039172-171039194 TTGGAAAAGCAAGAGGAGTTGGG - Intergenic
983751279 4:171275070-171275092 TGGGAAATGAATGAGGAGACAGG + Intergenic
984447974 4:179861596-179861618 TTGCAAATCAAGGAGGAGGAAGG + Intergenic
984601572 4:181732982-181733004 AAGGAAAAGAAGGAGGAGAATGG + Intergenic
985831309 5:2234141-2234163 TTCCAAAAAATTGAGGAGGATGG - Intergenic
985895024 5:2743775-2743797 TTGGAAAAGATGAACGAGGAAGG - Intergenic
986227663 5:5831373-5831395 TTCCAAAAGATTGAGAAGGAGGG + Intergenic
986624091 5:9707217-9707239 TGGGAGAAGAATGAGAAGGCAGG + Intronic
986979523 5:13431015-13431037 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
987851289 5:23358754-23358776 AAGGAAGAGGATGAGGAGGAGGG - Intergenic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988122204 5:26980174-26980196 TTGGAAAATATTGAGGAAGTTGG + Intronic
988153142 5:27413885-27413907 TGGGGAAAGGAAGAGGAGGAGGG - Intergenic
988208949 5:28177614-28177636 TGGGAGAGGCATGAGGAGGAGGG - Intergenic
988737832 5:34040404-34040426 AGGGAAAAGAAAGAAGAGGAAGG + Intronic
988865315 5:35327956-35327978 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
988870895 5:35388371-35388393 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
988955562 5:36313268-36313290 TAGGAATAGAAAGAGAAGGATGG + Intergenic
988990534 5:36666104-36666126 TAGGAAGAGAGTGAGGAGGAGGG - Intronic
989299466 5:39872356-39872378 TTGCAAAAAATTGAGGAGGAAGG - Intergenic
989348596 5:40458055-40458077 TTGGAACAGAATTATGAGGTGGG + Intergenic
989365889 5:40654648-40654670 TTCCAAAAGATTGAGAAGGAGGG + Intergenic
989555176 5:42786147-42786169 TTCCAAAAAATTGAGGAGGAGGG - Intronic
989757963 5:44979006-44979028 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
989970379 5:50517266-50517288 TCTGAAAAGAAAGAGGAGGAAGG - Intergenic
990106968 5:52276682-52276704 GTGGAAAAGGAAGAGGAAGATGG - Intergenic
990167825 5:53014633-53014655 TTCCAAAAAATTGAGGAGGAGGG - Intronic
990327664 5:54694234-54694256 TTTGAAAACAATCAGGAGGGAGG + Intergenic
990477998 5:56180355-56180377 TTGAAAAAGAATAAAGTGGAAGG - Intronic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
990805460 5:59655679-59655701 GTGGAAAAGAGGGATGAGGAAGG + Intronic
990898033 5:60720160-60720182 TTCAAAAAAATTGAGGAGGAAGG + Intergenic
991137996 5:63205819-63205841 TTGGAAAATGAAGAGGAGGTGGG + Intergenic
991174491 5:63670870-63670892 TTCCAAAAAACTGAGGAGGAGGG + Intergenic
991382228 5:66041598-66041620 TTTGACAAGAATGAGAAGCATGG + Intronic
991428493 5:66517496-66517518 TTGGCTAAGAATCAGGAGCATGG + Intergenic
991504666 5:67311911-67311933 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
991631283 5:68658579-68658601 TTTGAAAAGAAGTTGGAGGAGGG - Intergenic
991645083 5:68793346-68793368 TTAGAAAAAAATGTTGAGGAAGG - Intergenic
991918828 5:71633054-71633076 TGGGAAACAATTGAGGAGGAGGG + Intronic
992030207 5:72713513-72713535 TTGAACAAAAAGGAGGAGGAAGG + Intergenic
992032533 5:72736809-72736831 TTTCAAAAAATTGAGGAGGAAGG - Intergenic
992273270 5:75088030-75088052 TTAGAACAGAAAGAAGAGGAAGG - Intronic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
993018978 5:82567924-82567946 TTCCAAGAAAATGAGGAGGAGGG + Intergenic
993520276 5:88891066-88891088 TTAACAAAGAATGAGGAGCATGG + Intronic
993692090 5:91014410-91014432 TTCAAAAAAATTGAGGAGGAAGG - Intronic
993785859 5:92134679-92134701 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
993941718 5:94066791-94066813 TTCCAAAAAAATGAAGAGGAGGG + Intronic
993944294 5:94099084-94099106 TTCCAAAAAATTGAGGAGGAAGG + Intronic
994119657 5:96099863-96099885 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
994186747 5:96823397-96823419 GTGGACTCGAATGAGGAGGATGG - Intronic
994262391 5:97675243-97675265 TTTCAAAAAAATGAGGAGAAGGG + Intergenic
994409011 5:99382668-99382690 TTTCAAAAAATTGAGGAGGAGGG + Intergenic
994561588 5:101380726-101380748 TTAGAAAAAATTAAGGAGGAGGG - Intergenic
994575877 5:101578846-101578868 TTGGGAGAGAAAGAGGAGCAAGG + Intergenic
994591342 5:101777082-101777104 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
994603619 5:101939677-101939699 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
994673097 5:102785805-102785827 TTGGAAACAAATGGGGAGTAAGG + Intronic
994899327 5:105749806-105749828 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
995041766 5:107596014-107596036 TTTGACAAGAAATAGGAGGAAGG - Intronic
995099546 5:108282129-108282151 TTTCAAAAAATTGAGGAGGATGG + Intronic
995188295 5:109294132-109294154 TTGCAAAAAATTGAGGAAGAAGG + Intergenic
995240988 5:109885153-109885175 TTGGGAACGCATGACGAGGAGGG + Intergenic
995325906 5:110889574-110889596 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
995713394 5:115057406-115057428 TTGGGTAAGAATCAGCAGGATGG - Intergenic
995788348 5:115855852-115855874 TTTTAAAAGAATGATGAGGATGG + Intronic
996046250 5:118876833-118876855 TTCCAAAAGATTGAGGAGGAGGG + Intronic
996071916 5:119140712-119140734 TTCCAAAAAATTGAGGAGGAGGG + Intronic
996198316 5:120637744-120637766 TTGGGAGAGACTGAGGTGGAAGG + Intronic
996426914 5:123322865-123322887 TTCCAAAATATTGAGGAGGAGGG - Intergenic
996589733 5:125133071-125133093 TTGGCAATGAATGAGGTGGGAGG - Intergenic
997066027 5:130559951-130559973 TTGTAAATAATTGAGGAGGAGGG + Intergenic
997084266 5:130778491-130778513 TTTAAAAAGAAAAAGGAGGAAGG + Intergenic
997221740 5:132172935-132172957 TTGAAAAAGAATGAAGTTGAAGG + Intergenic
997347119 5:133200042-133200064 TTGGAAATGATTATGGAGGAAGG + Intronic
998233108 5:140374235-140374257 TTGGAGAAGCATGAAGATGAGGG - Intronic
998275578 5:140749956-140749978 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
998611516 5:143694313-143694335 TTTAAAAAGGAGGAGGAGGAGGG - Intergenic
998627825 5:143865473-143865495 TGGCAGAAAAATGAGGAGGAAGG + Intergenic
999109151 5:149102263-149102285 TTGGAATAGTTTGAGGAGAATGG - Intergenic
999233630 5:150077719-150077741 TTGGGAGAGAGGGAGGAGGAGGG - Intronic
999267272 5:150275076-150275098 GTGCAGAAGGATGAGGAGGAAGG + Intronic
1000186672 5:158865186-158865208 TTGGAAAAGGGTGAACAGGATGG - Intronic
1000462953 5:161545635-161545657 GTGGGAAAGACTGAGGAGGAGGG - Intronic
1000811102 5:165863151-165863173 ATAGAAAGGAATGAGAAGGAAGG + Intergenic
1001013405 5:168118812-168118834 GAGGAAAAGAAAGAGAAGGAAGG - Intronic
1001375818 5:171257029-171257051 TTCCAAAAAATTGAGGAGGAGGG + Intronic
1002221406 5:177685612-177685634 TGGCAAAGGAATGAGAAGGAAGG - Intergenic
1002309249 5:178304728-178304750 TGGAAAAACAATGAGGGGGAGGG + Intronic
1002406008 5:179032071-179032093 TGGGAAAAAGAAGAGGAGGAAGG - Intronic
1002499263 5:179636851-179636873 TTGGCAAAGAATGGGGAAAAGGG - Intergenic
1002502413 5:179655670-179655692 TTGGCAAAGAATGGGGAAAAGGG + Intergenic
1002846405 6:949025-949047 ATAGAAAAGAAGGAGGAGGGAGG + Intergenic
1003217543 6:4128492-4128514 TGGGAAAGAAATGAGGAAGAGGG + Intronic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003639587 6:7865412-7865434 TTTGAAGAGAATGAGAAGGAGGG - Intronic
1003767100 6:9250667-9250689 TAGGAAAAGAAGGGAGAGGAAGG - Intergenic
1004599667 6:17136152-17136174 TCCAAAAAAAATGAGGAGGAGGG + Intergenic
1004947089 6:20627526-20627548 TCGGAAAAGAATAATGTGGAAGG - Intronic
1005097090 6:22128849-22128871 TTCTAAAAAATTGAGGAGGAGGG - Intergenic
1005250476 6:23940521-23940543 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1005353228 6:24957571-24957593 TTCCTAAAGAATGAGAAGGAGGG + Intronic
1005435433 6:25805983-25806005 TTCCAAAAGATTGAGGAAGAGGG + Intronic
1005764769 6:29000182-29000204 TAGAAAAATAATGAAGAGGAAGG - Intronic
1005912743 6:30325867-30325889 TGTGAAAAGGCTGAGGAGGAGGG - Intergenic
1006205840 6:32342000-32342022 TGTGACAGGAATGAGGAGGAGGG - Intronic
1006244502 6:32718703-32718725 AAGGAAGAGAAAGAGGAGGAAGG + Intergenic
1006962937 6:37952237-37952259 TTGCAAAAAACTGAGGAAGAGGG - Intronic
1007580912 6:42959484-42959506 TTGGAAAGGAAGGAGGAGAGAGG + Intergenic
1007874613 6:45082246-45082268 TTCCAAAAAAATGAGGAAGAGGG + Intronic
1008033476 6:46722160-46722182 TGGGGAAAGAAAGAGGTGGAAGG - Intronic
1008137249 6:47791011-47791033 TTGGAGGAGGATGAGGTGGAAGG + Intronic
1008173544 6:48237993-48238015 TTCCAAAAGATTGAGAAGGAGGG + Intergenic
1008185412 6:48383901-48383923 TTACAAAAGATTGAGAAGGAAGG - Intergenic
1008388951 6:50926952-50926974 TAGGAAAAAAATGAAGAAGAGGG + Intergenic
1008820992 6:55630285-55630307 TTGGACAAGAATGGGGTGGGTGG + Intergenic
1009192961 6:60651704-60651726 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1009296983 6:61963595-61963617 TTGGAAAAGAAAGAGTGAGAGGG - Intronic
1009531188 6:64818149-64818171 TTTGATAAGACTTAGGAGGATGG - Intronic
1010019882 6:71146895-71146917 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1010023098 6:71184142-71184164 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1010163607 6:72889288-72889310 CTGGAACAGAATGAGGCAGAGGG + Intronic
1010906583 6:81499016-81499038 TTCCAAAAAATTGAGGAGGAGGG - Intronic
1011928265 6:92675258-92675280 TTTCAAAAAATTGAGGAGGAAGG + Intergenic
1012337709 6:98081641-98081663 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
1012345142 6:98176460-98176482 TTCCAAAAAATTGAGGAGGATGG + Intergenic
1012421295 6:99068410-99068432 TTAGAAGAGAAGGAAGAGGAGGG - Intergenic
1012677410 6:102134488-102134510 TAGGAAGAAAATGAGAAGGATGG + Intergenic
1012845671 6:104385022-104385044 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
1013564101 6:111339914-111339936 TTGACAAAGCATTAGGAGGATGG - Intronic
1013738222 6:113252192-113252214 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1013876878 6:114842322-114842344 TTTCAAAAAATTGAGGAGGAAGG + Intergenic
1013968929 6:115991805-115991827 TTCAAAAAAATTGAGGAGGAGGG - Intronic
1014364826 6:120526074-120526096 TTCCAAAAAATTGAGGAGGAAGG - Intergenic
1014490721 6:122058497-122058519 TTGAATTAGAATGAGGAGAAAGG + Intergenic
1014992261 6:128095492-128095514 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1015107140 6:129550281-129550303 TTAGAAGAGAATGAAGAGAAAGG - Intergenic
1015134097 6:129848154-129848176 TAGGGAGAGAATGAGGAGCATGG - Intronic
1015391596 6:132688539-132688561 TAGGAAAAGATTGAGGAGGCAGG + Intronic
1015698372 6:136007443-136007465 TGGGAAGAAATTGAGGAGGAGGG - Intronic
1015795052 6:137003109-137003131 TTGTAAAAGATTGAGGCTGAAGG - Intronic
1016785350 6:148005496-148005518 AGGGAAAGGAAAGAGGAGGAGGG + Intergenic
1017297646 6:152817474-152817496 TTTGAGAAGACTGAGGGGGAAGG + Intergenic
1017521944 6:155210133-155210155 TTGGAGAAGAGTGCTGAGGATGG + Intronic
1017601598 6:156089142-156089164 TTCCAAAATATTGAGGAGGAGGG + Intergenic
1017648378 6:156559472-156559494 TTGGAAAGGGGTGAGGAGGCTGG - Intergenic
1017981728 6:159406695-159406717 TTAGACAAGAGTAAGGAGGAGGG + Intergenic
1018132345 6:160744194-160744216 TTCAAAAAAACTGAGGAGGAGGG - Intronic
1018219373 6:161562982-161563004 CTGGAAAATACTGAGCAGGAAGG - Intronic
1018316998 6:162566740-162566762 TTCCAAAAGACAGAGGAGGAGGG + Intronic
1018389342 6:163330554-163330576 AAGGAAAATAATGAGGAAGATGG - Intergenic
1019066636 6:169306230-169306252 TCTAAAAAAAATGAGGAGGAGGG + Intergenic
1019169064 6:170118984-170119006 TTGGAAAAGAATAAAGTTGAAGG - Intergenic
1019534270 7:1520375-1520397 CTGGAACAGAAGGTGGAGGAAGG + Intergenic
1019985467 7:4652263-4652285 GAGGAAAGGAATGAGCAGGAGGG - Intergenic
1020680618 7:11232473-11232495 TTGAAAGAGAAGGTGGAGGAGGG + Intergenic
1020684492 7:11276272-11276294 TAGGAAAAGAATCGGTAGGAAGG + Intergenic
1020702644 7:11502243-11502265 TTCCAAAAGGATTAGGAGGAGGG + Intronic
1020906017 7:14065658-14065680 AAAAAAAAGAATGAGGAGGAAGG - Intergenic
1021169653 7:17383423-17383445 TTGGAAAATAAAGTGGATGATGG + Intergenic
1021461318 7:20890269-20890291 TTGGCAAAGATTGTGCAGGAAGG - Intergenic
1021502511 7:21346279-21346301 TGGGAAAAGAGAGAGGGGGAGGG + Intergenic
1022374047 7:29796945-29796967 GTGGAGAAGAGTTAGGAGGAGGG + Intergenic
1022416724 7:30184741-30184763 TTGTAAATGAATGAGGGTGACGG - Intergenic
1022557953 7:31318670-31318692 TTGGAAAAGGATCATTAGGAGGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023008621 7:35904258-35904280 TTGGAAAAGAACAAGAAGAAAGG + Exonic
1023016550 7:35973629-35973651 TTGGAAAAGAACAAGAAGAAAGG + Intergenic
1024055333 7:45656856-45656878 ATGGAATAGAAAGAGGAGGTTGG + Intronic
1024165750 7:46728151-46728173 TTCCAAAAAACTGAGGAGGAGGG + Intronic
1024237455 7:47409087-47409109 ACAGAAAATAATGAGGAGGAAGG + Intronic
1024426943 7:49236961-49236983 TTGCAAAAAACTGAGGATGAGGG - Intergenic
1024445765 7:49476652-49476674 TTCCAAAAAATTGAGGAGGAAGG - Intergenic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1024800159 7:53067880-53067902 TTGAAAAAAAAGGATGAGGATGG + Intergenic
1024806511 7:53147815-53147837 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1025096669 7:56100998-56101020 GTGGAAAAGAGCGATGAGGAAGG - Intergenic
1025985149 7:66444185-66444207 TTGGAAAAGTATGTGTGGGAGGG - Intergenic
1026029731 7:66780074-66780096 TTGGAAAAGTATGTGTGGGAGGG + Intronic
1026150421 7:67783642-67783664 TGGGACCTGAATGAGGAGGATGG + Intergenic
1026159090 7:67852942-67852964 GAGGAAGAGAAGGAGGAGGAGGG + Intergenic
1026661139 7:72303667-72303689 TTGGAAAAGAGAGTGAAGGAGGG - Intronic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1026989956 7:74579315-74579337 TTTGAAAAGGAAGAGGAAGAAGG + Intronic
1027208362 7:76122783-76122805 TTGGAAAAGTATGTGTGGGAGGG - Intergenic
1027357043 7:77367736-77367758 TTTCAAAAAATTGAGGAGGATGG - Intronic
1027368687 7:77485205-77485227 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1027411134 7:77918945-77918967 TTGGAGAAGAAGGACAAGGAAGG + Intronic
1027479363 7:78675779-78675801 TTGGAAAACAAGAAGGATGATGG - Intronic
1027627155 7:80560476-80560498 TTCCAAAAAATTGAGGAGGAAGG - Intronic
1027683205 7:81246517-81246539 TTACAAAAAATTGAGGAGGAGGG - Intergenic
1028176644 7:87668020-87668042 TTCCAAAAAAATGAGGAAGAGGG - Intronic
1028209432 7:88055200-88055222 TTGGAAAAGACTGAGAGGGAAGG + Intronic
1028232916 7:88327039-88327061 TTAGAAAAGTAAGAAGAGGAAGG - Intergenic
1028334490 7:89635159-89635181 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1028431577 7:90753098-90753120 TTGCAAAAAATTGAGGAAGATGG + Intronic
1028521640 7:91738194-91738216 CTGACAAAGATTGAGGAGGAGGG - Intronic
1028570909 7:92286118-92286140 TTGGAGAAAAATAAGGAGAATGG - Intronic
1028771909 7:94635315-94635337 TTGGATAAGAATGATTAAGAAGG + Intronic
1028806802 7:95037112-95037134 CTGGAAAAAAAAGAGGGGGAGGG + Intronic
1029407581 7:100385215-100385237 TTGGAAGGGAGTGAGGAGGCAGG + Intronic
1029480266 7:100808019-100808041 TGGGAAAAGAGAAAGGAGGAAGG - Intronic
1030255339 7:107504532-107504554 TTGCAAAAGATTGAGAAAGAGGG - Intronic
1030365828 7:108645054-108645076 TTAGAAAAGAATAAGGTGGAAGG - Intergenic
1030519659 7:110582047-110582069 TTAGGAAAGAATGGGGAGGGAGG + Intergenic
1030718733 7:112843749-112843771 TTCCAAAAGACTGAGGAGGAGGG + Intronic
1031004154 7:116453244-116453266 TTGGAAAGGTCTGAGGAGGAAGG - Intronic
1031007784 7:116494425-116494447 TTAGAAATAAATGAGGAAGAAGG - Intronic
1031250464 7:119373520-119373542 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1031257386 7:119471337-119471359 TTCCAAAAGAATGAGGAGTATGG + Intergenic
1031429730 7:121652426-121652448 TTGCAAAAAATTGAGGAGGAGGG - Intergenic
1031738150 7:125393630-125393652 TTCCAAAAAAGTGAGGAGGAGGG + Intergenic
1031869246 7:127074417-127074439 CTGGAAAAGAATGAGGCAGGGGG + Intronic
1032090490 7:128909291-128909313 TAGGAACAGAGAGAGGAGGAGGG + Intronic
1032119457 7:129145450-129145472 CTGGCAAAGAAAGAAGAGGAAGG + Intronic
1032217497 7:129968970-129968992 ATGGAAAAGAGAGAGGAGGCCGG + Intergenic
1032249622 7:130243734-130243756 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1032724705 7:134580127-134580149 CAGGAAAAGACTCAGGAGGAAGG - Intergenic
1032726922 7:134598602-134598624 TTCCAAAAAAATGAGGAGGAAGG - Intergenic
1032730827 7:134641149-134641171 TGTGAATAGGATGAGGAGGATGG + Intergenic
1032769818 7:135039961-135039983 GAGGAAGAGAACGAGGAGGAGGG + Intronic
1032965876 7:137096833-137096855 TTCCAAAAAAATGAGGAGGAAGG + Intergenic
1032980036 7:137270957-137270979 TTAGAAGAGAATAACGAGGAAGG - Intronic
1033191221 7:139282022-139282044 TGGGGAAAGAATGGAGAGGAAGG - Exonic
1033496313 7:141900146-141900168 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1033532267 7:142276564-142276586 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
1033612688 7:142980779-142980801 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
1033706842 7:143897281-143897303 TAGGCTAAGGATGAGGAGGAAGG - Intronic
1034332263 7:150293104-150293126 GTGGGAAAGAATGAAAAGGATGG - Intronic
1034611006 7:152368626-152368648 TTGGAAAAGAACAAGAAGAAAGG + Intronic
1034665773 7:152816773-152816795 GTGGGAAAGAATGAAAAGGATGG + Intronic
1034688209 7:152992621-152992643 AGGGGAAAGAATGAGCAGGAGGG - Intergenic
1035195038 7:157211116-157211138 GTGGCAGGGAATGAGGAGGAAGG + Intronic
1035651073 8:1265504-1265526 TTAAAAAAGAATGGGGAGAAAGG + Intergenic
1035722057 8:1799318-1799340 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1035979822 8:4357765-4357787 AATGAAAAGAATAAGGAGGATGG + Intronic
1036590893 8:10167096-10167118 TTGGAAGAGAATGGAGAGGAGGG - Intronic
1037119826 8:15269442-15269464 TTCCAAAAAAATGAAGAGGAAGG + Intergenic
1037280571 8:17237296-17237318 TTTAAAAAACATGAGGAGGAAGG - Exonic
1037521395 8:19683503-19683525 TTAGAAAAGATTGTGGAAGAGGG + Intronic
1037631070 8:20656873-20656895 TTGGATAAGAAGGGTGAGGAGGG - Intergenic
1037691297 8:21183495-21183517 AAGGAAGAGAAAGAGGAGGAGGG - Intergenic
1037927411 8:22854849-22854871 TTTGAAAAGAGGGAGGGGGAGGG - Intronic
1038390922 8:27200092-27200114 ATGGAAATGGATGAAGAGGAAGG - Intergenic
1038514413 8:28173163-28173185 TTGCAAAAAACTGAAGAGGATGG - Intronic
1038601645 8:28949861-28949883 GTAGAAAAGAAAGGGGAGGAAGG + Intronic
1038910783 8:31961674-31961696 TTGGAAAAGAAGTTGGAGGGAGG - Intronic
1039203003 8:35117599-35117621 TTAGAAAAGAATGATGAGGCTGG + Intergenic
1039299077 8:36189995-36190017 GTGGAAAAGAATGGAGATGATGG - Intergenic
1039435988 8:37559566-37559588 GAGGAAAAGAAGGAGGGGGAGGG + Intergenic
1039666654 8:39540677-39540699 TGGGAAATGCTTGAGGAGGAAGG - Intergenic
1039765173 8:40620921-40620943 TTGGAAATGAATAAGCAGTAGGG - Intronic
1040540623 8:48351032-48351054 TTCTAAAAAATTGAGGAGGAGGG + Intergenic
1040623746 8:49120078-49120100 TCTTAAAAGAATGAGGTGGAAGG - Intergenic
1040986625 8:53301318-53301340 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1041470840 8:58207147-58207169 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1041768283 8:61443679-61443701 TTGAAAAAGAATAAAGTGGAAGG - Intronic
1041972278 8:63757596-63757618 TTGCAAAAAATTGAGGAGAAGGG - Intergenic
1042024647 8:64410065-64410087 TTGGAAGAAAATGAAGAGCATGG - Intergenic
1042199210 8:66264039-66264061 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1042305624 8:67328839-67328861 TTTGAAAAGAAGGAGAAAGAAGG + Intronic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042811908 8:72834950-72834972 TTGGAAAACCAGCAGGAGGAAGG + Intronic
1042836012 8:73079638-73079660 TTGGGGGAGAAGGAGGAGGAGGG - Intronic
1042848835 8:73195028-73195050 GTTGGAAAGAATGTGGAGGAAGG - Intergenic
1042873055 8:73415380-73415402 CTGGAGAAGAATGAGGAAAAAGG - Intergenic
1042984543 8:74568403-74568425 CTGGAAAAGAGGGATGAGGAAGG - Intergenic
1043058567 8:75471600-75471622 TTGGAAATTAATAAGAAGGAAGG - Intronic
1043240245 8:77924474-77924496 TTTCAAAAAAATGAGGAGGAGGG + Intergenic
1043396908 8:79846676-79846698 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1043738309 8:83775136-83775158 ATGGAAAAGGATGTGGAGGCAGG - Intergenic
1044130545 8:88518233-88518255 TTGGGAAAGAATGAGGCAGAAGG - Intergenic
1044174388 8:89100361-89100383 TGGGGAAAGAATGAAGAGAACGG - Intergenic
1044181906 8:89206459-89206481 TTGAAAAAGAACGAGGATAAAGG + Intergenic
1044196389 8:89381430-89381452 TTTTAAAAAAATGAGAAGGAAGG - Intergenic
1044272165 8:90258936-90258958 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1044304274 8:90619765-90619787 TGGGGATAGAATGAAGAGGAGGG - Intergenic
1044391655 8:91659171-91659193 CTGGAAAAGAGTGAGGAACAAGG - Intergenic
1044509602 8:93059258-93059280 TTGCAAAAGAATGAGCAAAATGG + Intergenic
1044656920 8:94557938-94557960 TTGGAAAAGAAAAGGGAAGATGG + Intergenic
1045130393 8:99145462-99145484 CTGGAAAAGAGGGAGGAGAAAGG - Intronic
1045264611 8:100608716-100608738 TAGGAAACGAAAGAGGTGGAGGG - Intronic
1045524953 8:102933598-102933620 TTGGAGAAGAATCACCAGGATGG - Intronic
1045722835 8:105133788-105133810 TTGCAACAGAAAGAGGAAGAAGG - Intronic
1046045641 8:108961022-108961044 TTGACAAAGAAAGGGGAGGATGG + Intergenic
1046109110 8:109700354-109700376 TTGGCTGAGAAGGAGGAGGAGGG - Intergenic
1046567908 8:115923735-115923757 CTGGACAAGAATGAGGAAAAGGG + Intergenic
1046669053 8:117037430-117037452 TTGGAGGAGAATGGAGAGGAAGG + Intronic
1047062444 8:121242880-121242902 GAAGAAGAGAATGAGGAGGAAGG - Intergenic
1047213927 8:122862065-122862087 TTTGACAAAACTGAGGAGGAGGG + Intronic
1047580858 8:126213839-126213861 TTGAATAAAAATGTGGAGGAGGG + Intergenic
1047691327 8:127357747-127357769 CAGGAAAAGAAAGAGAAGGAAGG - Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1047819944 8:128507804-128507826 TTGGCACGGTATGAGGAGGATGG + Intergenic
1048073030 8:131040936-131040958 GGGGCAAAGAAGGAGGAGGAGGG + Exonic
1048531403 8:135253523-135253545 TAGGGAAAGAAAGAAGAGGAGGG + Intergenic
1049823370 8:144650357-144650379 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1049889428 9:54837-54859 CTGGAACAGAAGGAGGAGGGCGG - Intergenic
1049896654 9:116000-116022 TTCTAAAAGAATGAATAGGAGGG - Intergenic
1050003850 9:1107205-1107227 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1050099104 9:2099506-2099528 TGGGAAAGGATAGAGGAGGAGGG + Intronic
1050164765 9:2753430-2753452 TTTCAAAAAATTGAGGAGGAAGG + Intronic
1050303248 9:4280740-4280762 TCTGAGAAGAGTGAGGAGGAAGG - Intronic
1050675662 9:8049968-8049990 TTTGAAAAAACTGAGGAGGAGGG - Intergenic
1050861969 9:10446136-10446158 TTGAAATAGAAAGAGGAGAAAGG + Intronic
1050971964 9:11889088-11889110 TTTGTAAAGAATGATGATGATGG + Intergenic
1050990139 9:12139749-12139771 AAGGAAAAAAATGAGGAGGTGGG + Intergenic
1051317287 9:15854137-15854159 TTGAAAAAAAATGAAGAGAAGGG - Intronic
1051502551 9:17793689-17793711 ATAGAGAAGAATGAGAAGGAAGG - Intronic
1051506700 9:17834902-17834924 CTGGACAAAAATGAGGAGCAGGG - Intergenic
1051713790 9:19960424-19960446 TTGGAAACCAATGAGGTGGAAGG + Intergenic
1051749969 9:20330606-20330628 TTGGTAACAAATGGGGAGGAAGG - Intergenic
1051997911 9:23241349-23241371 TTGCAAAAAAATGAAGATGAGGG + Intergenic
1052078873 9:24178857-24178879 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1052524984 9:29605376-29605398 TTATAAAAAAATGAGGAGGTGGG - Intergenic
1052531180 9:29686289-29686311 AAGGAAGAGAAGGAGGAGGAGGG + Intergenic
1052543634 9:29844294-29844316 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1052629980 9:31025349-31025371 TTGAAGAAGAATGAGGTTGAGGG + Intergenic
1052692985 9:31838773-31838795 ATGGTAGAGAGTGAGGAGGAAGG + Intergenic
1053531138 9:38882621-38882643 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1053782412 9:41624310-41624332 TTGGGACAGAAAGAGGAGGAAGG + Intergenic
1053845087 9:42228074-42228096 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
1054170367 9:61834467-61834489 TTGGGACAGAAAGAGGAGGAAGG + Intergenic
1054203360 9:62107053-62107075 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1054584180 9:66948031-66948053 TTCAAAAAAATTGAGGAGGAGGG - Intergenic
1054635002 9:67481311-67481333 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1054667170 9:67746348-67746370 TTGGGACAGAAAGAGGAGGAAGG - Intergenic
1055045985 9:71924230-71924252 TTGGAAAAGAATTAGGACTAAGG - Intronic
1055225304 9:73988346-73988368 TTCCCAAAAAATGAGGAGGAAGG + Intergenic
1055336004 9:75234285-75234307 TTAGAAACGAATGAGGAGGAAGG + Intergenic
1055562956 9:77539542-77539564 TTCCAAAAGATTGAAGAGGAGGG - Intronic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055811346 9:80151889-80151911 TTCCAAAAAATTGAGGAGGAAGG - Intergenic
1055829016 9:80358707-80358729 TGGGAGAGGAAAGAGGAGGAGGG + Intergenic
1055833851 9:80415974-80415996 CCTGAAAAAAATGAGGAGGAGGG - Intergenic
1055851528 9:80636579-80636601 TTGGAATAGCATGAGAATGAGGG - Intergenic
1055868232 9:80841611-80841633 TAGGAGTAGAGTGAGGAGGAGGG - Intergenic
1055979266 9:81985974-81985996 TTAGAAAAGAATGTGTAGGAAGG + Intergenic
1056127585 9:83551510-83551532 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1056164496 9:83928136-83928158 TTGAGAAGGAATGAGGAAGATGG + Intergenic
1056235459 9:84589478-84589500 TTGGAAAAAATTGATGAGAAGGG + Intergenic
1056494965 9:87147619-87147641 TAAGAAAAGAATGAGGGCGAGGG - Intergenic
1056539152 9:87556565-87556587 TTGGCAGAGCATGGGGAGGATGG + Intronic
1056701759 9:88917120-88917142 GTGGAAAAGAGGGACGAGGAAGG - Intergenic
1056866928 9:90235744-90235766 TTACAAAACATTGAGGAGGAAGG - Intergenic
1056958262 9:91099764-91099786 TAGAAAATGAAAGAGGAGGAGGG + Intergenic
1057016533 9:91657435-91657457 TTAGAAAGGAAGGAGGAGGCTGG - Intronic
1057489347 9:95509231-95509253 TTGGAGAAAGAAGAGGAGGAGGG + Intronic
1057737152 9:97673778-97673800 TTGAAAATGAAAGATGAGGAAGG + Intergenic
1057856859 9:98608099-98608121 TTGGAAAAGAACAAGAAGAAAGG + Intronic
1058101553 9:100922936-100922958 TTTGAAAAAATTGAGGAGGAGGG + Intergenic
1058302623 9:103395151-103395173 TTCAAAAAAATTGAGGAGGAGGG - Intergenic
1058403190 9:104640867-104640889 TTCCAAAAAATTGAGGAGGATGG + Intergenic
1058409337 9:104713757-104713779 TTGGAGAAGAATAAGGAAAAGGG - Intergenic
1058724046 9:107785119-107785141 TTGGAAAAAAATGATGACAAGGG + Intergenic
1059015128 9:110506937-110506959 AGGGAAAAGAAAGAGGAAGATGG + Intronic
1059712408 9:116881125-116881147 GTGGAAGAGGAGGAGGAGGAAGG + Intronic
1059807592 9:117820082-117820104 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1059873493 9:118604438-118604460 TTGGAAATTGTTGAGGAGGAGGG + Intergenic
1059927633 9:119227287-119227309 ATCGGATAGAATGAGGAGGATGG - Intronic
1059927639 9:119227331-119227353 ACCGAATAGAATGAGGAGGATGG - Intronic
1060143218 9:121228189-121228211 TGGGGACAGAAGGAGGAGGAAGG - Intronic
1060671052 9:125470035-125470057 TGAGAAAAGAATGTGGAGCACGG - Intronic
1061048963 9:128182975-128182997 TTGGACAGGAATGGGGAGGGTGG - Intronic
1061067062 9:128285158-128285180 TTGGTAAAGAAAGAGAAAGAGGG + Intronic
1061327199 9:129871105-129871127 CTGGAGATGAATGGGGAGGATGG - Intronic
1185499197 X:584537-584559 GAGGAAGAGAAAGAGGAGGAGGG + Intergenic
1185499209 X:584582-584604 GAGGAAGAGAAAGAGGAGGAGGG + Intergenic
1185499269 X:584836-584858 GAGGAAGAGAAAGAGGAGGAGGG + Intergenic
1185499280 X:584887-584909 GAGGAAGAGAAAGAGGAGGAGGG + Intergenic
1185815174 X:3148334-3148356 TTGGAGAAGAAAGATGAAGAGGG + Intergenic
1186109057 X:6236751-6236773 GTGGAAAAGCATGACCAGGAAGG - Intergenic
1186178422 X:6949371-6949393 GAGGAAAAGGATAAGGAGGAGGG - Intergenic
1186952132 X:14638181-14638203 TTGGAGAAGTATGAAAAGGAAGG + Intronic
1187049864 X:15685187-15685209 TTTGGAAAGAATGAGGAGAATGG + Intergenic
1187266872 X:17741735-17741757 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1187620600 X:21049160-21049182 TTCTAAAAAAATGAGGAGGAGGG + Intergenic
1187624651 X:21097038-21097060 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
1187637905 X:21252983-21253005 TTGGAAAAGAAACAGCAGGATGG - Intergenic
1187738687 X:22331145-22331167 TTGGAAAAGCATGAGGTCAAGGG + Intergenic
1188073765 X:25749781-25749803 TAGGAAAGGAAAGAGGAGGATGG - Intergenic
1188146544 X:26620840-26620862 GGGGAAAAGGGTGAGGAGGATGG + Intergenic
1188283214 X:28296540-28296562 TTCTAAAACAATGAGGAGAAAGG + Intergenic
1188710664 X:33393350-33393372 TTCTAAAAAACTGAGGAGGAGGG + Intergenic
1188711584 X:33406860-33406882 TTCCAAATGATTGAGGAGGAAGG - Intergenic
1188796837 X:34477546-34477568 TTGAATAAGAATGATGAGAAAGG + Intergenic
1188900773 X:35730639-35730661 TTCCAAAAAACTGAGGAGGAGGG - Intergenic
1189020234 X:37328996-37329018 TAGGAAAAGAAGGAGGAAGGGGG + Intergenic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189112208 X:38303093-38303115 GTTGAAAAGAAGGAGGAAGAAGG - Intronic
1189207503 X:39254437-39254459 CTAGAAAAGGAGGAGGAGGATGG + Intergenic
1189398611 X:40645541-40645563 GTGGAAAAAAATGGGGAAGATGG + Intronic
1189653431 X:43214689-43214711 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1189834007 X:45002868-45002890 TTGGAGAAGAATGAAAAGGGGGG - Intronic
1189866806 X:45338888-45338910 TTCCAAAAGACTGAGAAGGAGGG + Intergenic
1189951999 X:46241874-46241896 TTTTAAAAGATTGAAGAGGAGGG + Intergenic
1190497179 X:51037847-51037869 TAGGAAAAGGATGAGGAGGAGGG + Intergenic
1190556637 X:51642231-51642253 TAGGAAAAGCATGAGGATTAGGG + Intergenic
1190988777 X:55524074-55524096 TTGGAAAAGGCTGAGAAGGCAGG - Intergenic
1191175163 X:57491617-57491639 TTCCAAAAAATTGAGGAGGATGG - Intergenic
1191221770 X:57997216-57997238 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1191610884 X:63111757-63111779 CCGAAAAAAAATGAGGAGGAAGG + Intergenic
1191811431 X:65193196-65193218 TTCCAAAAAATTGAGGAGGAAGG - Intergenic
1191919229 X:66236648-66236670 TTGCAAAAAAATGAGAAGGAGGG - Intronic
1192192476 X:68999888-68999910 TTGGGGAAGAATCAGCAGGAGGG - Intergenic
1192281435 X:69690684-69690706 TTGGAAGAGTTTGAGAAGGATGG + Intronic
1192296829 X:69858766-69858788 TTTCAAAAAAATGATGAGGAGGG - Intronic
1192561388 X:72130288-72130310 AGGAACAAGAATGAGGAGGAAGG - Exonic
1192635320 X:72810227-72810249 TTGGAAAAGAACAAGCATGAAGG - Intronic
1192646394 X:72910576-72910598 TTGGAAAAGAACAAGCATGAAGG + Intronic
1192700869 X:73470513-73470535 TTCTAAAAAATTGAGGAGGAGGG - Intergenic
1192747180 X:73950825-73950847 GTGGAAAAGATGGAGGAGGCAGG + Intergenic
1192892240 X:75402836-75402858 TTCCAGAAAAATGAGGAGGAAGG + Intronic
1193353190 X:80485334-80485356 TTTGAAAAGAATGAGAAGGTAGG - Intergenic
1193359786 X:80567906-80567928 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1193391398 X:80932960-80932982 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1193418654 X:81256064-81256086 TTGTGAAATAATGAGGAGTAAGG - Intronic
1193455575 X:81727683-81727705 TCCCAAAAAAATGAGGAGGAGGG + Intergenic
1193574170 X:83179058-83179080 TTGGAGAATAATAAGGGGGATGG - Intergenic
1193579624 X:83248426-83248448 CTGGAACAGAGTGAGGAAGAAGG - Intergenic
1193789906 X:85804944-85804966 TTACAAAAAATTGAGGAGGAAGG - Intergenic
1193863550 X:86700956-86700978 TTCCAAAAAATTGAGGAGGAGGG + Intronic
1193871361 X:86802844-86802866 TTGGGATAGATGGAGGAGGAGGG - Intronic
1194040490 X:88936239-88936261 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
1194069765 X:89307264-89307286 TTGAAAAAGAGTTAGGAGAATGG + Intergenic
1194137452 X:90163976-90163998 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
1194962668 X:100253673-100253695 TTACAAAAAATTGAGGAGGAGGG + Intergenic
1194982664 X:100456239-100456261 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1195473146 X:105256181-105256203 TTCCAAAAAATTGAGGAGGAGGG - Intronic
1196010751 X:110885383-110885405 TTACAAAAAATTGAGGAGGAAGG - Intergenic
1196218698 X:113086598-113086620 TCCAAAAAGATTGAGGAGGAGGG - Intergenic
1196240413 X:113337488-113337510 TTACAAAATATTGAGGAGGAGGG - Intergenic
1196295649 X:113993898-113993920 ATGGAAAAGAACGAAAAGGAGGG - Intergenic
1196434394 X:115661749-115661771 TTATAAAAGAAAGAGAAGGACGG + Intergenic
1196468507 X:115997168-115997190 TTCAAAAAAAATTAGGAGGAGGG - Intergenic
1196473431 X:116054999-116055021 TTGGAAAAAATTGAGGATGAGGG - Intergenic
1196584383 X:117412634-117412656 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1196603076 X:117623554-117623576 CTGGAAAAGAATAATGGGGAGGG - Intergenic
1196998548 X:121411926-121411948 TTACAAAATAATGAAGAGGAGGG - Intergenic
1197031763 X:121824656-121824678 TCTCAAAAGAATGAGAAGGAGGG + Intergenic
1197086675 X:122484916-122484938 TTGAAAAAGAATGAAGTTGAAGG + Intergenic
1197105481 X:122708798-122708820 TTGGATAAGAGTGATGAGTATGG - Intergenic
1197141466 X:123121954-123121976 TTGGAAAACGATGTGGAGGGTGG - Intergenic
1197158808 X:123300261-123300283 TTCTAAAAAATTGAGGAGGAGGG - Intronic
1197259068 X:124297238-124297260 TTCCAAAAAACTGAGGAGGAGGG + Intronic
1197795216 X:130291075-130291097 TTGGGGAAGAAAGAGGAAGATGG - Intergenic
1197815466 X:130493757-130493779 TTGGAAAAGAAGCAGTAAGATGG + Intergenic
1197902747 X:131391763-131391785 TTGGAAAATATGGAGAAGGAAGG - Intronic
1198011524 X:132561030-132561052 AAGGAACAGAATGAGGTGGAAGG - Intergenic
1198233594 X:134716109-134716131 CTGGAAAGGAAAGGGGAGGAGGG - Intronic
1198367000 X:135951218-135951240 CTGGAAACGAAGGATGAGGAAGG - Intergenic
1198455409 X:136812783-136812805 TAAGAAAAGAAAGAGGGGGAAGG + Intergenic
1198629775 X:138623337-138623359 TTCCAAAAAAATGAAGAGGAAGG - Intergenic
1198702508 X:139413498-139413520 TTGGAAAAGTAAGAGAAGAATGG - Intergenic
1198767525 X:140094280-140094302 CTGAAAAAATATGAGGAGGAGGG + Intergenic
1198974773 X:142324014-142324036 TTCCAAAAAATTGAGGAGGAAGG - Intergenic
1199165224 X:144664902-144664924 TTGCAAAAAATTGAGGTGGAGGG - Intergenic
1199561228 X:149164821-149164843 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1199681166 X:150225566-150225588 TTAGAAAAGTGTGAGGAGGGGGG - Intergenic
1199715771 X:150506418-150506440 TTTATAAAGAATGTGGAGGAAGG - Intronic
1199899360 X:152157957-152157979 TTGGAAAGGAATAAAGATGAGGG + Intergenic
1200142016 X:153907118-153907140 TAGGGAGAGAATGAGGAGGGAGG - Exonic
1200483182 Y:3733907-3733929 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
1200723912 Y:6641400-6641422 TTGAAAAAGAGTTAGGAGAATGG + Intergenic
1200887219 Y:8281671-8281693 CTGGCCAAGAAGGAGGAGGATGG - Intergenic
1201197863 Y:11511868-11511890 ATGGAAACGAATGTGAAGGAAGG + Intergenic
1201384984 Y:13430246-13430268 TTGCAAAAAAATGAGGAGGAGGG - Intronic
1201550197 Y:15210834-15210856 TTGGAAGAGAGAGAGGGGGAGGG + Intergenic
1202142163 Y:21736311-21736333 TTTGAAAAGAAGGAAGAAGAGGG - Intergenic
1202144702 Y:21767491-21767513 TTTGAAAAGAAGGAAGAAGAGGG + Intergenic