ID: 987226540

View in Genome Browser
Species Human (GRCh38)
Location 5:15847623-15847645
Sequence CATTATATGGAAAAGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987226532_987226540 17 Left 987226532 5:15847583-15847605 CCTATGCATATGAAAGAATTTCA 0: 1
1: 0
2: 5
3: 31
4: 348
Right 987226540 5:15847623-15847645 CATTATATGGAAAAGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987226540 Original CRISPR CATTATATGGAAAAGGTGGG GGG Intronic
No off target data available for this crispr