ID: 987227715

View in Genome Browser
Species Human (GRCh38)
Location 5:15861129-15861151
Sequence GTACTGCCATGGTCACACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987227715_987227718 0 Left 987227715 5:15861129-15861151 CCCAGGTGTGACCATGGCAGTAC 0: 1
1: 0
2: 0
3: 6
4: 128
Right 987227718 5:15861152-15861174 TGATACCTAAAACTTGAAACAGG 0: 1
1: 0
2: 1
3: 9
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987227715 Original CRISPR GTACTGCCATGGTCACACCT GGG (reversed) Intronic
901647641 1:10725183-10725205 GCAGTGACATGGTCACTCCTTGG - Intronic
904326599 1:29730601-29730623 GTACTGTCATGGTCCCCCTTTGG + Intergenic
907373331 1:54016962-54016984 GGACTGTCCTGGTCACACCATGG + Intronic
920135512 1:203765962-203765984 TTTCTGTCATGGTGACACCTAGG - Intronic
923670791 1:236039479-236039501 ATAATGCCCTAGTCACACCTGGG + Intronic
923730026 1:236541233-236541255 GTACTGCCAACTACACACCTAGG - Intronic
923873790 1:238024967-238024989 GCACTGCCCTGCTAACACCTTGG - Intergenic
923882600 1:238119831-238119853 GTTCTGCCATGCTCAGTCCTTGG - Intergenic
924043992 1:240009764-240009786 GTGCAGCCAGGGTCCCACCTTGG + Intergenic
1062861121 10:810573-810595 GCGCTGCAATGCTCACACCTTGG + Exonic
1065478612 10:26168558-26168580 GTACTGTCATAGTGACATCTAGG + Intronic
1066335525 10:34473708-34473730 CTACTGCCATGGCAACACCTAGG + Intronic
1072511636 10:96131761-96131783 TTTTTGCCATGGTCACACTTCGG + Intronic
1080880755 11:36318166-36318188 GTACAGCCTTTGCCACACCTGGG - Intronic
1083699097 11:64462797-64462819 CTGTTGCCATGGTGACACCTGGG - Intergenic
1084831631 11:71774254-71774276 CTATTGCCATGGTAACACCCGGG + Intergenic
1085522112 11:77144987-77145009 CTACTGCCCTGGTTACACTTTGG + Intronic
1086949114 11:92873222-92873244 GTCAGGCCATGGTCACACCCAGG + Intronic
1088832092 11:113545966-113545988 ATACTGTGATGGTCAAACCTGGG - Intergenic
1090505654 11:127310799-127310821 CTCCTGCCTTGTTCACACCTCGG - Intergenic
1090614145 11:128499746-128499768 GAACTGGCCTGGTCAAACCTCGG + Intronic
1091951819 12:4599182-4599204 GTCCTGCCATGGACACACTCTGG + Intronic
1093170235 12:15852145-15852167 CTACTGCCTTTGTCATACCTAGG - Intronic
1097013848 12:55971586-55971608 GTACTGGCTTGGTCACATCCTGG - Exonic
1097878546 12:64666681-64666703 GCACTGCCAAGGAAACACCTTGG - Intronic
1102450400 12:113037718-113037740 GTATTCCCATGCTCACACCCTGG + Intergenic
1104861661 12:131927439-131927461 GTACTGCCATGGCTTCCCCTGGG - Intergenic
1112656178 13:101454221-101454243 TTACTGCGATTGTCACACTTTGG + Intronic
1113310553 13:109127609-109127631 GTACTGCCATGGGCGCCCCAAGG - Intronic
1116391403 14:44395166-44395188 GTGCTGCCATGATTGCACCTTGG - Intergenic
1116972449 14:51080721-51080743 ATACTGCCATGGTAACCCTTAGG + Intronic
1117798363 14:59417896-59417918 GTATTCACATGGTCATACCTTGG - Intergenic
1118294376 14:64555653-64555675 ATTATGCCATGATCACACCTGGG + Intronic
1202935828 14_KI270725v1_random:86666-86688 GTGCTGCCCTGGTCTGACCTGGG - Intergenic
1127713751 15:61627029-61627051 GAACTGCCATTGTCACTCATGGG + Intergenic
1130705259 15:86227093-86227115 GTACTGCCATTTTTACACATGGG - Intronic
1132008730 15:98255343-98255365 GGACAGCAATGATCACACCTGGG + Intergenic
1135355076 16:21762265-21762287 GTTCTGCCATCAGCACACCTTGG + Intergenic
1135453560 16:22578407-22578429 GTTCTGCCATCAGCACACCTTGG + Intergenic
1135867021 16:26113070-26113092 GTAGTGCCATAGTCACACAATGG + Intronic
1136265876 16:29117851-29117873 GAACTCCCAGTGTCACACCTGGG - Intergenic
1141336935 16:83164942-83164964 GTTCTGCCATGGTTTTACCTGGG - Intronic
1141486795 16:84345660-84345682 GTACTGCCCTGGTCCCTCCTAGG - Intergenic
1141512397 16:84521097-84521119 TTCCAGCCATGGTAACACCTGGG - Intronic
1142054689 16:87985758-87985780 GAACTCCCAGTGTCACACCTGGG - Intronic
1142297367 16:89234287-89234309 GAACTGCCATGTTGACTCCTGGG + Exonic
1143101087 17:4505174-4505196 CTCTAGCCATGGTCACACCTGGG + Intronic
1144830737 17:18129820-18129842 GATCAGCCATGGTCACCCCTGGG + Intronic
1146973605 17:37092654-37092676 GTTGTGCCCTGGTCACTCCTTGG - Intronic
1149546278 17:57506159-57506181 GTCCTGCCCTGGACAGACCTAGG - Intronic
1150717533 17:67584655-67584677 TTACTGTGATGGCCACACCTCGG + Intronic
1151245660 17:72792676-72792698 GAACTGCCATGATCCCTCCTGGG + Intronic
1151261073 17:72916496-72916518 CTGCTGCCATGGTAACAGCTGGG - Intronic
1156450472 18:37263709-37263731 GTCCTGCCCTGTTCACACCAGGG + Intronic
1164641199 19:29827169-29827191 GTACTGCCATGGTGCCATCTTGG - Intergenic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
1166963801 19:46515559-46515581 GTATTGTCATGGTCACTGCTGGG + Intronic
934305372 2:91817571-91817593 GTGCTGCCCTGGTCTGACCTGGG + Intergenic
934327884 2:92035177-92035199 GTGCTGCCCTGGTCTGACCTGGG - Intergenic
934466274 2:94265716-94265738 GTGCTGCCCTGGTCTGACCTGGG - Intergenic
934490404 2:94758580-94758602 GCACTGCAAGGGTCAGACCTGGG + Intergenic
936029585 2:109060415-109060437 GAACTTCCATGGCCACACCCAGG + Intergenic
940524011 2:154788910-154788932 GAACTGCCATAGTCACACTGAGG - Intronic
947206487 2:227666041-227666063 CTCCTGCCATGGTGACACCTTGG + Intergenic
948290500 2:236820666-236820688 CTTCTTCCAGGGTCACACCTGGG - Intergenic
948992336 2:241561447-241561469 GCACTGCCACGCTCCCACCTGGG - Intronic
948992354 2:241561498-241561520 GCACTGCCACGCTCCCACCTGGG - Intronic
948992370 2:241561549-241561571 GCACTGCCACGCTCCCACCTGGG - Intronic
948992388 2:241561600-241561622 GCACTGCCACGCTCCCACCTGGG - Intronic
948992404 2:241561651-241561673 GCACTGCCACGCTCCCACCTGGG - Intronic
948992422 2:241561702-241561724 GCACTGCCACGCTCCCACCTGGG - Intronic
948992438 2:241561753-241561775 GCACTGCCACGCTCCCACCTGGG - Intronic
1168860047 20:1039547-1039569 GTACTGCTCAGGCCACACCTGGG + Intergenic
1170703498 20:18725259-18725281 CTACTGCCATGGCAACACCACGG - Intronic
1175915866 20:62425498-62425520 GTCCTGCCAGGGCCACAGCTGGG - Intronic
1179165168 21:38929817-38929839 CTTCTGCCATGGGCCCACCTTGG + Intergenic
1180280175 22:10686342-10686364 GTGCTGCCCTGGTCTGACCTGGG - Intergenic
1180587396 22:16904874-16904896 GTGCTGCCCTGGTCTGACCTGGG - Intergenic
1180590633 22:16934181-16934203 GTACTGCCCTGGTTTGACCTGGG - Intergenic
1181770566 22:25122291-25122313 TGATTGCCATGGTAACACCTGGG + Intronic
1181770575 22:25122334-25122356 TGATTGCCATGGTAACACCTGGG + Intronic
950730808 3:14955267-14955289 GAACTGCCATGGTACTACCTGGG + Intronic
953911518 3:46895608-46895630 CTCCTGCCCTGGTGACACCTAGG - Intronic
959787313 3:110316176-110316198 CTTTTGCCATTGTCACACCTTGG + Intergenic
962767621 3:138580054-138580076 GTACTGCCAGGGTACCGCCTAGG - Intronic
963006782 3:140733921-140733943 GTACAGCCCTGCTAACACCTTGG - Intergenic
966301978 3:178489345-178489367 GTCCTCACATGGTCACCCCTTGG + Intronic
967567674 3:190991071-190991093 CCACTGCCATGGCAACACCTGGG - Intergenic
968861929 4:3179122-3179144 GTAGTGCCATTCTCACATCTGGG - Intronic
977408352 4:96629877-96629899 GTCCTGCCATGTTCAATCCTAGG - Intergenic
981519827 4:145649812-145649834 GTACTGCTGTGCTCCCACCTGGG - Intronic
985883783 5:2660213-2660235 GCAGTGCCAAGATCACACCTAGG + Intergenic
986029905 5:3883966-3883988 GCACAGCCATGGCCACACCCCGG - Intergenic
987227715 5:15861129-15861151 GTACTGCCATGGTCACACCTGGG - Intronic
990568545 5:57054835-57054857 CTCCTCCCATGGGCACACCTGGG + Intergenic
990904852 5:60792943-60792965 GGCCAGCCATGGTCAGACCTCGG - Intronic
992786466 5:80174887-80174909 GTACAGCCTTGGTCAAAACTGGG + Intronic
996620373 5:125494204-125494226 CTAATGGCATGGTCACACCTAGG + Intergenic
999269346 5:150287454-150287476 TTCCTGCCATGGCCACACCAGGG + Intronic
1000478547 5:161743651-161743673 GGCCTGCCATGATCACTCCTTGG + Intergenic
1003307689 6:4944542-4944564 GTGCTGCCATGATCGCTCCTGGG - Intronic
1003766535 6:9243348-9243370 CAACTGCCATGGTCACCCCATGG - Intergenic
1004061251 6:12200208-12200230 CTATTGCCATGGCAACACCTGGG + Intergenic
1005692053 6:28316066-28316088 GAACTGGCATGGCCACAACTAGG + Intergenic
1011239733 6:85258279-85258301 GTTCTGCAATGGCCACAGCTGGG + Intergenic
1013703704 6:112806767-112806789 GTGATGGCATGGTCATACCTGGG + Intergenic
1015390039 6:132671457-132671479 CTACTACCATAGTGACACCTGGG + Intergenic
1016741399 6:147533054-147533076 GTGCAGCCATGGTCAGGCCTTGG + Intronic
1017075633 6:150615217-150615239 GTACTTCCAGGACCACACCTTGG + Intronic
1020695657 7:11410750-11410772 GTACTTAGATGGTCACAGCTGGG + Intronic
1020849296 7:13330345-13330367 GTAATGCCATGGTGAGATCTTGG + Intergenic
1020891866 7:13888310-13888332 GTAGTGCCATGGTGAGATCTTGG - Intergenic
1023862496 7:44224883-44224905 GTACTGCCCTGGGGGCACCTGGG - Intronic
1029150636 7:98477882-98477904 CCACTGCCATGGTAACACCTGGG + Intergenic
1030985282 7:116234372-116234394 GAACTGCCATGTACATACCTGGG + Intronic
1033118408 7:138646284-138646306 GTTCTGCCACAGTAACACCTGGG + Intronic
1045818696 8:106308517-106308539 ATACTGACCTGGTCAGACCTAGG + Intronic
1053354922 9:37437452-37437474 CAAGTGCCATGGTCACAACTGGG - Intergenic
1053696323 9:40642488-40642510 GTGCTGCCCTGGTCTGACCTGGG - Intergenic
1054307574 9:63441716-63441738 GTGCTGCCCTGGTCTGACCTGGG - Intergenic
1054406301 9:64765718-64765740 GTGCTGCCCTGGTCTGACCTGGG - Intergenic
1054439930 9:65251191-65251213 GTGCTGCCCTGGTCTGACCTGGG - Intergenic
1054490476 9:65770748-65770770 GTGCTGCCCTGGTCTGACCTGGG + Intergenic
1055155536 9:73058248-73058270 CTACTTCCATTGTCACATCTTGG - Intronic
1062205204 9:135332678-135332700 GAACCTCCATGCTCACACCTAGG + Intergenic
1202778771 9_KI270717v1_random:16149-16171 GTGCTGCCCTGGTCTGACCTGGG - Intergenic
1203585847 Un_KI270747v1:2557-2579 GTGCTGCCCTGGTCTGACCTGGG - Intergenic
1189261820 X:39684550-39684572 GCACTGTCATGTTCCCACCTGGG + Intergenic
1192143928 X:68667923-68667945 GTTCTGCTCTGGTCACACTTGGG - Intronic
1193069613 X:77294364-77294386 GTACTGACATGGGCACATCATGG - Intergenic
1194146276 X:90268937-90268959 GTACTGCCTTGGTTCCACTTTGG + Intergenic
1196139873 X:112249291-112249313 GTACTCACATGATCAAACCTTGG - Intergenic
1198024984 X:132696109-132696131 ATACTGCCATGGTGAAAACTTGG - Intronic
1200492019 Y:3838208-3838230 GTACTGCCTTGGTTCCACTTTGG + Intergenic
1201194072 Y:11474417-11474439 GTGCTGCCCTGGTCTGACCTGGG - Intergenic