ID: 987228001

View in Genome Browser
Species Human (GRCh38)
Location 5:15863645-15863667
Sequence CCCACTAGGCCCCACCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 7, 3: 47, 4: 379}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987228001_987228007 -6 Left 987228001 5:15863645-15863667 CCTGGGAGGTGGGGCCTAGTGGG 0: 1
1: 0
2: 7
3: 47
4: 379
Right 987228007 5:15863662-15863684 AGTGGGAGGTATTTGGGTCATGG 0: 20
1: 324
2: 1199
3: 4112
4: 10754

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987228001 Original CRISPR CCCACTAGGCCCCACCTCCC AGG (reversed) Intronic
900095157 1:937243-937265 CCCGCTAAGCCGCACCTCCCTGG + Intronic
900118751 1:1039816-1039838 CCCACACGCCCCCTCCTCCCTGG - Intronic
900420214 1:2553008-2553030 CCCACTCTGTCCCACCACCCAGG - Intergenic
900424217 1:2568650-2568672 CCCACTCTGTCCCACCACCCGGG + Intergenic
900427417 1:2586941-2586963 TCCACCCGGCCTCACCTCCCCGG - Exonic
900518533 1:3094801-3094823 GGGACAAGGCCCCACCTCCCTGG - Intronic
900612980 1:3552234-3552256 CCCACCAGGGCCAGCCTCCCAGG + Intronic
900645964 1:3708870-3708892 CCCACGAGGCCCCGCCTCCCCGG + Intronic
901007750 1:6180007-6180029 CCCACTGGGCCCCGCATGCCCGG + Exonic
902513929 1:16980031-16980053 CCCCCTGTCCCCCACCTCCCAGG - Intronic
902532953 1:17102323-17102345 CAGGCTAGGCTCCACCTCCCTGG + Intronic
903143651 1:21355815-21355837 CCCACTTGGCTCCACAGCCCTGG - Intergenic
903420579 1:23215989-23216011 CCCTCTAGGTCCCAGCTTCCTGG + Intergenic
903672754 1:25046195-25046217 CCCACTACCCTGCACCTCCCGGG - Intergenic
905472818 1:38206342-38206364 GACACTAGTACCCACCTCCCAGG - Intergenic
905628009 1:39501179-39501201 CCCACTGGCCCCCTCCTCCATGG + Intronic
906124812 1:43421282-43421304 CCCTCCAGGCTCCACCACCCCGG + Exonic
906545531 1:46616941-46616963 CGCACTCGCCCCCACCTTCCCGG + Intergenic
906567355 1:46810739-46810761 CCAGCTAGGCCCCAAGTCCCTGG - Intronic
908007417 1:59741240-59741262 CCCACCAGGGCCCTCCTCACTGG - Intronic
908034517 1:60037630-60037652 CCTATTAGGTCCCATCTCCCAGG + Intronic
911039440 1:93580066-93580088 CACCCTCAGCCCCACCTCCCAGG + Intronic
911602988 1:99867409-99867431 CCCTCTTGGCCACACCTACCAGG - Intronic
911727211 1:101255137-101255159 CCCACTAAGCCCCAGCTACCTGG - Intergenic
912395159 1:109336731-109336753 CCCTGCAGCCCCCACCTCCCGGG - Intronic
912680104 1:111723531-111723553 CCCACCCTGCCCCACTTCCCTGG - Exonic
913009602 1:114670100-114670122 CCCCCTAGCCCCGCCCTCCCTGG + Intronic
914995939 1:152543459-152543481 CCCACCATGCCCCACATCCTGGG + Intronic
915122958 1:153643307-153643329 CGCCCTAGGCCCCCTCTCCCAGG - Exonic
915579894 1:156807262-156807284 CCCACCAGCCCCCACCCGCCTGG - Exonic
917528865 1:175815047-175815069 CCCAGGAGGCCCCACCTTCCTGG - Intergenic
918208215 1:182328282-182328304 CACTCTAGCCTCCACCTCCCAGG - Intergenic
918378543 1:183932834-183932856 CCCATGAGTCCCCACCTCCTTGG + Intronic
920388854 1:205586374-205586396 CCAGGTAGGCTCCACCTCCCAGG - Intronic
920409658 1:205749608-205749630 CCCAAGAGGCCCCACCTCCTCGG - Intronic
921048023 1:211491147-211491169 CCTTCTAGGCCCGATCTCCCTGG + Intronic
921190003 1:212700163-212700185 CCCCCTGGTCCCCACCCCCCCGG - Intergenic
922111778 1:222565784-222565806 CCCTGTAGCCTCCACCTCCCTGG - Intronic
922221732 1:223613513-223613535 ACCAAGAGGCCCCACCTGCCTGG - Intronic
922501345 1:226098974-226098996 CCCACCAGGCCCCACCTCATAGG - Intergenic
922812707 1:228426702-228426724 CCCACTGGCCCCCCCCTCCCTGG - Intergenic
922958547 1:229625790-229625812 CCGCCGAGGCCCCACCGCCCCGG + Intronic
923259840 1:232258159-232258181 CTCACTAGGCTCCACCACCCTGG - Intergenic
924384249 1:243487732-243487754 CCCAGGAAGCCCCGCCTCCCCGG - Intronic
924628691 1:245716688-245716710 CCCACTAGACTCCACATCCCTGG - Intergenic
1063043470 10:2368152-2368174 CCCACATGGCTCCAGCTCCCAGG + Intergenic
1063381822 10:5590546-5590568 CCCACCGCGCCCCCCCTCCCTGG + Intergenic
1066129952 10:32383425-32383447 CACAGTAGGCTCGACCTCCCAGG + Intergenic
1067436848 10:46284647-46284669 GCCACCAGGCCCCGCCTTCCTGG + Intergenic
1067577912 10:47419551-47419573 CCCAGCAGGCTCCTCCTCCCAGG - Intergenic
1067713877 10:48672002-48672024 CCCACCAGCCCCAGCCTCCCAGG + Intergenic
1069579389 10:69554960-69554982 GCCACTTCTCCCCACCTCCCTGG + Intergenic
1069685093 10:70312804-70312826 CTCACTAGCCCCCTCCTCCCTGG - Intronic
1069912396 10:71767530-71767552 CCCGCCAGGCCCCATCCCCCAGG + Intronic
1070479980 10:76872650-76872672 CCCATTAAGTCCCATCTCCCTGG + Intronic
1071186162 10:83048577-83048599 CTCTCTAGGCCCCAGCTCCAGGG + Intergenic
1071733969 10:88277324-88277346 CCCCCAACCCCCCACCTCCCCGG - Intronic
1072662299 10:97370440-97370462 CCCCCTGGGCCTCACCTTCCTGG + Exonic
1076202031 10:128566631-128566653 CCCACTGGGCCCAACCTCCCAGG - Intergenic
1076344849 10:129773243-129773265 CCCAGTAGGCCACACCTTGCAGG - Intergenic
1076605780 10:131689140-131689162 CCCACCTGCCCCCACCTCCCAGG + Intergenic
1077298731 11:1837729-1837751 CTCTCTGGCCCCCACCTCCCCGG - Intergenic
1077308595 11:1878650-1878672 CCCACTGGGCCCCAGTCCCCTGG - Intronic
1077480611 11:2812752-2812774 CCCCCGAGGCCCCACGCCCCCGG + Intronic
1077503264 11:2918771-2918793 CACTGTAGGCCCCACCTCCCAGG + Intronic
1077545472 11:3167461-3167483 CCCAGTAGGCCCCACCATCCAGG + Intergenic
1078085621 11:8231660-8231682 CCCACCCCTCCCCACCTCCCCGG + Intronic
1078463193 11:11530896-11530918 CCCACTTGACCCTACCTCCTTGG - Intronic
1078470912 11:11585908-11585930 TCCCGAAGGCCCCACCTCCCTGG - Intronic
1078534193 11:12160220-12160242 CCCACTGGGCACCACCTGCCAGG - Intronic
1079056023 11:17207580-17207602 CCCACCAGGCCCCTCTTCTCGGG - Intronic
1080519966 11:33060244-33060266 TCCACTATGCCCCAGCTTCCAGG - Intronic
1081991666 11:47341272-47341294 CCCACTGGGCCACACACCCCTGG + Intronic
1083954695 11:65976935-65976957 CCCACTGGTCACCACCTGCCAGG - Intronic
1087066696 11:94034093-94034115 CCCTCTTTGCCCCAACTCCCAGG - Intronic
1087626712 11:100604034-100604056 CCCACTAGGCACTTCATCCCAGG - Intergenic
1087651543 11:100874310-100874332 CCCACTAGGCCCTGATTCCCAGG + Intronic
1090404328 11:126467904-126467926 TCCACTGGGCACCCCCTCCCTGG - Intronic
1091051676 11:132378340-132378362 CTCAATAGGCCCCACCCCACTGG - Intergenic
1091254707 11:134173264-134173286 CCCACCATCCCCCGCCTCCCTGG - Intronic
1091601659 12:1921586-1921608 GCCACGAGGCCCCACCTGGCTGG + Intergenic
1091601671 12:1921680-1921702 GCCACGAGGCCCCACCTGGCTGG + Intergenic
1091601683 12:1921774-1921796 GCCACGAGGCCCCACCTGGCTGG + Intergenic
1091601695 12:1921868-1921890 GCCACGAGGCCCCACCTGGCTGG + Intergenic
1091601707 12:1921962-1921984 GCCACGAGGCCCCACCTGGCTGG + Intergenic
1091601719 12:1922056-1922078 GCCACGAGGCCCCACCTGGCTGG + Intergenic
1092160296 12:6312055-6312077 CCCACTATACCCTCCCTCCCAGG + Intronic
1092605256 12:10111629-10111651 CCCACTTGTCCCCACCCACCGGG - Intergenic
1098298867 12:69033339-69033361 ACCACGTGGCCCCACCTGCCTGG - Intergenic
1098817216 12:75182445-75182467 CTCACTAAGCTCCGCCTCCCAGG - Intronic
1102153113 12:110702308-110702330 CCCACTTGGCCCCAAGCCCCTGG - Intronic
1105725654 13:23160130-23160152 CCCACCACTCCACACCTCCCGGG - Intergenic
1105745804 13:23375757-23375779 CCCACCAGGCTCCGCCTGCCAGG + Intronic
1106335371 13:28778422-28778444 CCCCCGAGGCCCCAGCTCCCTGG - Intergenic
1107549494 13:41461759-41461781 CCCACAAGGTCCCCTCTCCCAGG - Intronic
1113487424 13:110664439-110664461 CACTCTAGGCCCAACCTCCTGGG - Intronic
1113848965 13:113407284-113407306 CCCACTGGGCCCCGTCTCCCTGG + Intergenic
1115502281 14:34060384-34060406 CCACCTAGGCGCCCCCTCCCGGG - Intronic
1117456802 14:55905942-55905964 CCCCCAAGGCCCCTCCTCCAAGG + Intergenic
1118320469 14:64749508-64749530 CCCACAGCCCCCCACCTCCCGGG + Exonic
1119708527 14:76803837-76803859 CCCACTGTGGCCCAGCTCCCTGG - Exonic
1121602834 14:95218730-95218752 CCCACTGGGCCCCATTTACCAGG - Intronic
1121725848 14:96149171-96149193 CCAACTATCCCCCACTTCCCTGG - Intergenic
1122864430 14:104597154-104597176 CTCACTGGACACCACCTCCCAGG + Intronic
1125471540 15:40009163-40009185 CTCACTAGCCCCTACCTTCCAGG + Intronic
1125502534 15:40248470-40248492 CACACGTGCCCCCACCTCCCCGG + Intronic
1125781456 15:42273098-42273120 CCAACTGGGACCCACCTCCCTGG - Intronic
1126503417 15:49374617-49374639 CCATCTAGGCTCCGCCTCCCAGG + Intronic
1128333496 15:66771417-66771439 CCTGCTTGGCCCCACCTCTCTGG - Intronic
1128454037 15:67822927-67822949 CACTCTAGGCTCCACCACCCTGG + Intronic
1129735066 15:77955786-77955808 CACTGTAGCCCCCACCTCCCAGG + Intergenic
1129997744 15:80021316-80021338 CTCACTAGTCTCCACCTCCCAGG - Intergenic
1131321689 15:91399866-91399888 CCCTCATGGCCCCAGCTCCCAGG - Intergenic
1131562475 15:93456612-93456634 GCCACTCAGCCCCACCTTCCTGG - Intergenic
1131830520 15:96352077-96352099 CCCTCCACGCCCCACCCCCCCGG - Intergenic
1132493737 16:249651-249673 CCCACCAGTCCTCACCTACCTGG - Exonic
1132580719 16:683536-683558 CCCCCAGGACCCCACCTCCCTGG - Exonic
1132757240 16:1491644-1491666 CTCCCTCGGCTCCACCTCCCGGG + Intergenic
1133276116 16:4639370-4639392 CCCACCCCGCCCCACCTTCCCGG - Intronic
1133629137 16:7602392-7602414 CCCACTGGTCCCAGCCTCCCAGG - Intronic
1133839678 16:9396196-9396218 TCCTCTGGGCCCCACCTGCCAGG + Intergenic
1133943420 16:10329045-10329067 CCATCTCGGCTCCACCTCCCGGG + Intronic
1134206383 16:12241746-12241768 GCCACCAGGCCCAGCCTCCCTGG + Intronic
1134257701 16:12625598-12625620 CGCTGTAGCCCCCACCTCCCAGG - Intergenic
1134605081 16:15563944-15563966 CTCACTCACCCCCACCTCCCAGG - Intronic
1134820664 16:17244253-17244275 CCCCCAAGGCCCCACCCCCAGGG - Intronic
1136251358 16:29007603-29007625 CCATCTAGGCTCCGCCTCCCAGG - Intergenic
1136498915 16:30659970-30659992 CCCATTAGGCCCCACCTGCAAGG - Exonic
1136535395 16:30896455-30896477 CCCACTAGGCCCCACGGACGAGG + Intergenic
1137613818 16:49835554-49835576 CCCACTGGCCCGCATCTCCCCGG - Intronic
1138746374 16:59367484-59367506 CCAACTTGGCTCCACCTCCCGGG - Intergenic
1139297908 16:65919047-65919069 CCCACTTACCTCCACCTCCCTGG + Intergenic
1139393798 16:66623587-66623609 CCCACGATACCCAACCTCCCTGG + Intronic
1139438483 16:66950495-66950517 CCCACCAGCTCCCACCTGCCTGG - Intergenic
1139632704 16:68240056-68240078 CGCGTTGGGCCCCACCTCCCGGG + Intergenic
1140112933 16:72019029-72019051 CACAGTAGCCTCCACCTCCCAGG + Intronic
1141040533 16:80669311-80669333 CCCCCAAGGCCCCACAGCCCAGG + Intronic
1141660851 16:85440755-85440777 CCAGCAAGGCCCCACCTCCACGG - Intergenic
1141770213 16:86085330-86085352 CCCCCCAGGCCCCACCCCACTGG + Intergenic
1142059881 16:88022501-88022523 CCCACTAGGTACCACCACCTGGG - Intronic
1142108581 16:88319214-88319236 CCCCCTTGGCCTCACCTCCGAGG + Intergenic
1143472380 17:7184030-7184052 GCCACTGTCCCCCACCTCCCTGG - Intergenic
1143484017 17:7243105-7243127 CCCAGCCGGCCCCGCCTCCCCGG - Intronic
1143731656 17:8885620-8885642 CCCCCATGGCCCCACCTCCTGGG + Intronic
1143949392 17:10620654-10620676 CTCACCAGACCCCACCTTCCAGG - Intergenic
1144313524 17:14036831-14036853 CCCATCAGGCCCCACCTCCAAGG + Intergenic
1144481154 17:15630071-15630093 CCTACCAGGCCCCACGTCCCTGG + Intronic
1144737525 17:17563395-17563417 CCCTCTCAGCCCCACCTCGCAGG + Intronic
1144783310 17:17818529-17818551 CCTAGTAGCACCCACCTCCCAGG + Intronic
1144830322 17:18127470-18127492 CCCACCTGGCCTCACCTTCCTGG + Intronic
1144852340 17:18250431-18250453 CGCCCTTGGCCCCACCTCCTTGG + Intronic
1144917156 17:18733660-18733682 CCTACCAGGCCCCACGTCCCTGG - Intronic
1147296279 17:39485485-39485507 CTCACTAATCTCCACCTCCCGGG + Intronic
1147327752 17:39677890-39677912 CCCACTTGTCCCCACCGCCATGG - Intronic
1147425480 17:40344077-40344099 CCCACTCCACCCCTCCTCCCTGG - Intronic
1148152359 17:45404357-45404379 CCCACCAAGTCCCTCCTCCCAGG + Intronic
1149593713 17:57850580-57850602 CCCACTAAGCCCCTCGTCCCCGG + Intergenic
1150228643 17:63538007-63538029 CCCACTGGGCCACACCACCAAGG - Intronic
1150250521 17:63701935-63701957 CACTGTAGGCTCCACCTCCCGGG - Intergenic
1150287439 17:63962086-63962108 CCCACAAAGCCCCACCCCTCAGG + Intronic
1150751262 17:67864878-67864900 CACTCTAGGCTCCACCTCCTGGG + Intronic
1151475590 17:74342889-74342911 CCCACTCCCCACCACCTCCCTGG + Intronic
1151699930 17:75737662-75737684 CTCCCAAGGCCCCACATCCCAGG + Intronic
1151825780 17:76523464-76523486 CCCACTAGTCCCCTGCACCCAGG + Intergenic
1151879515 17:76886655-76886677 CCCAGGTGGCCCCTCCTCCCTGG - Intronic
1152618781 17:81350500-81350522 CCAACCAGGCCCCACCCCGCAGG + Intergenic
1152624003 17:81380049-81380071 CCCACTAGCCCCCATCCCCCTGG + Intergenic
1153391754 18:4569502-4569524 CCCTGTAAGCTCCACCTCCCGGG - Intergenic
1157638220 18:49183988-49184010 CCCACTAGACCCCACCCTACTGG + Intronic
1158265946 18:55660868-55660890 CACACTAGTACCCACCTCCGGGG - Intronic
1161375260 19:3936680-3936702 CCCTCTCAGCTCCACCTCCCCGG - Intronic
1161497673 19:4596468-4596490 CCCCCCAGGCCCCTCCTCCCTGG - Intergenic
1161950016 19:7462683-7462705 ATCACCAGGACCCACCTCCCAGG - Intronic
1162145771 19:8611339-8611361 CCCACTCAGCCCCTCCTCCAGGG - Intergenic
1162514111 19:11138069-11138091 CCCTCGAGCCGCCACCTCCCAGG - Intronic
1162779829 19:13001143-13001165 CCCACTTGCCCCCACATCCAGGG - Intronic
1163236281 19:16032336-16032358 CTGACTAGGCCCCACTACCCAGG - Intergenic
1163236314 19:16032484-16032506 CTGACTAGGCCCCACTACCCAGG - Intergenic
1163236536 19:16033410-16033432 CTGACTAGGCCCCACTACCCAGG - Intergenic
1163863495 19:19754632-19754654 CTGACTAGGCCCCACCAACCTGG + Intergenic
1164535734 19:29085285-29085307 CTCACTCTGCCCCACCTCTCAGG + Intergenic
1165287574 19:34854556-34854578 CCCTATAGCCTCCACCTCCCGGG + Intergenic
1165324095 19:35104192-35104214 CCCACTCTGCGCCAGCTCCCCGG - Intergenic
1165756680 19:38297330-38297352 CCCCCTACCCCCCACCACCCTGG - Intronic
1165838554 19:38773514-38773536 CCCAGCAGGCCCCACCACCACGG - Intergenic
1165841005 19:38789183-38789205 CCCAGCAGGCCCCACCACCACGG + Intergenic
1166011699 19:39947525-39947547 CACTCTAAGCTCCACCTCCCGGG + Intergenic
1167331700 19:48860200-48860222 TCTTCTAGGCCCCACCTCCAGGG - Intronic
1167509236 19:49887623-49887645 CCCTCTCCGCCCAACCTCCCAGG - Intronic
1167588067 19:50386211-50386233 CTCACTAACCTCCACCTCCCGGG + Intronic
1167672059 19:50859130-50859152 CCCTCTAGGCCCCTCCTCCCAGG - Intronic
1167674807 19:50877543-50877565 CCCTCCCGGCCCCTCCTCCCAGG - Intronic
1167738632 19:51311585-51311607 CCCCCTTGACCCCGCCTCCCCGG + Intergenic
1167770311 19:51510631-51510653 CCCTCTTGGCAGCACCTCCCAGG - Intergenic
1168108818 19:54180720-54180742 CCCAGCAGCCCCCACCTCCAAGG - Intronic
1168121464 19:54254534-54254556 CACACTTGGCCCCATCTCCTGGG - Intronic
1168289242 19:55349003-55349025 CCCCCTTGTCCCCGCCTCCCAGG - Intergenic
1168403046 19:56097096-56097118 CCCACCAGCCCCCAGCTCCACGG + Intronic
925057939 2:869700-869722 CCCACCAGGTCCCACCTCCAGGG - Intergenic
925200144 2:1960688-1960710 CCCACAATGCATCACCTCCCTGG + Intronic
925427483 2:3762702-3762724 CCCACCAGGCCCCACCTCCAAGG + Intronic
925843727 2:8017285-8017307 CCCACTAGGCCCCTGGTTCCAGG + Intergenic
925856333 2:8133115-8133137 CCCACTCTGCCCCACATCCTGGG - Intergenic
926702244 2:15811329-15811351 CCCACCAGGCTCCTCCTCCGAGG - Intergenic
926800297 2:16654069-16654091 CCCACCAGCTCCCACCTCACAGG - Intronic
927846277 2:26474256-26474278 GCCCCTAGGCCCCAGCCCCCAGG + Intronic
928922452 2:36539659-36539681 CCCACTTCTCCCCACCTCCACGG - Intronic
928978107 2:37110144-37110166 CACAGCAGCCCCCACCTCCCAGG + Intronic
930146929 2:48017010-48017032 CACCCTAGCCTCCACCTCCCGGG + Intergenic
930518746 2:52436863-52436885 CACACTTGGCTTCACCTCCCAGG - Intergenic
931802700 2:65774120-65774142 CCCTGTAAACCCCACCTCCCAGG + Intergenic
932471438 2:71962029-71962051 CCCTCCAGGCCCCAGCTCACAGG + Intergenic
932806936 2:74792417-74792439 CCTACTAGGCCCTGCCTTCCTGG - Intergenic
935970057 2:108522603-108522625 CCCTCCAAGCTCCACCTCCCGGG + Intergenic
936295069 2:111261718-111261740 CCCACTAGGGCCCACCTCCAGGG - Intergenic
936600323 2:113889406-113889428 CCCCCCAACCCCCACCTCCCAGG - Intergenic
937617653 2:123944656-123944678 CCCTGTAGCCACCACCTCCCCGG - Intergenic
937863921 2:126733640-126733662 ACCACTGGGCTCCACGTCCCTGG - Intergenic
941399292 2:165010993-165011015 CCCACTAGCCCTCAGCCCCCAGG + Intergenic
941431738 2:165422224-165422246 CCCACCAGGCCCCTCCCACCAGG + Intergenic
941987319 2:171522378-171522400 CCCAAGAGGCCCCACATTCCGGG + Exonic
942253938 2:174073055-174073077 CACAGTAGCCTCCACCTCCCAGG + Exonic
942826765 2:180187066-180187088 CCCTGCAGCCCCCACCTCCCAGG - Intergenic
944258248 2:197647296-197647318 CTCTGTAGCCCCCACCTCCCGGG + Intronic
944260279 2:197668781-197668803 CCCAGTATGCCCTTCCTCCCTGG + Intronic
944343570 2:198633324-198633346 TTCACTAAGCCCCACCTCTCTGG - Intergenic
945296219 2:208174026-208174048 CCCAGCAGCCTCCACCTCCCAGG + Intronic
945870475 2:215220790-215220812 CTCTCTAGGCTCCACCTCTCAGG + Intergenic
946413010 2:219524840-219524862 CCCACTGGGCGCAACCTCACAGG - Intronic
946698504 2:222386089-222386111 CACTCTAGCCCCAACCTCCCAGG + Intergenic
947601868 2:231456375-231456397 TCCACTGGGCCCCACCTGCTTGG - Intronic
947641752 2:231710839-231710861 CCCGCGAGGCCGCACCGCCCCGG - Intronic
947652213 2:231796416-231796438 CTCACTAAGCCCCAGCTCCCAGG - Intronic
948851999 2:240713081-240713103 GCCAGTAGGGTCCACCTCCCAGG + Intergenic
948929953 2:241125813-241125835 CCCACCAGCCCCCACCTCAGTGG - Intronic
1168958039 20:1848509-1848531 CTCACCTGGCCCCACCTGCCAGG + Intergenic
1169084722 20:2819649-2819671 CTCACTGCGCTCCACCTCCCAGG + Intronic
1170359818 20:15533804-15533826 CCCACTCCACCCTACCTCCCAGG - Intronic
1171946990 20:31387679-31387701 CCCAGTGGGCCCCACCCTCCAGG + Intronic
1172020176 20:31908507-31908529 CCCCCTCGGCAGCACCTCCCTGG + Intronic
1172320882 20:33994306-33994328 CCCACTCGGACCCGCCGCCCCGG + Intronic
1172972557 20:38883995-38884017 CCCACAAAGCCCCAAGTCCCAGG - Intronic
1175498945 20:59435699-59435721 TGCTCTAGGCCTCACCTCCCAGG + Intergenic
1175790644 20:61738063-61738085 CCCTCTGGGGCCCACCTCCTTGG + Intronic
1176102977 20:63372888-63372910 CGCACTCGTCCCCACCTGCCTGG + Intronic
1176215261 20:63944859-63944881 CCCACTCCTCCCCACCTGCCAGG - Intronic
1177774412 21:25551891-25551913 CCCACCAGGCCCTACCTCCAAGG + Intergenic
1178027659 21:28486537-28486559 CACACCAGCCTCCACCTCCCGGG - Intergenic
1178992699 21:37367865-37367887 CCCCCCAGGCCCCGGCTCCCGGG - Intronic
1180758211 22:18177900-18177922 CCCACTGGGCTCCCCCACCCAGG - Intergenic
1180768499 22:18361692-18361714 CCCACTGGGCTCCCCCGCCCAGG - Intergenic
1180777811 22:18500699-18500721 CCCACTGGGCTCCCCCACCCAGG + Intergenic
1180810537 22:18758010-18758032 CCCACTGGGCTCCCCCGCCCAGG + Intergenic
1181056397 22:20262376-20262398 CCCACTCTGCCCTGCCTCCCAGG - Intronic
1181196680 22:21192265-21192287 CCCACTGGGCTCCCCCGCCCAGG + Intergenic
1181212845 22:21300859-21300881 CCCACTGGGCTCCCCCGCCCAGG - Intergenic
1181277222 22:21694674-21694696 GCCGCCACGCCCCACCTCCCTGG - Intronic
1181528809 22:23504429-23504451 CCCCCCAGGCCCTCCCTCCCTGG + Intergenic
1182145557 22:27994782-27994804 CCCATTAGTCACCTCCTCCCAGG - Intronic
1182739062 22:32553748-32553770 TTCACCAGGCCCCACCTCACTGG - Intronic
1185237116 22:49720529-49720551 CCCAGCAGCCCCCACCTCCTGGG + Intergenic
1185326270 22:50227309-50227331 CCCAGCAGGCCCTCCCTCCCAGG + Intronic
1185408633 22:50671686-50671708 CCCACCAGACCCCACCGGCCAGG - Intergenic
1203230117 22_KI270731v1_random:102580-102602 CCCACTGGGCTCCCCCGCCCAGG - Intergenic
1203276518 22_KI270734v1_random:90822-90844 CCCACTGGGCTCCCCCCCCCAGG - Intergenic
949165161 3:931597-931619 CCCACTTCTCCCCACCTCCATGG + Intergenic
949947534 3:9202425-9202447 CCCTCTAAGCCCCAACTCCAGGG + Intronic
950662279 3:14473953-14473975 TCCACCAGGCCCCACTTCCTGGG - Intronic
951405632 3:22293818-22293840 ATCACTAGGCCTCACCTCCAGGG - Intronic
952971966 3:38656963-38656985 CCCAGGAGACCCCCCCTCCCCGG - Intergenic
953563224 3:44011214-44011236 GCCACCATGCCCCACCCCCCAGG + Intergenic
953742854 3:45552115-45552137 CCCACTCTGCTCCACCTCGCTGG + Intergenic
954206406 3:49062257-49062279 CTCACTAGCTTCCACCTCCCAGG - Intronic
954302296 3:49706413-49706435 CACACTGGGCCCCACCTTCCTGG - Intronic
954445593 3:50545146-50545168 GCCTCTTGGCCCCATCTCCCAGG + Intergenic
954615372 3:51966658-51966680 CCCACCCGGCCCCAGCACCCAGG - Intronic
955835340 3:63048275-63048297 CTCACTGGGCTCAACCTCCCTGG - Intergenic
956554620 3:70505006-70505028 ACCAGTAGGCCCCACCTCATGGG + Intergenic
956942491 3:74179782-74179804 GCCACTATGCTCCACTTCCCAGG - Intergenic
958779432 3:98523001-98523023 CCCACAAGGCCCCTCGGCCCCGG - Intronic
959539539 3:107523681-107523703 CTCCCCAGGCCCCACCTCCCCGG - Intronic
960784647 3:121358596-121358618 CCCACCAGGCCCCACCTCCTGGG + Intronic
961084803 3:124057649-124057671 CTCACTGGGCTCCACCACCCAGG - Intergenic
961299797 3:125915622-125915644 CCTAACCGGCCCCACCTCCCGGG + Intergenic
961864837 3:129946021-129946043 CCCTCAAGGGCCCACCTTCCCGG - Intergenic
962343723 3:134605216-134605238 CCCATGAGGACCCACCTGCCTGG + Intronic
963349206 3:144132036-144132058 CCCACTAGGCCCCACCTGGTGGG + Intergenic
964444225 3:156741940-156741962 CCCCCTAGACCCCACCTTCAAGG - Intergenic
967188659 3:186966741-186966763 ACCACTGGGCCTCACCTCCTGGG - Intronic
967189925 3:186976169-186976191 CCCACAAGGTCACACCTCACTGG - Intronic
968458712 4:713063-713085 CCCACTTGGCCACAGCCCCCAGG - Intronic
968472335 4:787859-787881 CCCACTGGTTCCCACCTTCCTGG - Intronic
968520208 4:1031667-1031689 CCCACTGGTCCCCATCTCTCAGG - Intergenic
968573481 4:1354334-1354356 CTCACCAGCCCCCACCCCCCCGG - Intronic
968599635 4:1502923-1502945 GCCACGGGGCCCCAGCTCCCTGG + Intergenic
968946435 4:3666947-3666969 CCCTCAAGTCCCCTCCTCCCTGG - Intergenic
969492799 4:7509627-7509649 CCCACAAGGCCCCTTCTTCCTGG - Intronic
969686017 4:8674707-8674729 CCCACAGGGCCCCACCCCACGGG - Intergenic
969866919 4:10082304-10082326 CCCAGGAGTCCCCATCTCCCAGG + Intronic
970359377 4:15293087-15293109 CCCACTATGCCTCACCTCCAGGG + Intergenic
970385741 4:15554740-15554762 CCCACAAAGCCTCACATCCCAGG - Intronic
972582152 4:40404514-40404536 CCAGCTCGGCCCCAACTCCCAGG - Intergenic
972610813 4:40653845-40653867 CCCACTATGCCCCACCTTCAAGG - Intergenic
973700109 4:53528785-53528807 CCAGCTAGTCCCCACCTTCCAGG - Intronic
973907691 4:55547140-55547162 CCGACCAGGCCCCGCCTCCCCGG - Intergenic
975745786 4:77472905-77472927 CCCACTGGGCCCCCCCACCTTGG + Intergenic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
977230449 4:94446316-94446338 TCCAGTATGCCCCACCTCCCAGG + Intergenic
977995244 4:103492962-103492984 CCCATCAGGCCTAACCTCCCTGG - Intergenic
978672467 4:111267098-111267120 TTCAGTGGGCCCCACCTCCCAGG + Intergenic
980134332 4:128845580-128845602 CCACCCAGGCCCTACCTCCCAGG - Intronic
980613008 4:135183196-135183218 CTCTGTAGGCTCCACCTCCCGGG - Intergenic
980614078 4:135195202-135195224 CCCACCAGGCCCCACCTCCTGGG - Intergenic
981158228 4:141465336-141465358 CACACTGGGCTCCTCCTCCCAGG - Intergenic
981658650 4:147140918-147140940 CACTGTAGGCTCCACCTCCCAGG - Intergenic
983998216 4:174211616-174211638 CTCAGTAGGCACCACCTCTCAGG + Intergenic
985228987 4:187794767-187794789 TCCACCAGCCTCCACCTCCCAGG + Intergenic
985577725 5:681518-681540 CCCACTGGCCGGCACCTCCCTGG + Intronic
985592646 5:773617-773639 CCCACTGGCCAGCACCTCCCTGG + Intergenic
985761007 5:1748700-1748722 CTCACAAGACACCACCTCCCTGG - Intergenic
986196964 5:5546217-5546239 CCCACCAGCCCTCTCCTCCCTGG + Intergenic
986267523 5:6203077-6203099 CCAACAAGGCCCCAGCTCTCAGG + Intergenic
987061990 5:14251711-14251733 CCCAATTGTTCCCACCTCCCAGG - Intronic
987228001 5:15863645-15863667 CCCACTAGGCCCCACCTCCCAGG - Intronic
987383276 5:17306273-17306295 ATCACTAGCCCCCGCCTCCCGGG - Intergenic
989052048 5:37331071-37331093 CACTCTAAGCTCCACCTCCCAGG - Intronic
993274795 5:85843678-85843700 CCCACTGCGCTCCACCTCTCAGG + Intergenic
994130960 5:96226790-96226812 CCCTCTTGGCCGCTCCTCCCTGG + Intergenic
996251795 5:121343877-121343899 CACTGTAGGCTCCACCTCCCGGG - Intergenic
996722267 5:126641500-126641522 CCCACCAGGTCCCACCTCCTAGG - Intergenic
997371766 5:133366033-133366055 TCCACAAGGCCCCACCTGCCTGG + Intronic
997400331 5:133597120-133597142 TCCAGTATGCTCCACCTCCCAGG + Intronic
998463870 5:142327623-142327645 TCCACCATCCCCCACCTCCCCGG - Intergenic
999715880 5:154359461-154359483 CCCACTTGGCCCCTTCTTCCCGG + Intronic
1000714249 5:164621496-164621518 CCCAGGAGGCCCCTCCTTCCAGG + Intergenic
1000770464 5:165346976-165346998 CACTCTAGCCCCCAACTCCCGGG - Intergenic
1000963849 5:167631686-167631708 CTCACTAGACCTCACCCCCCTGG + Intronic
1001049302 5:168401562-168401584 CCCACAAGTCCCCACCGCCTGGG + Intronic
1001159716 5:169301912-169301934 CCTACCTGGCCTCACCTCCCTGG + Intergenic
1001978589 5:176021471-176021493 CCTCCCAGGCACCACCTCCCTGG - Intronic
1001991716 5:176122080-176122102 CACTGTAGCCCCCACCTCCCAGG - Intronic
1002001058 5:176196489-176196511 CCCCCCCGCCCCCACCTCCCAGG + Intergenic
1002069684 5:176671940-176671962 CCCACCTGGCCCCACCTGCTAGG + Intergenic
1002133563 5:177095433-177095455 CCGCCTCGGCCCCACCTTCCTGG - Exonic
1002225158 5:177716057-177716079 CACTGTAGCCCCCACCTCCCAGG + Intronic
1002238828 5:177822291-177822313 CCTCCCAGGCACCACCTCCCTGG + Intergenic
1002253277 5:177942483-177942505 CCCCCCCGCCCCCACCTCCCAGG - Intergenic
1002644821 5:180647976-180647998 CCCTCTGGGCCCCTCCTCCAGGG + Intronic
1003174305 6:3744019-3744041 CGCTCTAGGAGCCACCTCCCAGG - Intronic
1006396429 6:33790329-33790351 TCCCCCAGGCCCCTCCTCCCTGG + Intergenic
1007169172 6:39850351-39850373 CCCTTTACCCCCCACCTCCCAGG + Intronic
1007368555 6:41411664-41411686 CCCACAAGGCCACCACTCCCTGG + Intergenic
1007695435 6:43729713-43729735 CCCACAGTGCCCCACCTCCGAGG + Intergenic
1010234889 6:73567086-73567108 ACCAGGAAGCCCCACCTCCCGGG - Intergenic
1010245373 6:73657344-73657366 CCCTGTAGGCTCCACCTCCTGGG + Intergenic
1011740471 6:90354767-90354789 TCCACTAGCCCCTGCCTCCCAGG + Intergenic
1012477949 6:99635594-99635616 CCTACTAGGACCCAGCACCCTGG - Intergenic
1017493489 6:154964463-154964485 TCCACTCAGACCCACCTCCCAGG - Intronic
1017902314 6:158728975-158728997 CACAGAAAGCCCCACCTCCCAGG - Intronic
1018997854 6:168724121-168724143 GCCTCTAGGCCCCAGCTACCAGG + Intergenic
1019321068 7:415478-415500 CCCACAGGGCCCCGCTTCCCTGG - Intergenic
1019492267 7:1321109-1321131 CCCACTCGGCCCCAGCTGTCGGG - Intergenic
1019535644 7:1528448-1528470 CCCTGTAGCCTCCACCTCCCAGG - Intergenic
1019660471 7:2221142-2221164 CTCACTATGCCCCACCCCACCGG + Intronic
1019710729 7:2517088-2517110 CCCACTGGGCCACACAGCCCTGG - Intronic
1021076272 7:16307997-16308019 CCCACCAGGTCTCACCTCCATGG - Intronic
1021816177 7:24449603-24449625 GCCACCTGGCTCCACCTCCCAGG + Intergenic
1022511409 7:30937067-30937089 CCCACCTGGCCCCACTCCCCAGG - Intergenic
1025713530 7:63932301-63932323 GACACTGCGCCCCACCTCCCAGG + Intergenic
1026815521 7:73508625-73508647 CTCACTAGCCTCCACCTCCTGGG + Intronic
1026824717 7:73574190-73574212 GCCACAGGGCCCCATCTCCCCGG - Intronic
1026976554 7:74502322-74502344 CCCACTAGGCTGCACTTCACTGG + Intronic
1030690137 7:112523968-112523990 CCCATTTGCCCCTACCTCCCAGG - Intergenic
1032785794 7:135198228-135198250 CCCACCACGCCCCCCCGCCCAGG - Intronic
1033326195 7:140380618-140380640 CTCACTAGGCTTCACCTCCTGGG + Intronic
1034329813 7:150272764-150272786 CCCTGTAGCCTCCACCTCCCAGG + Intronic
1034348861 7:150403836-150403858 CCCACCAGGCCCCACCCGTCTGG - Intronic
1034668243 7:152837098-152837120 CCCTGTAGCCTCCACCTCCCAGG - Intronic
1034966707 7:155395951-155395973 TCCACTCTGCCCCAGCTCCCTGG + Exonic
1035739317 8:1914278-1914300 GCCACTTGGCCACACATCCCTGG - Intronic
1035780620 8:2224482-2224504 CACACTGGGCCCCTCCTTCCTGG - Intergenic
1036788210 8:11701845-11701867 CCCACCACCCCCCACCACCCCGG - Intronic
1036850050 8:12194653-12194675 CGGACTCGGCCCCGCCTCCCGGG - Intergenic
1036871414 8:12436926-12436948 CGGACTCGGCCCCGCCTCCCGGG - Intergenic
1037273643 8:17156269-17156291 CCCAGCAGCCCCCGCCTCCCCGG + Exonic
1037759207 8:21730739-21730761 CCCTCAAGGTCCCACCTCCCAGG + Intronic
1040654656 8:49492489-49492511 CACTGTAGCCCCCACCTCCCAGG - Intergenic
1040829335 8:51660374-51660396 ACCAGGAGGCCCCACCTCACTGG - Intronic
1042484602 8:69336647-69336669 CCCACCGGGACCCACCTCCCAGG - Intergenic
1044717144 8:95110991-95111013 CCCACAAGGCTTCACCTCCAAGG - Intronic
1046849017 8:118952079-118952101 CCCCTCACGCCCCACCTCCCTGG - Exonic
1046894063 8:119454141-119454163 CACTCTAGGCTCCACCTCCCAGG + Intergenic
1047217197 8:122885864-122885886 CCCACTAGGCCACACAGCCAGGG - Intronic
1047460049 8:125054741-125054763 CCCTGCAGGCTCCACCTCCCGGG - Intronic
1047535816 8:125718722-125718744 CCCACTCACCCCCACCTCCAAGG - Intergenic
1048843181 8:138582627-138582649 CCCACTATGCCCCACCCACTCGG + Intergenic
1049195359 8:141312810-141312832 CCCTCTAGCCTCCACCTCCGTGG - Intergenic
1049304575 8:141894215-141894237 CCCAGTAGTCCTTACCTCCCGGG + Intergenic
1049352809 8:142173087-142173109 CACACAAGGCCTCACCTCACGGG + Intergenic
1049460532 8:142725637-142725659 CCCAAAAGGCCACCCCTCCCTGG + Intergenic
1049573098 8:143378660-143378682 GCCACTGGGCCCCACCGCCCTGG - Intronic
1049591332 8:143464356-143464378 CCAGCCAGGCCCTACCTCCCCGG + Intronic
1049614219 8:143569182-143569204 CCTCCCAGGCCCCGCCTCCCAGG - Intronic
1049656234 8:143799474-143799496 CCCACTGGGCCCCTCCTCTGCGG - Intronic
1049757267 8:144316255-144316277 CCCACCAGGCCCCAGGCCCCTGG + Exonic
1049760481 8:144329972-144329994 CCCCCTGGGCACCTCCTCCCTGG + Intergenic
1054905231 9:70408595-70408617 TCCCTAAGGCCCCACCTCCCAGG + Intronic
1056065274 9:82927139-82927161 CACTCTAAGCTCCACCTCCCGGG + Intergenic
1056186840 9:84143427-84143449 CCCACCAGGGCCCACTTCCCTGG + Intergenic
1057261212 9:93585873-93585895 CCCACCAGGCCCCACGTTCCTGG - Intronic
1058034597 9:100237295-100237317 CTCAGTGGGTCCCACCTCCCTGG - Intronic
1058707628 9:107650293-107650315 ACCACCAGGCCAGACCTCCCAGG - Intergenic
1059184386 9:112254064-112254086 CACTGTAGGCTCCACCTCCCAGG + Intronic
1060105199 9:120868985-120869007 CCCCCGAGGCCCCACCCCCGCGG + Intronic
1061255302 9:129451723-129451745 CCCCCCAGGCCCTCCCTCCCTGG - Intergenic
1061779901 9:132989321-132989343 TCCCCTAGTACCCACCTCCCTGG + Intronic
1062000036 9:134211343-134211365 CCAACTAGGCCGCAGCTCCACGG + Intergenic
1062026880 9:134344597-134344619 CCCTCTCCTCCCCACCTCCCGGG + Intronic
1062393469 9:136343190-136343212 GCAACCAGCCCCCACCTCCCTGG + Intronic
1062421383 9:136484154-136484176 CCGAGTAGGCCGCACCTCCCCGG - Exonic
1062505173 9:136870302-136870324 CACAGCAGGCCCAACCTCCCAGG + Intronic
1062579615 9:137223468-137223490 GCCACGAGGCCCCGCCCCCCAGG + Intergenic
1185432085 X:17335-17357 CCCATTCGGCCCCACCTGTCAGG + Intergenic
1185441401 X:230049-230071 CCCATTCGGCCCCACCTGTCAGG + Intergenic
1185979164 X:4757222-4757244 CCCAGGAAGCTCCACCTCCCGGG + Intergenic
1187249698 X:17585682-17585704 CAGAGGAGGCCCCACCTCCCAGG + Intronic
1187633178 X:21197466-21197488 CCCATAAAGCCCCACCTCCTGGG + Intergenic
1190127823 X:47722106-47722128 CACACTAGGCCCTGCCTGCCTGG - Intergenic
1190998699 X:55637155-55637177 CCCACTTGTCCCCAGCTCCTGGG - Intergenic
1191273489 X:58510898-58510920 CACTCTAGGCTCCACCTCTCGGG + Intergenic
1194493532 X:94580242-94580264 CTCACTGGGCTCCGCCTCCCAGG - Intergenic
1195197897 X:102516932-102516954 CTCCCCAGGCCCCACCTCCCAGG + Intergenic
1195347146 X:103962453-103962475 CTCCCCAGGCCCCACCTCCCAGG - Intronic
1195360296 X:104076388-104076410 CTCCCCAGGCCCCACCTCCCAGG + Intergenic