ID: 987229859

View in Genome Browser
Species Human (GRCh38)
Location 5:15882534-15882556
Sequence CTGTGTAAGAAGAATGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 858
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 388}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987229859 Original CRISPR CTGTGTAAGAAGAATGGGGA AGG (reversed) Intronic
900766457 1:4509280-4509302 CTCTGTGAGAAGGGTGGGGAAGG + Intergenic
900766457 1:4509280-4509302 CTCTGTGAGAAGGGTGGGGAAGG + Intergenic
901147222 1:7073442-7073464 CTGGGTGAGATGACTGGGGAGGG + Intronic
901147222 1:7073442-7073464 CTGGGTGAGATGACTGGGGAGGG + Intronic
903832822 1:26184688-26184710 CTGTGTGGGAAGGATGGGGGTGG - Intronic
903832822 1:26184688-26184710 CTGTGTGGGAAGGATGGGGGTGG - Intronic
904012554 1:27398189-27398211 CAGGGGAAGAAGGATGGGGAGGG + Intergenic
904012554 1:27398189-27398211 CAGGGGAAGAAGGATGGGGAGGG + Intergenic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
905228063 1:36492869-36492891 CTGTGGCAGGAGGATGGGGATGG + Intergenic
905228063 1:36492869-36492891 CTGTGGCAGGAGGATGGGGATGG + Intergenic
905256924 1:36690837-36690859 CTGTGAAACAAGAATGGCAAAGG + Intergenic
905256924 1:36690837-36690859 CTGTGAAACAAGAATGGCAAAGG + Intergenic
905682487 1:39884014-39884036 CTGTGAAAGAATAATAGGGACGG - Intergenic
905682487 1:39884014-39884036 CTGTGAAAGAATAATAGGGACGG - Intergenic
906065684 1:42978663-42978685 CTGTGTAAGATGAGGTGGGAAGG - Intergenic
906065684 1:42978663-42978685 CTGTGTAAGATGAGGTGGGAAGG - Intergenic
906139411 1:43524855-43524877 AGGTGTAAAGAGAATGGGGAGGG + Intergenic
906139411 1:43524855-43524877 AGGTGTAAAGAGAATGGGGAGGG + Intergenic
906660187 1:47576400-47576422 CTGTGGAAGCAGCATGGGGCTGG + Intergenic
906660187 1:47576400-47576422 CTGTGGAAGCAGCATGGGGCTGG + Intergenic
906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG + Intronic
906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG + Intronic
906925460 1:50110960-50110982 CAGTGTAAAAAAAAAGGGGAGGG + Intronic
906925460 1:50110960-50110982 CAGTGTAAAAAAAAAGGGGAGGG + Intronic
907457284 1:54583823-54583845 ATGTGTGAGAAAAATGAGGAGGG - Intronic
907457284 1:54583823-54583845 ATGTGTGAGAAAAATGAGGAGGG - Intronic
907951748 1:59189897-59189919 CAGGGAAAGAAGAATGGAGAGGG - Intergenic
907951748 1:59189897-59189919 CAGGGAAAGAAGAATGGAGAGGG - Intergenic
908834182 1:68211984-68212006 CTTTGTAATCAGAATGGGGGAGG - Intronic
908834182 1:68211984-68212006 CTTTGTAATCAGAATGGGGGAGG - Intronic
910682928 1:89885835-89885857 CTGTGGAGGCAGAATGGGCAAGG + Intronic
910682928 1:89885835-89885857 CTGTGGAGGCAGAATGGGCAAGG + Intronic
910707510 1:90145822-90145844 CTGTGGGAGAAGCATGGGAATGG + Intergenic
910707510 1:90145822-90145844 CTGTGGGAGAAGCATGGGAATGG + Intergenic
910828692 1:91437267-91437289 TGGTATAAGAAGAATGGGTAGGG - Intergenic
910828692 1:91437267-91437289 TGGTATAAGAAGAATGGGTAGGG - Intergenic
912013911 1:105007025-105007047 CTGTGTAAGAAGCATGAAAAAGG - Intergenic
912013911 1:105007025-105007047 CTGTGTAAGAAGCATGAAAAAGG - Intergenic
912459787 1:109822944-109822966 CTGTGAGAGGAGAATGGGAAAGG + Intergenic
912459787 1:109822944-109822966 CTGTGAGAGGAGAATGGGAAAGG + Intergenic
912482653 1:109995761-109995783 CTGTGTAATCAGAATGGGGGAGG + Intronic
912482653 1:109995761-109995783 CTGTGTAATCAGAATGGGGGAGG + Intronic
912656833 1:111493495-111493517 CTGTATAAGAAGCATGGTGCTGG - Intronic
912656833 1:111493495-111493517 CTGTATAAGAAGCATGGTGCTGG - Intronic
914790394 1:150872451-150872473 CTGTGGATGAAGAATGTAGAAGG - Intronic
914790394 1:150872451-150872473 CTGTGGATGAAGAATGTAGAAGG - Intronic
914918906 1:151834446-151834468 CTTTGTGACAAGAAGGGGGAGGG - Intergenic
914918906 1:151834446-151834468 CTTTGTGACAAGAAGGGGGAGGG - Intergenic
915508354 1:156371640-156371662 CTGTGGATGAAATATGGGGAGGG - Intronic
915508354 1:156371640-156371662 CTGTGGATGAAATATGGGGAGGG - Intronic
916530643 1:165653260-165653282 ATGTGTGATAGGAATGGGGATGG - Intronic
916530643 1:165653260-165653282 ATGTGTGATAGGAATGGGGATGG - Intronic
917250428 1:173053639-173053661 CTGTTTAAGAAGAGAGAGGAGGG + Intergenic
917250428 1:173053639-173053661 CTGTTTAAGAAGAGAGAGGAGGG + Intergenic
917719979 1:177778085-177778107 CTGTGGAAGAGGAATGTGTATGG - Intergenic
917719979 1:177778085-177778107 CTGTGGAAGAGGAATGTGTATGG - Intergenic
917959353 1:180129936-180129958 CTGTGTAAGAATCAGGGAGAGGG + Intergenic
917959353 1:180129936-180129958 CTGTGTAAGAATCAGGGAGAGGG + Intergenic
919897115 1:202015857-202015879 CTGTGGGAGAGGAGTGGGGAGGG - Exonic
919897115 1:202015857-202015879 CTGTGGGAGAGGAGTGGGGAGGG - Exonic
920647974 1:207817126-207817148 GTGTGGGAGAAGAATGGAGAAGG + Intergenic
920647974 1:207817126-207817148 GTGTGGGAGAAGAATGGAGAAGG + Intergenic
920679006 1:208058714-208058736 CTGTGAAAGGAGCCTGGGGAGGG - Intronic
920679006 1:208058714-208058736 CTGTGAAAGGAGCCTGGGGAGGG - Intronic
921261647 1:213389671-213389693 CTGGGTAAAAAGAAAGGGAAGGG - Intergenic
921261647 1:213389671-213389693 CTGGGTAAAAAGAAAGGGAAGGG - Intergenic
922430765 1:225550194-225550216 CTATGTTTGAAGAATGGGGAGGG - Intronic
922430765 1:225550194-225550216 CTATGTTTGAAGAATGGGGAGGG - Intronic
922680447 1:227590872-227590894 CTGTATAGCAAGAGTGGGGAAGG - Intronic
922680447 1:227590872-227590894 CTGTATAGCAAGAGTGGGGAAGG - Intronic
922690413 1:227684740-227684762 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
922690413 1:227684740-227684762 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
922969829 1:229727128-229727150 CAATGTAACAAGGATGGGGATGG - Intergenic
922969829 1:229727128-229727150 CAATGTAACAAGGATGGGGATGG - Intergenic
923133517 1:231097665-231097687 CTGAGTAAGGAGATTGGGGGAGG + Intergenic
923133517 1:231097665-231097687 CTGAGTAAGGAGATTGGGGGAGG + Intergenic
924222839 1:241895880-241895902 CTGAATAATAAGAATGTGGAAGG - Intergenic
924222839 1:241895880-241895902 CTGAATAATAAGAATGTGGAAGG - Intergenic
924223070 1:241898131-241898153 CTGAATAATAAGAATGTGGAAGG - Intergenic
924223070 1:241898131-241898153 CTGAATAATAAGAATGTGGAAGG - Intergenic
1062908435 10:1195618-1195640 CTGGTTCAGAAGAATTGGGATGG + Intronic
1062908435 10:1195618-1195640 CTGGTTCAGAAGAATTGGGATGG + Intronic
1063371412 10:5525140-5525162 CTGTTTGACAAGGATGGGGACGG + Exonic
1063371412 10:5525140-5525162 CTGTTTGACAAGGATGGGGACGG + Exonic
1064642133 10:17425932-17425954 CTGTGGAAAAAGAGTGGGGATGG - Intronic
1064642133 10:17425932-17425954 CTGTGGAAAAAGAGTGGGGATGG - Intronic
1066650438 10:37650281-37650303 CTGTGCAAGAAGCATGGAGCTGG + Intergenic
1066650438 10:37650281-37650303 CTGTGCAAGAAGCATGGAGCTGG + Intergenic
1066693773 10:38060273-38060295 CTGTGGAAGCAGAGTGGGGATGG - Intronic
1066693773 10:38060273-38060295 CTGTGGAAGCAGAGTGGGGATGG - Intronic
1066999044 10:42588869-42588891 CTGTGGAAGCAGAGTGGGGATGG + Intronic
1066999044 10:42588869-42588891 CTGTGGAAGCAGAGTGGGGATGG + Intronic
1067033445 10:42896417-42896439 CTGTGCAAGAAGCATGGAGCTGG + Intergenic
1067033445 10:42896417-42896439 CTGTGCAAGAAGCATGGAGCTGG + Intergenic
1067138281 10:43631363-43631385 CTGTGTGAGAACAAATGGGAAGG + Intergenic
1067138281 10:43631363-43631385 CTGTGTGAGAACAAATGGGAAGG + Intergenic
1067845032 10:49712810-49712832 CTGTGTACAATGAATGGGGGAGG - Intergenic
1067845032 10:49712810-49712832 CTGTGTACAATGAATGGGGGAGG - Intergenic
1067984865 10:51131623-51131645 CAGTGGAAGATGAATGTGGAAGG + Intronic
1067984865 10:51131623-51131645 CAGTGGAAGATGAATGTGGAAGG + Intronic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1070703199 10:78618324-78618346 CTCTGTAAGTAGACTGGGCAGGG - Intergenic
1070703199 10:78618324-78618346 CTCTGTAAGTAGACTGGGCAGGG - Intergenic
1071264230 10:83949907-83949929 CTGTGCAAGAAGCATGGTGCCGG - Intergenic
1071264230 10:83949907-83949929 CTGTGCAAGAAGCATGGTGCCGG - Intergenic
1072807868 10:98435948-98435970 GTGGTTAGGAAGAATGGGGAGGG + Intronic
1072807868 10:98435948-98435970 GTGGTTAGGAAGAATGGGGAGGG + Intronic
1073200210 10:101729195-101729217 CTGTGAAAGACAAATGAGGAAGG + Intergenic
1073200210 10:101729195-101729217 CTGTGAAAGACAAATGAGGAAGG + Intergenic
1074144495 10:110704618-110704640 CTGTGTAAGAGGAAAGGGAGAGG + Intronic
1074144495 10:110704618-110704640 CTGTGTAAGAGGAAAGGGAGAGG + Intronic
1074904260 10:117847186-117847208 CTTGGGAAGAAGAATGTGGATGG + Intergenic
1074904260 10:117847186-117847208 CTTGGGAAGAAGAATGTGGATGG + Intergenic
1076026406 10:127118281-127118303 CTGTGTGAGAAGAATTGGTCAGG - Intronic
1076026406 10:127118281-127118303 CTGTGTGAGAAGAATTGGTCAGG - Intronic
1076523282 10:131094346-131094368 CTCTGTAAGGAGAAGTGGGAGGG - Intronic
1076523282 10:131094346-131094368 CTCTGTAAGGAGAAGTGGGAGGG - Intronic
1076819216 10:132930474-132930496 CTGTGTGGGGAGTATGGGGAAGG - Intronic
1076819216 10:132930474-132930496 CTGTGTGGGGAGTATGGGGAAGG - Intronic
1076819323 10:132930829-132930851 CTGTGTGAGGAGTGTGGGGAAGG - Intronic
1076819323 10:132930829-132930851 CTGTGTGAGGAGTGTGGGGAAGG - Intronic
1076819341 10:132930891-132930913 CTGTGTGAGGAGTGTGGGGAAGG - Intronic
1076819341 10:132930891-132930913 CTGTGTGAGGAGTGTGGGGAAGG - Intronic
1078007406 11:7542493-7542515 CTGAGGAAGAACAATGGGGTGGG - Intronic
1078007406 11:7542493-7542515 CTGAGGAAGAACAATGGGGTGGG - Intronic
1078558748 11:12352783-12352805 CTGTAAAAGGAGAGTGGGGAGGG + Intronic
1078558748 11:12352783-12352805 CTGTAAAAGGAGAGTGGGGAGGG + Intronic
1079144363 11:17837604-17837626 CTGTATAAGAAGCATGGCGCCGG - Intronic
1079144363 11:17837604-17837626 CTGTATAAGAAGCATGGCGCCGG - Intronic
1079998199 11:27318965-27318987 CAGTGTAAGAATAATGGAGAAGG - Intergenic
1079998199 11:27318965-27318987 CAGTGTAAGAATAATGGAGAAGG - Intergenic
1080313531 11:30922940-30922962 TTGTTTAAGAAGAAGAGGGAAGG + Intronic
1080313531 11:30922940-30922962 TTGTTTAAGAAGAAGAGGGAAGG + Intronic
1082674154 11:56075112-56075134 CTGTGGCAGGAGGATGGGGAGGG - Intergenic
1082674154 11:56075112-56075134 CTGTGGCAGGAGGATGGGGAGGG - Intergenic
1083090201 11:60191695-60191717 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
1083090201 11:60191695-60191717 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
1083150090 11:60786496-60786518 CCCTGTAAGCAGGATGGGGATGG + Intronic
1083150090 11:60786496-60786518 CCCTGTAAGCAGGATGGGGATGG + Intronic
1083287202 11:61667743-61667765 CTGGGTGAGAGGGATGGGGAGGG + Intergenic
1083287202 11:61667743-61667765 CTGGGTGAGAGGGATGGGGAGGG + Intergenic
1084560005 11:69899303-69899325 CTCTGTAACCAGAATGGGGAGGG - Intergenic
1084560005 11:69899303-69899325 CTCTGTAACCAGAATGGGGAGGG - Intergenic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1085602600 11:77868757-77868779 CTGTGTAAGAACCAGTGGGAAGG - Intronic
1085602600 11:77868757-77868779 CTGTGTAAGAACCAGTGGGAAGG - Intronic
1085791794 11:79502991-79503013 GTCTGTAAGAAGACTGGGGGTGG - Intergenic
1085791794 11:79502991-79503013 GTCTGTAAGAAGACTGGGGGTGG - Intergenic
1086222861 11:84470970-84470992 GTGTATAAGAAAAATAGGGAGGG - Intronic
1086222861 11:84470970-84470992 GTGTATAAGAAAAATAGGGAGGG - Intronic
1087033222 11:93727445-93727467 ATGTGTAAGAACAGTGGAGATGG + Exonic
1087033222 11:93727445-93727467 ATGTGTAAGAACAGTGGAGATGG + Exonic
1087684836 11:101250807-101250829 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
1087684836 11:101250807-101250829 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
1087763879 11:102128992-102129014 CAGTGTCAGGAGACTGGGGAGGG - Intronic
1087763879 11:102128992-102129014 CAGTGTCAGGAGACTGGGGAGGG - Intronic
1089409756 11:118230792-118230814 GTGTATAAGAACAATAGGGAAGG - Intronic
1089409756 11:118230792-118230814 GTGTATAAGAACAATAGGGAAGG - Intronic
1089460224 11:118648697-118648719 CTGTTTAAGGAGAAAGGGTAGGG - Intronic
1089460224 11:118648697-118648719 CTGTTTAAGGAGAAAGGGTAGGG - Intronic
1091197877 11:133747359-133747381 CTGGGTGAGAAGGATGGGGGTGG - Intergenic
1091197877 11:133747359-133747381 CTGGGTGAGAAGGATGGGGGTGG - Intergenic
1091336852 11:134776747-134776769 CTGTGTGAGAAGCATGGTGCTGG - Intergenic
1091336852 11:134776747-134776769 CTGTGTGAGAAGCATGGTGCTGG - Intergenic
1091871725 12:3897023-3897045 CTGAGCAGGAAGAATAGGGAAGG + Intergenic
1091871725 12:3897023-3897045 CTGAGCAGGAAGAATAGGGAAGG + Intergenic
1092724959 12:11475867-11475889 CTGTATAAGAAGCATGGTGCAGG - Intronic
1092724959 12:11475867-11475889 CTGTATAAGAAGCATGGTGCAGG - Intronic
1093662230 12:21770517-21770539 CTGTGAAAGAAGCAGAGGGAAGG + Intronic
1093662230 12:21770517-21770539 CTGTGAAAGAAGCAGAGGGAAGG + Intronic
1095413863 12:41953945-41953967 ATGTCTAAGAAGATTGTGGATGG + Intergenic
1095413863 12:41953945-41953967 ATGTCTAAGAAGATTGTGGATGG + Intergenic
1097144147 12:56928406-56928428 TTGTGAAAGAAGAATGGAGCAGG - Intronic
1097144147 12:56928406-56928428 TTGTGAAAGAAGAATGGAGCAGG - Intronic
1097719737 12:63007220-63007242 CTTTGTAACAAGAATCTGGAGGG + Intergenic
1097719737 12:63007220-63007242 CTTTGTAACAAGAATCTGGAGGG + Intergenic
1098235877 12:68417764-68417786 AAGTGTAAGAAAAATGGGAACGG + Intergenic
1098235877 12:68417764-68417786 AAGTGTAAGAAAAATGGGAACGG + Intergenic
1098248711 12:68546469-68546491 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
1098248711 12:68546469-68546491 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
1098498063 12:71159994-71160016 CTGCCTAGGAAGAAAGGGGAGGG - Intronic
1098498063 12:71159994-71160016 CTGCCTAGGAAGAAAGGGGAGGG - Intronic
1099119004 12:78664663-78664685 CTGTGTAAAAGGGATGGGGTAGG - Intergenic
1099119004 12:78664663-78664685 CTGTGTAAAAGGGATGGGGTAGG - Intergenic
1099612479 12:84891831-84891853 CTATGTCAGAAGAATGGGGGCGG - Exonic
1099612479 12:84891831-84891853 CTATGTCAGAAGAATGGGGGCGG - Exonic
1100807795 12:98305349-98305371 CTGTGCAGGAAGAATGGTGCTGG - Intergenic
1100807795 12:98305349-98305371 CTGTGCAGGAAGAATGGTGCTGG - Intergenic
1101623487 12:106415173-106415195 CTGTGGAAGATGAATGGAGTTGG - Intronic
1101623487 12:106415173-106415195 CTGTGGAAGATGAATGGAGTTGG - Intronic
1102082035 12:110106341-110106363 CTGTGTAGGAAGGGTCGGGAAGG - Intergenic
1102082035 12:110106341-110106363 CTGTGTAGGAAGGGTCGGGAAGG - Intergenic
1102853400 12:116272642-116272664 CTTTGTGAGAAGAATGGGCAAGG - Intronic
1102853400 12:116272642-116272664 CTTTGTGAGAAGAATGGGCAAGG - Intronic
1104923353 12:132302794-132302816 CTGTGGCAGCAGAAAGGGGACGG + Intronic
1104923353 12:132302794-132302816 CTGTGGCAGCAGAAAGGGGACGG + Intronic
1107867595 13:44717909-44717931 CTATATTGGAAGAATGGGGAAGG - Intergenic
1107867595 13:44717909-44717931 CTATATTGGAAGAATGGGGAAGG - Intergenic
1108357882 13:49643569-49643591 CTGCCTAAGTAAAATGGGGAAGG - Intergenic
1108357882 13:49643569-49643591 CTGCCTAAGTAAAATGGGGAAGG - Intergenic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1110226976 13:73129873-73129895 CTGTTAAAGAAGAATGTGGCTGG + Intergenic
1110226976 13:73129873-73129895 CTGTTAAAGAAGAATGTGGCTGG + Intergenic
1110276458 13:73646824-73646846 CTGTATAAGAAGCATGGTGCCGG - Intergenic
1110276458 13:73646824-73646846 CTGTATAAGAAGCATGGTGCCGG - Intergenic
1110700387 13:78540626-78540648 CTCTGCAAGAAGAAGGAGGATGG - Intergenic
1110700387 13:78540626-78540648 CTCTGCAAGAAGAAGGAGGATGG - Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1112641372 13:101279407-101279429 CATTGGAAGAAGAATGAGGAAGG + Intronic
1112641372 13:101279407-101279429 CATTGGAAGAAGAATGAGGAAGG + Intronic
1112864829 13:103881756-103881778 TTGTGTAAGAAGTATTGAGATGG + Intergenic
1112864829 13:103881756-103881778 TTGTGTAAGAAGTATTGAGATGG + Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113266065 13:108619643-108619665 CTGGCCAAGAAGAAAGGGGAAGG + Intronic
1113266065 13:108619643-108619665 CTGGCCAAGAAGAAAGGGGAAGG + Intronic
1113424417 13:110196136-110196158 CTGTGTAGGAACTATGGGGGAGG + Intronic
1113424417 13:110196136-110196158 CTGTGTAGGAACTATGGGGGAGG + Intronic
1114586935 14:23824216-23824238 CAGTGTAAGAGGAAGTGGGAGGG - Intergenic
1114586935 14:23824216-23824238 CAGTGTAAGAGGAAGTGGGAGGG - Intergenic
1114656695 14:24319991-24320013 CTGTTTAAGAAGAATTGGGAAGG + Intronic
1114656695 14:24319991-24320013 CTGTTTAAGAAGAATTGGGAAGG + Intronic
1115099004 14:29675407-29675429 GGTTGTCAGAAGAATGGGGATGG - Intronic
1115099004 14:29675407-29675429 GGTTGTCAGAAGAATGGGGATGG - Intronic
1116240744 14:42339227-42339249 CTGTATAGCAAGAATGGGGAAGG - Intergenic
1116240744 14:42339227-42339249 CTGTATAGCAAGAATGGGGAAGG - Intergenic
1116290039 14:43022578-43022600 GAATGAAAGAAGAATGGGGAAGG - Intergenic
1116290039 14:43022578-43022600 GAATGAAAGAAGAATGGGGAAGG - Intergenic
1116313032 14:43350512-43350534 CTGTGAAAGAAGCATGGTGCTGG + Intergenic
1116313032 14:43350512-43350534 CTGTGAAAGAAGCATGGTGCTGG + Intergenic
1116531359 14:45977464-45977486 CTGGGGAAGAAGCCTGGGGAAGG + Intergenic
1116531359 14:45977464-45977486 CTGGGGAAGAAGCCTGGGGAAGG + Intergenic
1117846593 14:59918723-59918745 CTGTGAAATAAGAATGTAGAGGG + Intergenic
1117846593 14:59918723-59918745 CTGTGAAATAAGAATGTAGAGGG + Intergenic
1118345546 14:64938195-64938217 CTCTGTAAGAAGGAAGGGGTTGG - Intronic
1118345546 14:64938195-64938217 CTCTGTAAGAAGGAAGGGGTTGG - Intronic
1119345515 14:73920474-73920496 CTGGGTAGGTAGAATGGAGACGG + Intronic
1119345515 14:73920474-73920496 CTGGGTAGGTAGAATGGAGACGG + Intronic
1120249084 14:82040255-82040277 CAGTGTAGGAGCAATGGGGAGGG - Intergenic
1120249084 14:82040255-82040277 CAGTGTAGGAGCAATGGGGAGGG - Intergenic
1123029763 14:105446171-105446193 CTGTGTCAGTAGCATGTGGAGGG - Intronic
1123029763 14:105446171-105446193 CTGTGTCAGTAGCATGTGGAGGG - Intronic
1202832681 14_GL000009v2_random:53868-53890 CTGGGAAATAAGAACGGGGAGGG + Intergenic
1202832681 14_GL000009v2_random:53868-53890 CTGGGAAATAAGAACGGGGAGGG + Intergenic
1124201352 15:27681193-27681215 CTGTGTACGAGGTGTGGGGAGGG - Intergenic
1124201352 15:27681193-27681215 CTGTGTACGAGGTGTGGGGAGGG - Intergenic
1124337085 15:28865619-28865641 CTGTATAAGAAGCATGGGGCTGG - Intergenic
1124337085 15:28865619-28865641 CTGTATAAGAAGCATGGGGCTGG - Intergenic
1126688624 15:51269811-51269833 CTGTGAAAGAAGAGAGGGAAGGG - Intronic
1126688624 15:51269811-51269833 CTGTGAAAGAAGAGAGGGAAGGG - Intronic
1127671443 15:61198897-61198919 CTGGGTAAGGAGAATGGACAGGG - Intronic
1127671443 15:61198897-61198919 CTGGGTAAGGAGAATGGACAGGG - Intronic
1128159961 15:65417150-65417172 CTGGGAAAGGAGAATGGTGATGG - Intronic
1128159961 15:65417150-65417172 CTGGGAAAGGAGAATGGTGATGG - Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128443426 15:67735916-67735938 CTTTGCAAGAAGCATGGGAAAGG + Intronic
1128443426 15:67735916-67735938 CTTTGCAAGAAGCATGGGAAAGG + Intronic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129858713 15:78843679-78843701 CTGTGTATGTAGCATGGGGCTGG - Intronic
1129858713 15:78843679-78843701 CTGTGTATGTAGCATGGGGCTGG - Intronic
1131501551 15:92972471-92972493 CAGTGTAGGAAGGTTGGGGAGGG - Intronic
1131501551 15:92972471-92972493 CAGTGTAGGAAGGTTGGGGAGGG - Intronic
1131670524 15:94614974-94614996 CTGGACAAGAAGAAAGGGGAGGG - Intergenic
1131670524 15:94614974-94614996 CTGGACAAGAAGAAAGGGGAGGG - Intergenic
1134318370 16:13140179-13140201 CTGTCTAAAAAGAAAGGGAAGGG - Intronic
1134318370 16:13140179-13140201 CTGTCTAAAAAGAAAGGGAAGGG - Intronic
1134455556 16:14392858-14392880 TACTGTAAGAAGAATGGGGCCGG + Intergenic
1134455556 16:14392858-14392880 TACTGTAAGAAGAATGGGGCCGG + Intergenic
1135193255 16:20372591-20372613 CTGGGCAGGAAGAATGGAGAAGG + Intronic
1135193255 16:20372591-20372613 CTGGGCAGGAAGAATGGAGAAGG + Intronic
1135347923 16:21705146-21705168 CTGTGTGAGAAGAGGAGGGATGG - Intronic
1135347923 16:21705146-21705168 CTGTGTGAGAAGAGGAGGGATGG - Intronic
1137627419 16:49918318-49918340 CGGAGTAAGAAGAGTGAGGACGG + Intergenic
1137627419 16:49918318-49918340 CGGAGTAAGAAGAGTGAGGACGG + Intergenic
1138979972 16:62256215-62256237 CTGTATGAGAAGAAACGGGAAGG + Intergenic
1138979972 16:62256215-62256237 CTGTATGAGAAGAAACGGGAAGG + Intergenic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1142342680 16:89534156-89534178 CTGGGGATGGAGAATGGGGAGGG - Intronic
1142342680 16:89534156-89534178 CTGGGGATGGAGAATGGGGAGGG - Intronic
1142990266 17:3725391-3725413 CGCTGTGAGAAGATTGGGGAAGG + Exonic
1142990266 17:3725391-3725413 CGCTGTGAGAAGATTGGGGAAGG + Exonic
1143214163 17:5211707-5211729 CTCTCTAAGAAGAAAGGGGATGG + Intronic
1143214163 17:5211707-5211729 CTCTCTAAGAAGAAAGGGGATGG + Intronic
1144405326 17:14947441-14947463 CTGTGTAACAACACTGGAGATGG - Intergenic
1144405326 17:14947441-14947463 CTGTGTAACAACACTGGAGATGG - Intergenic
1144424208 17:15126025-15126047 CTGTGCAAGAAGCATGGGGCCGG - Intergenic
1144424208 17:15126025-15126047 CTGTGCAAGAAGCATGGGGCCGG - Intergenic
1146090676 17:29874284-29874306 CTGTCTCAAAAAAATGGGGAGGG + Intronic
1146090676 17:29874284-29874306 CTGTCTCAAAAAAATGGGGAGGG + Intronic
1146573092 17:33969519-33969541 CTGGGGAACAAGAAAGGGGAAGG + Intronic
1146573092 17:33969519-33969541 CTGGGGAACAAGAAAGGGGAAGG + Intronic
1146667510 17:34714968-34714990 CAGAGAAAGAAGAATGGGTAGGG + Intergenic
1146667510 17:34714968-34714990 CAGAGAAAGAAGAATGGGTAGGG + Intergenic
1146709974 17:35032554-35032576 CTGTGTGTGGAGAATAGGGACGG + Intronic
1146709974 17:35032554-35032576 CTGTGTGTGGAGAATAGGGACGG + Intronic
1146764477 17:35506865-35506887 CTGTATAGCAAGAGTGGGGAAGG + Intronic
1146764477 17:35506865-35506887 CTGTATAGCAAGAGTGGGGAAGG + Intronic
1147032610 17:37652235-37652257 CTGTATAAAAATAATGGGGTAGG - Intergenic
1147032610 17:37652235-37652257 CTGTATAAAAATAATGGGGTAGG - Intergenic
1147302294 17:39539594-39539616 CTGAGGAAGAAGACTGGGGGAGG + Intronic
1147302294 17:39539594-39539616 CTGAGGAAGAAGACTGGGGGAGG + Intronic
1149612467 17:57967635-57967657 CTGAGGGAGAAGAATGGGGAGGG - Intergenic
1149612467 17:57967635-57967657 CTGAGGGAGAAGAATGGGGAGGG - Intergenic
1150663625 17:67109171-67109193 ATGTGAAGGAAGAATGGGGCCGG + Exonic
1150663625 17:67109171-67109193 ATGTGAAGGAAGAATGGGGCCGG + Exonic
1151138031 17:71966398-71966420 GTGTTTAAGAAAAATGGGGCTGG - Intergenic
1151138031 17:71966398-71966420 GTGTTTAAGAAAAATGGGGCTGG - Intergenic
1151629767 17:75302475-75302497 CTATGGAAGAAGAGGGGGGAAGG + Intergenic
1151629767 17:75302475-75302497 CTATGGAAGAAGAGGGGGGAAGG + Intergenic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1153507339 18:5814640-5814662 CTGTGTAAGAAGATTTGAGCAGG + Intergenic
1153507339 18:5814640-5814662 CTGTGTAAGAAGATTTGAGCAGG + Intergenic
1154162295 18:11989619-11989641 CTGTCTCAGAAGAAGGGGGAGGG + Intronic
1154162295 18:11989619-11989641 CTGTCTCAGAAGAAGGGGGAGGG + Intronic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1156504506 18:37580805-37580827 CAGTGTAAGGAGAATGAGAAAGG - Intergenic
1156504506 18:37580805-37580827 CAGTGTAAGGAGAATGAGAAAGG - Intergenic
1156844770 18:41652657-41652679 CAGTGAAAGAAGAATGGGGCAGG + Intergenic
1156844770 18:41652657-41652679 CAGTGAAAGAAGAATGGGGCAGG + Intergenic
1157330406 18:46699969-46699991 CAGTGGCAGAAAAATGGGGAAGG + Intronic
1157330406 18:46699969-46699991 CAGTGGCAGAAAAATGGGGAAGG + Intronic
1157444005 18:47731324-47731346 CCGTGAGAGCAGAATGGGGAAGG + Intergenic
1157444005 18:47731324-47731346 CCGTGAGAGCAGAATGGGGAAGG + Intergenic
1157463938 18:47928529-47928551 TTGTGTAGGAATATTGGGGATGG - Intronic
1157463938 18:47928529-47928551 TTGTGTAGGAATATTGGGGATGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158509448 18:58077603-58077625 CTGAGTTAGAAGGATGGGGCAGG + Intronic
1158509448 18:58077603-58077625 CTGAGTTAGAAGGATGGGGCAGG + Intronic
1158549393 18:58422319-58422341 TTCTGGAAGAAGAATGAGGAAGG - Intergenic
1158549393 18:58422319-58422341 TTCTGGAAGAAGAATGAGGAAGG - Intergenic
1159266798 18:66090748-66090770 ATATGTAAGAAAAATGAGGAAGG + Intergenic
1159266798 18:66090748-66090770 ATATGTAAGAAAAATGAGGAAGG + Intergenic
1159325321 18:66907989-66908011 CTGTGTAAGATGAGTACGGAGGG - Intergenic
1159325321 18:66907989-66908011 CTGTGTAAGATGAGTACGGAGGG - Intergenic
1159967738 18:74612278-74612300 CTGTATAAGAAGGAAGGTGATGG + Intronic
1159967738 18:74612278-74612300 CTGTATAAGAAGGAAGGTGATGG + Intronic
1160692010 19:464494-464516 ATGTGTATGGAGGATGGGGAAGG - Intronic
1160692010 19:464494-464516 ATGTGTATGGAGGATGGGGAAGG - Intronic
1164607297 19:29609370-29609392 CTGTGGGAGAGCAATGGGGATGG - Intronic
1164607297 19:29609370-29609392 CTGTGGGAGAGCAATGGGGATGG - Intronic
1164949880 19:32328269-32328291 CTCTGTGAGAAAAATGGAGAAGG - Intergenic
1164949880 19:32328269-32328291 CTCTGTGAGAAAAATGGAGAAGG - Intergenic
1165216095 19:34273887-34273909 CGGTGTAAGAAAATTGGGAAGGG + Intronic
1165216095 19:34273887-34273909 CGGTGTAAGAAAATTGGGAAGGG + Intronic
1166826723 19:45614451-45614473 TTGTGTAAGAGGAAAGGGTAGGG - Intronic
1166826723 19:45614451-45614473 TTGTGTAAGAGGAAAGGGTAGGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168149611 19:54438048-54438070 CTGGGTAGGGAAAATGGGGAGGG + Intergenic
1168149611 19:54438048-54438070 CTGGGTAGGGAAAATGGGGAGGG + Intergenic
1202640000 1_KI270706v1_random:73863-73885 CTGGGAAATAAGAACGGGGAGGG - Intergenic
1202640000 1_KI270706v1_random:73863-73885 CTGGGAAATAAGAACGGGGAGGG - Intergenic
928034015 2:27805071-27805093 GTGTTTGAGAAGAATGTGGATGG - Intronic
928034015 2:27805071-27805093 GTGTTTGAGAAGAATGTGGATGG - Intronic
928068215 2:28188210-28188232 ATGTGTAGGTAGAATGGAGAAGG - Intronic
928068215 2:28188210-28188232 ATGTGTAGGTAGAATGGAGAAGG - Intronic
928633314 2:33216329-33216351 CTGGGAAAGAAAAAAGGGGAGGG + Intronic
928633314 2:33216329-33216351 CTGGGAAAGAAAAAAGGGGAGGG + Intronic
928899189 2:36299432-36299454 CTGTGTAAGAACCAATGGGAAGG - Intergenic
928899189 2:36299432-36299454 CTGTGTAAGAACCAATGGGAAGG - Intergenic
929269055 2:39952739-39952761 ATCTGTAAAAAGAATGAGGAAGG + Intergenic
929269055 2:39952739-39952761 ATCTGTAAAAAGAATGAGGAAGG + Intergenic
930731908 2:54735973-54735995 AGGTGGAAAAAGAATGGGGAAGG + Intronic
930731908 2:54735973-54735995 AGGTGGAAAAAGAATGGGGAAGG + Intronic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
930975529 2:57454950-57454972 CTGTGTATAAAGAATGGGGGTGG - Intergenic
930975529 2:57454950-57454972 CTGTGTATAAAGAATGGGGGTGG - Intergenic
932592729 2:73076764-73076786 TTGGGTGAGAAGAAAGGGGAAGG - Intronic
932592729 2:73076764-73076786 TTGGGTGAGAAGAAAGGGGAAGG - Intronic
932649209 2:73537397-73537419 CTGTACAAGAAGAAAAGGGAAGG + Intronic
932649209 2:73537397-73537419 CTGTACAAGAAGAAAAGGGAAGG + Intronic
934656989 2:96121586-96121608 CTGTGTAACTGGCATGGGGAGGG - Intergenic
934656989 2:96121586-96121608 CTGTGTAACTGGCATGGGGAGGG - Intergenic
934731614 2:96662054-96662076 GTGTGGAAGAAGAAGGGGCATGG + Intergenic
934731614 2:96662054-96662076 GTGTGGAAGAAGAAGGGGCATGG + Intergenic
935721169 2:105980578-105980600 CTGTATAGCAAGAGTGGGGAAGG - Intergenic
935721169 2:105980578-105980600 CTGTATAGCAAGAGTGGGGAAGG - Intergenic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
938222210 2:129580151-129580173 CTGTACAAGAAGCATGGGGCTGG + Intergenic
938222210 2:129580151-129580173 CTGTACAAGAAGCATGGGGCTGG + Intergenic
938747767 2:134296199-134296221 CTGTGTCAGAGAATTGGGGATGG + Intronic
938747767 2:134296199-134296221 CTGTGTCAGAGAATTGGGGATGG + Intronic
939076924 2:137614278-137614300 ATGAGAAAGAAGAATGGGGATGG - Intronic
939076924 2:137614278-137614300 ATGAGAAAGAAGAATGGGGATGG - Intronic
939511084 2:143105620-143105642 CTGTTTAAGAAGGATGGGAATGG - Intronic
939511084 2:143105620-143105642 CTGTTTAAGAAGGATGGGAATGG - Intronic
939918717 2:148081782-148081804 ATGTAGAATAAGAATGGGGAAGG - Intronic
939918717 2:148081782-148081804 ATGTAGAATAAGAATGGGGAAGG - Intronic
940413281 2:153390946-153390968 CAGGGTAAGGAGAATTGGGAGGG + Intergenic
940413281 2:153390946-153390968 CAGGGTAAGGAGAATTGGGAGGG + Intergenic
940424677 2:153516856-153516878 CTGTGTAAAGAGAAGTGGGAAGG - Intergenic
940424677 2:153516856-153516878 CTGTGTAAAGAGAAGTGGGAAGG - Intergenic
941707385 2:168674335-168674357 CTGTGGAAGAGGAAAAGGGATGG - Intronic
941707385 2:168674335-168674357 CTGTGGAAGAGGAAAAGGGATGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941963744 2:171280074-171280096 CTGTACAAGACGAAGGGGGAGGG + Intergenic
941963744 2:171280074-171280096 CTGTACAAGACGAAGGGGGAGGG + Intergenic
942455133 2:176132788-176132810 CTGTTTAATAAGAAAGGGGTGGG + Intergenic
942455133 2:176132788-176132810 CTGTTTAATAAGAAAGGGGTGGG + Intergenic
942961616 2:181836317-181836339 CTGAGAAAGAAGACTGGCGAAGG + Intergenic
942961616 2:181836317-181836339 CTGAGAAAGAAGACTGGCGAAGG + Intergenic
944663582 2:201940772-201940794 CTGTGAAAGATGAAAGGGCAAGG - Intergenic
944663582 2:201940772-201940794 CTGTGAAAGATGAAAGGGCAAGG - Intergenic
945146781 2:206746812-206746834 CAGAGTATGAAGAATTGGGAAGG + Intronic
945146781 2:206746812-206746834 CAGAGTATGAAGAATTGGGAAGG + Intronic
946598936 2:221338306-221338328 CTGCTAAACAAGAATGGGGAGGG + Intergenic
946598936 2:221338306-221338328 CTGCTAAACAAGAATGGGGAGGG + Intergenic
947348863 2:229221805-229221827 GTGGTTAAGAGGAATGGGGAGGG - Intronic
947348863 2:229221805-229221827 GTGGTTAAGAGGAATGGGGAGGG - Intronic
948543944 2:238712193-238712215 CTGTGCAAGAAGCATGGCGCCGG + Intergenic
948543944 2:238712193-238712215 CTGTGCAAGAAGCATGGCGCCGG + Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1172704045 20:36870070-36870092 CTGGTCAAGAAGAATGGAGAAGG + Intergenic
1172704045 20:36870070-36870092 CTGGTCAAGAAGAATGGAGAAGG + Intergenic
1173349406 20:42231295-42231317 CTTAGTAAGAAGAATGGGTAGGG + Intronic
1173349406 20:42231295-42231317 CTTAGTAAGAAGAATGGGTAGGG + Intronic
1173544684 20:43886007-43886029 CTGACTCAGAACAATGGGGAGGG + Intergenic
1173544684 20:43886007-43886029 CTGACTCAGAACAATGGGGAGGG + Intergenic
1174664560 20:52245844-52245866 CTGGGTAGGAAAAATGAGGATGG + Intergenic
1174664560 20:52245844-52245866 CTGGGTAGGAAAAATGAGGATGG + Intergenic
1175449242 20:59048339-59048361 CTGTGTTAGAAGGATGGGGGTGG + Intergenic
1175449242 20:59048339-59048361 CTGTGTTAGAAGGATGGGGGTGG + Intergenic
1175566822 20:59986329-59986351 CTGTGTAAGATGGTTTGGGATGG + Intronic
1175566822 20:59986329-59986351 CTGTGTAAGATGGTTTGGGATGG + Intronic
1175752484 20:61508907-61508929 CTGTGGAGGCAGAGTGGGGAGGG - Intronic
1175752484 20:61508907-61508929 CTGTGGAGGCAGAGTGGGGAGGG - Intronic
1176648331 21:9371455-9371477 CTGGGAAATAAGAATGGGGAGGG - Intergenic
1176648331 21:9371455-9371477 CTGGGAAATAAGAATGGGGAGGG - Intergenic
1177558540 21:22721039-22721061 CTGGGTTAGAAGAATAAGGATGG + Intergenic
1177558540 21:22721039-22721061 CTGGGTTAGAAGAATAAGGATGG + Intergenic
1179098263 21:38334933-38334955 CTGTGAAGGAGGAATGGGGGTGG - Intergenic
1179098263 21:38334933-38334955 CTGTGAAGGAGGAATGGGGGTGG - Intergenic
1179572984 21:42288862-42288884 CTGTGTAAGAAGCATGGCCGGGG + Intronic
1179572984 21:42288862-42288884 CTGTGTAAGAAGCATGGCCGGGG + Intronic
1180239100 21:46487452-46487474 ATGTGTAATAAGAATGGGCATGG - Intronic
1180239100 21:46487452-46487474 ATGTGTAATAAGAATGGGCATGG - Intronic
1181471959 22:23145975-23145997 CAGTGGAAGTAGAGTGGGGAGGG - Intronic
1181471959 22:23145975-23145997 CAGTGGAAGTAGAGTGGGGAGGG - Intronic
1181566365 22:23741166-23741188 GTGTGCAGGAAGGATGGGGAGGG + Intergenic
1181566365 22:23741166-23741188 GTGTGCAGGAAGGATGGGGAGGG + Intergenic
1181600904 22:23951420-23951442 CTGTGGAGGGAGAATGGGCAGGG + Intergenic
1181600904 22:23951420-23951442 CTGTGGAGGGAGAATGGGCAGGG + Intergenic
1181607609 22:23989906-23989928 CTGTGGAGGGAGAATGGGCAGGG - Intergenic
1181607609 22:23989906-23989928 CTGTGGAGGGAGAATGGGCAGGG - Intergenic
1181725427 22:24807570-24807592 CTGAGACTGAAGAATGGGGAGGG - Intronic
1181725427 22:24807570-24807592 CTGAGACTGAAGAATGGGGAGGG - Intronic
1182936393 22:34226441-34226463 CAAGGTAAGAAGGATGGGGAAGG + Intergenic
1182936393 22:34226441-34226463 CAAGGTAAGAAGGATGGGGAAGG + Intergenic
1182944608 22:34310262-34310284 CTGAGAAAGAAGAATGTGTATGG + Intergenic
1182944608 22:34310262-34310284 CTGAGAAAGAAGAATGTGTATGG + Intergenic
1183108010 22:35628501-35628523 CTGTGTTAGCAGAATAAGGATGG - Intronic
1183108010 22:35628501-35628523 CTGTGTTAGCAGAATAAGGATGG - Intronic
1183227460 22:36560303-36560325 GAGTGGCAGAAGAATGGGGAGGG - Intergenic
1183227460 22:36560303-36560325 GAGTGGCAGAAGAATGGGGAGGG - Intergenic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
949221648 3:1641725-1641747 TTGTATAAGACAAATGGGGAAGG + Intergenic
949221648 3:1641725-1641747 TTGTATAAGACAAATGGGGAAGG + Intergenic
949396742 3:3622569-3622591 CTGTGAAGGCTGAATGGGGAAGG - Intergenic
949396742 3:3622569-3622591 CTGTGAAGGCTGAATGGGGAAGG - Intergenic
949852735 3:8435116-8435138 CTGTGAAAGAAGAAAGGAAAGGG + Intergenic
949852735 3:8435116-8435138 CTGTGAAAGAAGAAAGGAAAGGG + Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
949892351 3:8742930-8742952 CTGTATAAGAAGCATGGTGCAGG + Intronic
949892351 3:8742930-8742952 CTGTATAAGAAGCATGGTGCAGG + Intronic
951033383 3:17907041-17907063 CTGTATAAGAAGTATGGTGTCGG + Intronic
951033383 3:17907041-17907063 CTGTATAAGAAGTATGGTGTCGG + Intronic
952055469 3:29439750-29439772 CTGGGTAAGAAAAAGGGGGGAGG - Intronic
952055469 3:29439750-29439772 CTGGGTAAGAAAAAGGGGGGAGG - Intronic
952070456 3:29628106-29628128 TTGTTTTAGAAGAATGTGGAGGG + Intronic
952070456 3:29628106-29628128 TTGTTTTAGAAGAATGTGGAGGG + Intronic
954046995 3:47940535-47940557 CTATAAAAGTAGAATGGGGAAGG + Intronic
954046995 3:47940535-47940557 CTATAAAAGTAGAATGGGGAAGG + Intronic
954569379 3:51627767-51627789 CTGTGTAAGAGGAGAGGGAAAGG + Intronic
954569379 3:51627767-51627789 CTGTGTAAGAGGAGAGGGAAAGG + Intronic
954893837 3:53958336-53958358 CTGTTGAAGAAGACTGAGGAGGG - Intergenic
954893837 3:53958336-53958358 CTGTTGAAGAAGACTGAGGAGGG - Intergenic
955113875 3:55976980-55977002 CTGTGTGAGAACAAGGTGGAAGG - Intronic
955113875 3:55976980-55977002 CTGTGTGAGAACAAGGTGGAAGG - Intronic
956141574 3:66151692-66151714 GTGTGTTGGAAGGATGGGGATGG - Intronic
956141574 3:66151692-66151714 GTGTGTTGGAAGGATGGGGATGG - Intronic
956700899 3:71957577-71957599 CTGTGTAGGAAGCATGGTGCAGG + Intergenic
956700899 3:71957577-71957599 CTGTGTAGGAAGCATGGTGCAGG + Intergenic
957185029 3:76930322-76930344 CTGTGCACAAAGAGTGGGGAAGG - Intronic
957185029 3:76930322-76930344 CTGTGCACAAAGAGTGGGGAAGG - Intronic
957773941 3:84730781-84730803 CTGTGTGAGAAGAAAGAGGAAGG - Intergenic
957773941 3:84730781-84730803 CTGTGTGAGAAGAAAGAGGAAGG - Intergenic
959830492 3:110855896-110855918 ATTTGTGAGTAGAATGGGGATGG - Intergenic
959830492 3:110855896-110855918 ATTTGTGAGTAGAATGGGGATGG - Intergenic
960547127 3:118928347-118928369 ATCTGTAAGAAGCATGGAGAAGG + Intronic
960547127 3:118928347-118928369 ATCTGTAAGAAGCATGGAGAAGG + Intronic
962096441 3:132297506-132297528 CTGTATAGCAAGAGTGGGGAAGG - Intergenic
962096441 3:132297506-132297528 CTGTATAGCAAGAGTGGGGAAGG - Intergenic
962325962 3:134432428-134432450 CTCAGTGAGAAGAATGGAGAAGG - Intergenic
962325962 3:134432428-134432450 CTCAGTGAGAAGAATGGAGAAGG - Intergenic
962343687 3:134605017-134605039 CTATGTGAGAAGCATGGGGTGGG - Intronic
962343687 3:134605017-134605039 CTATGTGAGAAGCATGGGGTGGG - Intronic
962701654 3:138006523-138006545 CTGTTTAACAATAATGGGGTTGG - Intronic
962701654 3:138006523-138006545 CTGTTTAACAATAATGGGGTTGG - Intronic
963097198 3:141556350-141556372 CTGTGAAAGAATAATCGGAAGGG + Intronic
963097198 3:141556350-141556372 CTGTGAAAGAATAATCGGAAGGG + Intronic
963097315 3:141557701-141557723 AGGTGTAAGAAAAATGGGGAGGG + Intronic
963097315 3:141557701-141557723 AGGTGTAAGAAAAATGGGGAGGG + Intronic
963097816 3:141564343-141564365 CTGTTTAAGATGGATAGGGATGG + Intronic
963097816 3:141564343-141564365 CTGTTTAAGATGGATAGGGATGG + Intronic
963927848 3:150969965-150969987 CAGTGTAAGAGGAATGGAAAAGG - Intronic
963927848 3:150969965-150969987 CAGTGTAAGAGGAATGGAAAAGG - Intronic
964165903 3:153704939-153704961 CTGTATAAGAAGTATGGGTCTGG + Intergenic
964165903 3:153704939-153704961 CTGTATAAGAAGTATGGGTCTGG + Intergenic
964676560 3:159288869-159288891 CGGTGTATGGAGCATGGGGAGGG - Intronic
964676560 3:159288869-159288891 CGGTGTATGGAGCATGGGGAGGG - Intronic
966127790 3:176600144-176600166 CTGTGTGAGAAGACTGGCTAGGG - Intergenic
966127790 3:176600144-176600166 CTGTGTGAGAAGACTGGCTAGGG - Intergenic
967814636 3:193788453-193788475 ATCTTTAAGAAGAATGGGGAAGG - Intergenic
967814636 3:193788453-193788475 ATCTTTAAGAAGAATGGGGAAGG - Intergenic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076293 3:195817475-195817497 CTGTGTAAGGAGAACGAGGCCGG - Intergenic
968076293 3:195817475-195817497 CTGTGTAAGGAGAACGAGGCCGG - Intergenic
1202738551 3_GL000221v1_random:33529-33551 CTGGGAAATAAGAATGGGGAGGG + Intergenic
1202738551 3_GL000221v1_random:33529-33551 CTGGGAAATAAGAATGGGGAGGG + Intergenic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
969223171 4:5774585-5774607 CTGTGTGAGAAACCTGGGGAGGG + Intronic
969223171 4:5774585-5774607 CTGTGTGAGAAACCTGGGGAGGG + Intronic
970007031 4:11421345-11421367 CTGGGTAGGAAGGAGGGGGAGGG - Intronic
970007031 4:11421345-11421367 CTGGGTAGGAAGGAGGGGGAGGG - Intronic
970405533 4:15759596-15759618 ATGAGGAAGAAGAAAGGGGATGG - Intergenic
970405533 4:15759596-15759618 ATGAGGAAGAAGAAAGGGGATGG - Intergenic
971764875 4:30817979-30818001 CTGAGTGAGAAGAATGTGGCAGG - Intronic
971764875 4:30817979-30818001 CTGAGTGAGAAGAATGTGGCAGG - Intronic
971806650 4:31367007-31367029 CTCTGTAAGATGAAGGAGGAAGG + Intergenic
971806650 4:31367007-31367029 CTCTGTAAGATGAAGGAGGAAGG + Intergenic
972804054 4:42509362-42509384 CTGTTGAGGAAGAAGGGGGATGG + Intronic
972804054 4:42509362-42509384 CTGTTGAGGAAGAAGGGGGATGG + Intronic
972806004 4:42529959-42529981 CTGGGGAAGAAGTATGTGGATGG + Intronic
972806004 4:42529959-42529981 CTGGGGAAGAAGTATGTGGATGG + Intronic
974484000 4:62482926-62482948 GCATGTAAGAAAAATGGGGAGGG + Intergenic
974484000 4:62482926-62482948 GCATGTAAGAAAAATGGGGAGGG + Intergenic
977482220 4:97593237-97593259 CTGTGGGAGAAGAGTGGGGGTGG - Intronic
977482220 4:97593237-97593259 CTGTGGGAGAAGAGTGGGGGTGG - Intronic
980103425 4:128564473-128564495 CTTTGCAGGGAGAATGGGGAGGG + Intergenic
980103425 4:128564473-128564495 CTTTGCAGGGAGAATGGGGAGGG + Intergenic
981703093 4:147628198-147628220 CAGTGGCAGAAGAATGTGGATGG - Intronic
981703093 4:147628198-147628220 CAGTGGCAGAAGAATGTGGATGG - Intronic
981930328 4:150182389-150182411 CTGTTTAAGAAAAATGGAGTGGG + Intronic
981930328 4:150182389-150182411 CTGTTTAAGAAAAATGGAGTGGG + Intronic
982785903 4:159536729-159536751 CAGTCTAAGAAGAATGGTAAAGG - Intergenic
982785903 4:159536729-159536751 CAGTCTAAGAAGAATGGTAAAGG - Intergenic
983783801 4:171706662-171706684 TTCTGTAAGAAAAATGGAGAAGG - Intergenic
983783801 4:171706662-171706684 TTCTGTAAGAAAAATGGAGAAGG - Intergenic
983958197 4:173721568-173721590 ATATGTAAGAAGAATGTGGTTGG + Intergenic
983958197 4:173721568-173721590 ATATGTAAGAAGAATGTGGTTGG + Intergenic
984466598 4:180107416-180107438 CTGTGTTAGGAAAATGGAGAAGG + Intergenic
984466598 4:180107416-180107438 CTGTGTTAGGAAAATGGAGAAGG + Intergenic
1202767360 4_GL000008v2_random:159722-159744 CTGGGAAATAAGAATGGGGAGGG - Intergenic
1202767360 4_GL000008v2_random:159722-159744 CTGGGAAATAAGAATGGGGAGGG - Intergenic
986105291 5:4653981-4654003 CTGTGGAAGCAGCTTGGGGATGG - Intergenic
986105291 5:4653981-4654003 CTGTGGAAGCAGCTTGGGGATGG - Intergenic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
988893546 5:35647249-35647271 CTTAGTAAGGAGAAGGGGGAGGG + Intronic
988893546 5:35647249-35647271 CTTAGTAAGGAGAAGGGGGAGGG + Intronic
989079841 5:37606941-37606963 CTGTCAAAAAAGAAAGGGGATGG - Intronic
989079841 5:37606941-37606963 CTGTCAAAAAAGAAAGGGGATGG - Intronic
989497196 5:42123310-42123332 CTGAGAAAGAAGCATTGGGATGG - Intergenic
989497196 5:42123310-42123332 CTGAGAAAGAAGCATTGGGATGG - Intergenic
989770623 5:45140270-45140292 CTGTGTAAGAAGCATGGCTGGGG - Intergenic
989770623 5:45140270-45140292 CTGTGTAAGAAGCATGGCTGGGG - Intergenic
990150855 5:52815589-52815611 CTCTGTTGGAAGAATGGAGAAGG + Intronic
990150855 5:52815589-52815611 CTCTGTTGGAAGAATGGAGAAGG + Intronic
993884563 5:93400387-93400409 CTGTGTAAGACATATGGGGTTGG - Intergenic
993884563 5:93400387-93400409 CTGTGTAAGACATATGGGGTTGG - Intergenic
994978636 5:106843632-106843654 CTGTGTAGAAGAAATGGGGAGGG - Intergenic
994978636 5:106843632-106843654 CTGTGTAGAAGAAATGGGGAGGG - Intergenic
995316660 5:110782353-110782375 CTGTACAAGAAGCATGGTGAGGG + Intergenic
995316660 5:110782353-110782375 CTGTACAAGAAGCATGGTGAGGG + Intergenic
996823185 5:127653075-127653097 GTGTGTAGGAAGCATGGGCAAGG + Intronic
996823185 5:127653075-127653097 GTGTGTAGGAAGCATGGGCAAGG + Intronic
997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG + Exonic
997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG + Exonic
997991887 5:138551386-138551408 CTGTGTGAGCTGAGTGGGGAAGG + Intergenic
997991887 5:138551386-138551408 CTGTGTGAGCTGAGTGGGGAAGG + Intergenic
998411898 5:141917564-141917586 CTGTGTCAGAAGAAAAGGGATGG + Intergenic
998411898 5:141917564-141917586 CTGTGTCAGAAGAAAAGGGATGG + Intergenic
998420044 5:141976701-141976723 CTGTGTAAGTATATTGGGGGAGG - Intronic
998420044 5:141976701-141976723 CTGTGTAAGTATATTGGGGGAGG - Intronic
999953152 5:156671788-156671810 CTGTGTAAGAAGCATGGCACTGG + Intronic
999953152 5:156671788-156671810 CTGTGTAAGAAGCATGGCACTGG + Intronic
1002773836 6:311857-311879 CTGTCAGAGAAGAAAGGGGATGG - Intronic
1002773836 6:311857-311879 CTGTCAGAGAAGAAAGGGGATGG - Intronic
1002998799 6:2311887-2311909 CTGTATAGCAAGAGTGGGGAAGG - Intergenic
1002998799 6:2311887-2311909 CTGTATAGCAAGAGTGGGGAAGG - Intergenic
1005882544 6:30072082-30072104 CTGGGTCAGCAAAATGGGGAAGG + Intronic
1005882544 6:30072082-30072104 CTGGGTCAGCAAAATGGGGAAGG + Intronic
1005890176 6:30130976-30130998 CTGTGTAAGAGGAAGAGGGGTGG - Intergenic
1005890176 6:30130976-30130998 CTGTGTAAGAGGAAGAGGGGTGG - Intergenic
1006804099 6:36777357-36777379 CTGTGTAGGATGGGTGGGGAGGG - Intronic
1006804099 6:36777357-36777379 CTGTGTAGGATGGGTGGGGAGGG - Intronic
1007111896 6:39317650-39317672 CTGTGAAAGAGGAAGGGTGAAGG - Intronic
1007111896 6:39317650-39317672 CTGTGAAAGAGGAAGGGTGAAGG - Intronic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007207903 6:40167490-40167512 CTGAGGAAGAAGAGTGGAGAAGG - Intergenic
1007207903 6:40167490-40167512 CTGAGGAAGAAGAGTGGAGAAGG - Intergenic
1007234618 6:40381627-40381649 CTGTGTCAGAAGGATGGGTGAGG + Intergenic
1007234618 6:40381627-40381649 CTGTGTCAGAAGGATGGGTGAGG + Intergenic
1007649673 6:43411406-43411428 ATGTGAAAGAAGAATGTGAAGGG + Intergenic
1007649673 6:43411406-43411428 ATGTGAAAGAAGAATGTGAAGGG + Intergenic
1009059974 6:58387212-58387234 CTGTGGGAGAAGCATGGGCAGGG - Intergenic
1009059974 6:58387212-58387234 CTGTGGGAGAAGCATGGGCAGGG - Intergenic
1009230943 6:61060180-61060202 CTGTGGGAGAAGCATGGGCAGGG + Intergenic
1009230943 6:61060180-61060202 CTGTGGGAGAAGCATGGGCAGGG + Intergenic
1012177472 6:96106269-96106291 TTTTGTCAGAAGAATTGGGAGGG + Intronic
1012177472 6:96106269-96106291 TTTTGTCAGAAGAATTGGGAGGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1015497180 6:133893981-133894003 CTCTGTAAGATGAAAGAGGAAGG - Exonic
1015497180 6:133893981-133894003 CTCTGTAAGATGAAAGAGGAAGG - Exonic
1015704132 6:136068729-136068751 CTGTGTAATAAGAATCTTGAAGG - Intronic
1015704132 6:136068729-136068751 CTGTGTAATAAGAATCTTGAAGG - Intronic
1015785551 6:136919304-136919326 CTGTGTAGTAAGGTTGGGGATGG + Intergenic
1015785551 6:136919304-136919326 CTGTGTAGTAAGGTTGGGGATGG + Intergenic
1015821567 6:137266787-137266809 CTGTGCAAGAAGCATGGTGCTGG + Intergenic
1015821567 6:137266787-137266809 CTGTGCAAGAAGCATGGTGCTGG + Intergenic
1017398716 6:154034108-154034130 CTGTGTATGATGAAATGGGAAGG + Intronic
1017398716 6:154034108-154034130 CTGTGTATGATGAAATGGGAAGG + Intronic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017869646 6:158476089-158476111 CTGTGCTAGAAAAACGGGGAAGG - Intronic
1017869646 6:158476089-158476111 CTGTGCTAGAAAAACGGGGAAGG - Intronic
1018388725 6:163327394-163327416 CTGTGCAAGAAGTATGGTGCCGG - Intergenic
1018388725 6:163327394-163327416 CTGTGCAAGAAGTATGGTGCCGG - Intergenic
1018455828 6:163951441-163951463 CTGTGTTGGTAGAATGGGAAGGG + Intergenic
1018455828 6:163951441-163951463 CTGTGTTGGTAGAATGGGAAGGG + Intergenic
1018738989 6:166713066-166713088 CTTGGGAAGAAGCATGGGGAAGG - Intronic
1018738989 6:166713066-166713088 CTTGGGAAGAAGCATGGGGAAGG - Intronic
1019684234 7:2371754-2371776 CTGTTTAAAAAAAAGGGGGAAGG - Intronic
1019684234 7:2371754-2371776 CTGTTTAAAAAAAAGGGGGAAGG - Intronic
1019841217 7:3447507-3447529 CTGTCCTAGAAGAATGGGGTGGG - Intronic
1019841217 7:3447507-3447529 CTGTCCTAGAAGAATGGGGTGGG - Intronic
1020456321 7:8377329-8377351 CTGTGTAGGATGAATTAGGAAGG - Intergenic
1020456321 7:8377329-8377351 CTGTGTAGGATGAATTAGGAAGG - Intergenic
1021245992 7:18261533-18261555 CTCTGTGAGAATAATGGGAAGGG + Intronic
1021245992 7:18261533-18261555 CTCTGTGAGAATAATGGGAAGGG + Intronic
1022567485 7:31417604-31417626 CTGTGTTAGAAGACCAGGGATGG + Intergenic
1022567485 7:31417604-31417626 CTGTGTTAGAAGACCAGGGATGG + Intergenic
1022853065 7:34285245-34285267 CATAGTAAGAAGATTGGGGATGG + Intergenic
1022853065 7:34285245-34285267 CATAGTAAGAAGATTGGGGATGG + Intergenic
1023121800 7:36916715-36916737 CAGTGTAAGAGGAATGAGGGTGG - Intronic
1023121800 7:36916715-36916737 CAGTGTAAGAGGAATGAGGGTGG - Intronic
1023355994 7:39367545-39367567 CTGTTTAAGAAGGCAGGGGATGG - Intronic
1023355994 7:39367545-39367567 CTGTTTAAGAAGGCAGGGGATGG - Intronic
1023475486 7:40573423-40573445 CTGGGTAAGGTGGATGGGGAGGG - Intronic
1023475486 7:40573423-40573445 CTGGGTAAGGTGGATGGGGAGGG - Intronic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024215265 7:47243246-47243268 CTAGGTAAGAGGAATGGGCAGGG - Intergenic
1024215265 7:47243246-47243268 CTAGGTAAGAGGAATGGGCAGGG - Intergenic
1024339882 7:48246522-48246544 CTCAGTAAGAAGAATAGGGCTGG - Intronic
1024339882 7:48246522-48246544 CTCAGTAAGAAGAATAGGGCTGG - Intronic
1026284890 7:68954619-68954641 ATGTGTGGGAAGAATGGAGAGGG + Intergenic
1026284890 7:68954619-68954641 ATGTGTGGGAAGAATGGAGAGGG + Intergenic
1026389714 7:69888237-69888259 CTGTACAAGAAGAATGGTGCTGG + Intronic
1026389714 7:69888237-69888259 CTGTACAAGAAGAATGGTGCTGG + Intronic
1026959480 7:74399239-74399261 CAGTGTAAGAAGAAGGGTGCTGG + Intronic
1026959480 7:74399239-74399261 CAGTGTAAGAAGAAGGGTGCTGG + Intronic
1027208498 7:76123887-76123909 CTGTGGAAGAAGCATGGAGACGG - Intergenic
1027208498 7:76123887-76123909 CTGTGGAAGAAGCATGGAGACGG - Intergenic
1027428764 7:78088497-78088519 CTGTTTTCGAAGAATGGGCAGGG + Intronic
1027428764 7:78088497-78088519 CTGTTTTCGAAGAATGGGCAGGG + Intronic
1027428936 7:78089884-78089906 CTGTTCAAGAAGCATGGGGCAGG - Intronic
1027428936 7:78089884-78089906 CTGTTCAAGAAGCATGGGGCAGG - Intronic
1028879084 7:95859475-95859497 CTGGGTAAGATGAATGTGGAAGG - Intronic
1028879084 7:95859475-95859497 CTGGGTAAGATGAATGTGGAAGG - Intronic
1029903612 7:104068308-104068330 CAGGGTAGGAAGAATGGAGAGGG + Intergenic
1029903612 7:104068308-104068330 CAGGGTAGGAAGAATGGAGAGGG + Intergenic
1031744936 7:125483636-125483658 GTGTGTAAGAAGACAGAGGAGGG + Intergenic
1031744936 7:125483636-125483658 GTGTGTAAGAAGACAGAGGAGGG + Intergenic
1032919467 7:136528719-136528741 CTGCATAAGAAGCATGGGGCTGG + Intergenic
1032919467 7:136528719-136528741 CTGCATAAGAAGCATGGGGCTGG + Intergenic
1033352593 7:140573738-140573760 CTGTGAAAGAAGACTGCAGAGGG - Intronic
1033352593 7:140573738-140573760 CTGTGAAAGAAGACTGCAGAGGG - Intronic
1033532771 7:142282060-142282082 CTGGGTAACAAGAATGAGGCAGG - Intergenic
1033532771 7:142282060-142282082 CTGGGTAACAAGAATGAGGCAGG - Intergenic
1034703118 7:153113959-153113981 CTCTGCAAGATGAAAGGGGAAGG - Intergenic
1034703118 7:153113959-153113981 CTCTGCAAGATGAAAGGGGAAGG - Intergenic
1034902923 7:154918735-154918757 GTGTGAATGAAGAATGAGGAGGG + Intergenic
1034902923 7:154918735-154918757 GTGTGAATGAAGAATGAGGAGGG + Intergenic
1035649973 8:1256941-1256963 CTGTGTGAAAGGAATGGGGCAGG - Intergenic
1035649973 8:1256941-1256963 CTGTGTGAAAGGAATGGGGCAGG - Intergenic
1036000287 8:4594882-4594904 CTCTGTAAAAGGAATGTGGATGG + Intronic
1036000287 8:4594882-4594904 CTCTGTAAAAGGAATGTGGATGG + Intronic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1037626920 8:20616172-20616194 CTGTATAAGGAGAATAGTGAAGG - Intergenic
1037626920 8:20616172-20616194 CTGTATAAGGAGAATAGTGAAGG - Intergenic
1039179088 8:34843814-34843836 TTGTGTAAGGAGAATGAGAAGGG + Intergenic
1039179088 8:34843814-34843836 TTGTGTAAGGAGAATGAGAAGGG + Intergenic
1039244149 8:35589644-35589666 CTGAGCAAGGAGTATGGGGAAGG - Intronic
1039244149 8:35589644-35589666 CTGAGCAAGGAGTATGGGGAAGG - Intronic
1039252738 8:35684559-35684581 CTGAGAGAGAAAAATGGGGAGGG - Intronic
1039252738 8:35684559-35684581 CTGAGAGAGAAAAATGGGGAGGG - Intronic
1039428905 8:37510478-37510500 CTGTATAAGAAGCATGGTGCAGG + Intergenic
1039428905 8:37510478-37510500 CTGTATAAGAAGCATGGTGCAGG + Intergenic
1040101180 8:43507345-43507367 CTGGGAAATAAGAACGGGGAGGG + Intergenic
1040101180 8:43507345-43507367 CTGGGAAATAAGAACGGGGAGGG + Intergenic
1040758805 8:50812959-50812981 CTATGTAAGAAAAACGAGGATGG - Intergenic
1040758805 8:50812959-50812981 CTATGTAAGAAAAACGAGGATGG - Intergenic
1041017361 8:53604296-53604318 CTGTGGTCGAAGAATGGGGTTGG - Intergenic
1041017361 8:53604296-53604318 CTGTGGTCGAAGAATGGGGTTGG - Intergenic
1041119784 8:54574449-54574471 TTGGGTAAGAAGAAAGGGGGTGG + Intergenic
1041119784 8:54574449-54574471 TTGGGTAAGAAGAAAGGGGGTGG + Intergenic
1041227438 8:55714549-55714571 CTGTATAGCAAGATTGGGGAAGG + Intronic
1041227438 8:55714549-55714571 CTGTATAGCAAGATTGGGGAAGG + Intronic
1043830079 8:84978077-84978099 CAGAGTTAGAAGAATGTGGAAGG + Intergenic
1043830079 8:84978077-84978099 CAGAGTTAGAAGAATGTGGAAGG + Intergenic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1044584693 8:93858863-93858885 CTGAGTCAGAAGCATGGGGTGGG - Intronic
1044584693 8:93858863-93858885 CTGAGTCAGAAGCATGGGGTGGG - Intronic
1044628584 8:94257955-94257977 CTGTGTAAGAAGCTAGGGAAAGG + Intronic
1044628584 8:94257955-94257977 CTGTGTAAGAAGCTAGGGAAAGG + Intronic
1045737422 8:105313060-105313082 CTGTGGAAGAGGATTGGGAATGG + Intronic
1045737422 8:105313060-105313082 CTGTGGAAGAGGATTGGGAATGG + Intronic
1046178796 8:110614869-110614891 ATCCTTAAGAAGAATGGGGATGG + Intergenic
1046178796 8:110614869-110614891 ATCCTTAAGAAGAATGGGGATGG + Intergenic
1046362897 8:113185420-113185442 CTGGGAAAGAGGGATGGGGAAGG - Intronic
1046362897 8:113185420-113185442 CTGGGAAAGAGGGATGGGGAAGG - Intronic
1046697956 8:117363429-117363451 CTCTGTGAGAAGAATGGGGTAGG + Intergenic
1046697956 8:117363429-117363451 CTCTGTGAGAAGAATGGGGTAGG + Intergenic
1047167917 8:122461311-122461333 CTGAGTAAGAAGGAGGGGGCTGG + Intergenic
1047167917 8:122461311-122461333 CTGAGTAAGAAGGAGGGGGCTGG + Intergenic
1048460105 8:134614467-134614489 GTGTGTAAGGAGAATGGAGGAGG - Intronic
1048460105 8:134614467-134614489 GTGTGTAAGGAGAATGGAGGAGG - Intronic
1048917942 8:139202393-139202415 CTGTGCAAGAAGCATAGTGATGG + Intergenic
1048917942 8:139202393-139202415 CTGTGCAAGAAGCATAGTGATGG + Intergenic
1049040352 8:140108094-140108116 CTGTGGAGGATGAATGGAGAAGG + Intronic
1049040352 8:140108094-140108116 CTGTGGAGGATGAATGGAGAAGG + Intronic
1051503353 9:17801955-17801977 CTCTGTAAGAACCATGGGGTGGG - Intergenic
1051503353 9:17801955-17801977 CTCTGTAAGAACCATGGGGTGGG - Intergenic
1051725500 9:20084516-20084538 CTGTGAAAGAAAAAAGGAGAGGG - Intergenic
1051725500 9:20084516-20084538 CTGTGAAAGAAAAAAGGAGAGGG - Intergenic
1052508395 9:29383178-29383200 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
1052508395 9:29383178-29383200 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
1052656661 9:31371844-31371866 TAGTGGAAGAAGAATGTGGATGG + Intergenic
1052656661 9:31371844-31371866 TAGTGGAAGAAGAATGTGGATGG + Intergenic
1052935025 9:34085801-34085823 ATGTGGCAGAAGAATAGGGACGG + Intergenic
1052935025 9:34085801-34085823 ATGTGGCAGAAGAATAGGGACGG + Intergenic
1052979417 9:34437395-34437417 CTGTGGAAGGACACTGGGGATGG - Intronic
1052979417 9:34437395-34437417 CTGTGGAAGGACACTGGGGATGG - Intronic
1053499563 9:38574061-38574083 CTGGGAAATAAGAATGGGGAGGG - Intronic
1053499563 9:38574061-38574083 CTGGGAAATAAGAATGGGGAGGG - Intronic
1055318837 9:75061999-75062021 CTGTGTAATAAGAATGTGGTAGG - Intronic
1055318837 9:75061999-75062021 CTGTGTAATAAGAATGTGGTAGG - Intronic
1055809160 9:80131541-80131563 CTGTCTCAGAAGAAAGGGGGTGG + Intergenic
1055809160 9:80131541-80131563 CTGTCTCAGAAGAAAGGGGGTGG + Intergenic
1056587162 9:87936188-87936210 CTGGGAAATAAGAACGGGGAGGG - Intergenic
1056587162 9:87936188-87936210 CTGGGAAATAAGAACGGGGAGGG - Intergenic
1056609713 9:88116755-88116777 CTGGGAAATAAGAACGGGGATGG + Intergenic
1056609713 9:88116755-88116777 CTGGGAAATAAGAACGGGGATGG + Intergenic
1056688032 9:88782848-88782870 CTGGAAATGAAGAATGGGGAAGG + Intergenic
1056688032 9:88782848-88782870 CTGGAAATGAAGAATGGGGAAGG + Intergenic
1057850796 9:98565493-98565515 CTGTGTAAGAGGAGTGGGTTGGG - Intronic
1057850796 9:98565493-98565515 CTGTGTAAGAGGAGTGGGTTGGG - Intronic
1057913562 9:99038497-99038519 CTGTTTTATAAGAAGGGGGAGGG + Intronic
1057913562 9:99038497-99038519 CTGTTTTATAAGAAGGGGGAGGG + Intronic
1057938605 9:99261071-99261093 CTGTGTAAGATGGATGGAGGAGG + Intergenic
1057938605 9:99261071-99261093 CTGTGTAAGATGGATGGAGGAGG + Intergenic
1057951579 9:99373302-99373324 CTGTGAGATAAAAATGGGGAGGG - Intergenic
1057951579 9:99373302-99373324 CTGTGAGATAAAAATGGGGAGGG - Intergenic
1058341776 9:103906179-103906201 CTCAGGAAGAAAAATGGGGAAGG - Intergenic
1058341776 9:103906179-103906201 CTCAGGAAGAAAAATGGGGAAGG - Intergenic
1059043197 9:110837027-110837049 CTATGTAAGAAAAATTGGCATGG - Intergenic
1059043197 9:110837027-110837049 CTATGTAAGAAAAATTGGCATGG - Intergenic
1059382685 9:113939500-113939522 CTTTGTAACAAGAATTGGAATGG + Intronic
1059382685 9:113939500-113939522 CTTTGTAACAAGAATTGGAATGG + Intronic
1059442780 9:114319159-114319181 CTGAATGGGAAGAATGGGGAGGG - Intergenic
1059442780 9:114319159-114319181 CTGAATGGGAAGAATGGGGAGGG - Intergenic
1059848798 9:118312935-118312957 CTGTATAAGAAGCATGGCTAGGG + Intergenic
1059848798 9:118312935-118312957 CTGTATAAGAAGCATGGCTAGGG + Intergenic
1060155647 9:121318288-121318310 CAGTCTAAGAAGAGTAGGGAGGG + Intronic
1060155647 9:121318288-121318310 CAGTCTAAGAAGAGTAGGGAGGG + Intronic
1060196530 9:121627619-121627641 CTGTGTATGAAGAGCGGGGCTGG + Intronic
1060196530 9:121627619-121627641 CTGTGTATGAAGAGCGGGGCTGG + Intronic
1061281828 9:129602016-129602038 CTGCCCAAGAAGGATGGGGAGGG - Intergenic
1061281828 9:129602016-129602038 CTGCCCAAGAAGGATGGGGAGGG - Intergenic
1062571458 9:137187643-137187665 CAGAGTAAGAGGAAGGGGGAAGG - Exonic
1062571458 9:137187643-137187665 CAGAGTAAGAGGAAGGGGGAAGG - Exonic
1203707283 Un_KI270742v1:63976-63998 CTGGGAAATAAGAATGGGGAGGG + Intergenic
1203707283 Un_KI270742v1:63976-63998 CTGGGAAATAAGAATGGGGAGGG + Intergenic
1203548114 Un_KI270743v1:144594-144616 CTGGGAAATAAGAACGGGGAGGG - Intergenic
1203548114 Un_KI270743v1:144594-144616 CTGGGAAATAAGAACGGGGAGGG - Intergenic
1186976437 X:14911531-14911553 GTGTGTAAAAAGAAAGAGGAAGG + Intronic
1186976437 X:14911531-14911553 GTGTGTAAAAAGAAAGAGGAAGG + Intronic
1187930919 X:24292886-24292908 TTTAGTAAGAAGAATGGGGGTGG - Intergenic
1187930919 X:24292886-24292908 TTTAGTAAGAAGAATGGGGGTGG - Intergenic
1188852034 X:35143930-35143952 CTGGGGAAGAAGCATGTGGATGG - Intergenic
1188852034 X:35143930-35143952 CTGGGGAAGAAGCATGTGGATGG - Intergenic
1189201654 X:39201435-39201457 GTGTGTAAGAGGAAGTGGGAAGG - Intergenic
1189201654 X:39201435-39201457 GTGTGTAAGAGGAAGTGGGAAGG - Intergenic
1189358693 X:40331367-40331389 CTGTTTAAGAAGAATGTGCGTGG - Intergenic
1189358693 X:40331367-40331389 CTGTTTAAGAAGAATGTGCGTGG - Intergenic
1189866250 X:45330764-45330786 GTGTGTAAGATGTATGGGCAGGG + Intergenic
1189866250 X:45330764-45330786 GTGTGTAAGATGTATGGGCAGGG + Intergenic
1190427778 X:50348816-50348838 CTGTGTAATCAGAATGGGCGTGG + Intronic
1190427778 X:50348816-50348838 CTGTGTAATCAGAATGGGCGTGG + Intronic
1192965047 X:76168608-76168630 TTGAGTAAGAAAACTGGGGATGG - Intergenic
1192965047 X:76168608-76168630 TTGAGTAAGAAAACTGGGGATGG - Intergenic
1195116514 X:101704401-101704423 GTGTGTATGTGGAATGGGGATGG - Intergenic
1195116514 X:101704401-101704423 GTGTGTATGTGGAATGGGGATGG - Intergenic
1195575108 X:106440622-106440644 CTGTGTAGGAGGAATAGGGGAGG + Intergenic
1195575108 X:106440622-106440644 CTGTGTAGGAGGAATAGGGGAGG + Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196025596 X:111038401-111038423 TTCTGTAAGAAGGGTGGGGATGG - Intronic
1196025596 X:111038401-111038423 TTCTGTAAGAAGGGTGGGGATGG - Intronic
1196175092 X:112631396-112631418 CTTTGAAAGAAGATTGGAGAGGG - Exonic
1196175092 X:112631396-112631418 CTTTGAAAGAAGATTGGAGAGGG - Exonic
1196459747 X:115917916-115917938 CTGTATAGCAAGAGTGGGGAAGG - Intergenic
1196459747 X:115917916-115917938 CTGTATAGCAAGAGTGGGGAAGG - Intergenic
1196603076 X:117623554-117623576 CTGGAAAAGAATAATGGGGAGGG - Intergenic
1196603076 X:117623554-117623576 CTGGAAAAGAATAATGGGGAGGG - Intergenic
1197831905 X:130651876-130651898 CTTTGAAAGAAGAAAGGGAAGGG - Intronic
1197831905 X:130651876-130651898 CTTTGAAAGAAGAAAGGGAAGGG - Intronic
1198217760 X:134571810-134571832 CTTTGCATGAAGAATGGGAAGGG + Intronic
1198217760 X:134571810-134571832 CTTTGCATGAAGAATGGGAAGGG + Intronic
1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG + Intronic
1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG + Intronic
1200122151 X:153796218-153796240 CTGTGAAGGAAGGCTGGGGAGGG - Intronic
1200122151 X:153796218-153796240 CTGTGAAGGAAGGCTGGGGAGGG - Intronic
1200151136 X:153952037-153952059 CTGTGTCAGCACAATGGGTATGG + Exonic
1200151136 X:153952037-153952059 CTGTGTCAGCACAATGGGTATGG + Exonic
1201259836 Y:12148176-12148198 CTGTATAGCAAGAGTGGGGAAGG - Intergenic
1201259836 Y:12148176-12148198 CTGTATAGCAAGAGTGGGGAAGG - Intergenic