ID: 987230238

View in Genome Browser
Species Human (GRCh38)
Location 5:15886385-15886407
Sequence GCCATAGTGAGAAAAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987230238_987230243 15 Left 987230238 5:15886385-15886407 CCTTGCTCTTTTCTCACTATGGC 0: 1
1: 0
2: 1
3: 23
4: 296
Right 987230243 5:15886423-15886445 AGGGACTTTTTAGATTAGAGAGG 0: 1
1: 0
2: 2
3: 10
4: 169
987230238_987230241 -4 Left 987230238 5:15886385-15886407 CCTTGCTCTTTTCTCACTATGGC 0: 1
1: 0
2: 1
3: 23
4: 296
Right 987230241 5:15886404-15886426 TGGCCGTAAAATCAGGCAAAGGG No data
987230238_987230240 -5 Left 987230238 5:15886385-15886407 CCTTGCTCTTTTCTCACTATGGC 0: 1
1: 0
2: 1
3: 23
4: 296
Right 987230240 5:15886403-15886425 ATGGCCGTAAAATCAGGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987230238 Original CRISPR GCCATAGTGAGAAAAGAGCA AGG (reversed) Intronic
901175496 1:7295787-7295809 GCCACAGAGAAAATAGAGCAGGG + Intronic
901521255 1:9786857-9786879 GGCATCATGAGAAAAGACCAGGG + Intronic
905357883 1:37397332-37397354 GCCAGGGAGAGAAAACAGCAAGG - Intergenic
905446965 1:38033945-38033967 GCCCTAGTGAGAAAATTGGATGG - Intergenic
905492426 1:38354944-38354966 GCCAGAGAGAGAAGGGAGCATGG + Intergenic
905813977 1:40933639-40933661 GCCAGAGTGGCAAAAGGGCAGGG + Intergenic
906712461 1:47941074-47941096 GCCACAGAGAGAAAGGAGGAGGG - Intronic
906785981 1:48616376-48616398 TCCAGAGTGAGAAAAGAACAGGG + Intronic
906875729 1:49536663-49536685 GCTATAGTAACAAAATAGCATGG + Intronic
906879127 1:49570966-49570988 GCTATAGTAATAAAACAGCATGG - Intronic
908513707 1:64871175-64871197 GCCATAGAGACAACAGAGAAAGG - Intronic
910603071 1:89051880-89051902 AACACAGTGAGAAAAAAGCAAGG - Intergenic
911419820 1:97626729-97626751 GACATAGTAAGGAAAGAGAATGG + Intronic
911535281 1:99092305-99092327 GCCATAGTAACCAAACAGCATGG - Intergenic
915206368 1:154273245-154273267 GGCAAAGTGGGACAAGAGCAAGG - Intronic
915274181 1:154776659-154776681 CCCAGAGTGAGGAAACAGCAGGG - Intronic
918032971 1:180834619-180834641 ACTATAGTTAGAAAACAGCATGG - Intronic
918873866 1:190012656-190012678 GTCATAGTCACAAAACAGCATGG + Intergenic
919970403 1:202573209-202573231 GCCATGGTGAGGATAGAGGAGGG - Intronic
920249340 1:204612916-204612938 GCTAGACTGAGAACAGAGCATGG - Intergenic
922454556 1:225764203-225764225 GTGATTGTGAGAAAACAGCAAGG + Intergenic
922456340 1:225776727-225776749 GCCATTGTGAGAAATGAATAAGG - Intergenic
923228008 1:231957160-231957182 TCCATAGGGAGAAAAGATGAAGG - Intronic
923258299 1:232241477-232241499 GCTATAGTAACAAAACAGCATGG + Intergenic
923514617 1:234684298-234684320 GCCATTGTGAGAAGATAGCCTGG + Intergenic
1063201448 10:3787969-3787991 GCGAGAGTGAAAACAGAGCAGGG - Intergenic
1066172822 10:32869976-32869998 GCTACAGTAAGCAAAGAGCATGG - Intronic
1067015898 10:42756009-42756031 GCCAGGCTGAGATAAGAGCAAGG - Intergenic
1067334719 10:45350981-45351003 GTCATTTTGAGAGAAGAGCATGG - Intergenic
1067415056 10:46096542-46096564 GTCACAGTGAGGAATGAGCAGGG - Intergenic
1067994696 10:51258536-51258558 GGCAGAGTGACAATAGAGCAAGG - Intronic
1068535805 10:58240450-58240472 CCCATAAAGAGAAAAGAGAATGG + Intronic
1069344286 10:67449442-67449464 GCTATAGTAACAAAACAGCATGG + Intronic
1070127455 10:73633742-73633764 GAGATAGAGTGAAAAGAGCAGGG + Intronic
1071097298 10:81992384-81992406 TGCAGAGTGAGAAATGAGCAAGG - Intronic
1072027974 10:91482778-91482800 GCTATACAGTGAAAAGAGCATGG - Intronic
1074161752 10:110841539-110841561 GCCATTGTGGGAAAAGAGAATGG - Intergenic
1075757804 10:124828853-124828875 GCCAAAGTGATTAAAGAACATGG + Exonic
1077660587 11:4065149-4065171 GGAATATTGAGAAAAGTGCAGGG + Intronic
1077823068 11:5770380-5770402 GTCATTTTGAGAAAAGAGCATGG + Intronic
1080262428 11:30364140-30364162 GTCACAGTGTGCAAAGAGCAAGG - Intergenic
1081179961 11:39972926-39972948 GCCAAAGTGAGGCAAGAGAATGG - Intergenic
1081514851 11:43817723-43817745 GCCATAGTCACCAAACAGCATGG - Intronic
1082259949 11:50071168-50071190 GCCACAGTGAGGCAAGAGCTGGG + Intergenic
1082917073 11:58448688-58448710 GCCATAGTCAAAAAACAGCATGG + Intergenic
1084804534 11:71569737-71569759 GGCATAGAGAGAAAGGAGGAGGG + Intergenic
1084805921 11:71578891-71578913 GGCATAGAGAGAAAGGAGGAGGG - Intergenic
1085306909 11:75491588-75491610 GCCAGAATGAGTCAAGAGCATGG + Intronic
1088359513 11:108976073-108976095 GCCATGGTTTGAAATGAGCATGG - Intergenic
1088592656 11:111416635-111416657 GCCAATGTGAGCAGAGAGCACGG + Intronic
1088593081 11:111419881-111419903 GCCATATTGGAAAAAGAGTACGG + Intronic
1088890251 11:114038348-114038370 GTCTTTGTGAGAAAAGAGAAAGG - Intergenic
1090675977 11:128996672-128996694 TCCATTGTGAGAAAAAAGTATGG - Intronic
1091544703 12:1493817-1493839 CCCAGAGTGAGAGAAGAGGAAGG + Exonic
1092141235 12:6184911-6184933 GAGAGAGAGAGAAAAGAGCAAGG + Intergenic
1092792134 12:12079422-12079444 GCTTTGGTGAGAAGAGAGCAGGG - Exonic
1094810216 12:34129509-34129531 GCCATAGTTACCAAACAGCATGG + Intergenic
1096087263 12:48874101-48874123 GCCAGAGTGAAAATAGAGGAAGG + Intergenic
1098851044 12:75596456-75596478 TTCATAGTGAGAACAGAGTAGGG - Intergenic
1099647376 12:85376189-85376211 GACATAGTGAAAAAAGATCTGGG - Intergenic
1100955369 12:99902289-99902311 GCCAGAGGAAGAAAAGAGCTTGG + Intronic
1101151900 12:101890649-101890671 TGGGTAGTGAGAAAAGAGCAAGG + Intronic
1103551137 12:121738397-121738419 GCCATGGAGAGATAAGACCAGGG - Intronic
1106265956 13:28110483-28110505 GAAATAGTGAGAAAGGGGCATGG - Intergenic
1109241244 13:59891790-59891812 GCCTTAGTGTCAAAAAAGCATGG + Intronic
1111006476 13:82256300-82256322 ACCATAGAGAGAATAGAGCATGG - Intergenic
1111430161 13:88138751-88138773 GCCAGAGTGATAAGATAGCAAGG + Intergenic
1112110612 13:96293903-96293925 GCCAAGGTAAGAAAAGTGCATGG - Intronic
1112576643 13:100642224-100642246 GCCATGCTGTGCAAAGAGCAAGG - Exonic
1112791193 13:103003910-103003932 ACCATAATGAGAAAAAAGCCTGG - Intergenic
1113144259 13:107189710-107189732 TTCATAGTGATAAAAGAGAAAGG - Intronic
1114237665 14:20836432-20836454 ACCAAAATGAGAACAGAGCAGGG + Intergenic
1114413583 14:22523438-22523460 ACCAAAGTGAGGAATGAGCAGGG - Intergenic
1114853986 14:26415325-26415347 GCCAAAGTGAAAAAGGAGTAAGG - Intergenic
1116103905 14:40475518-40475540 ACCATGGAGGGAAAAGAGCAGGG - Intergenic
1118436622 14:65777055-65777077 TCCAAAGTGAGAAGAAAGCAGGG - Intergenic
1118971803 14:70643209-70643231 CACATAGTGAGAAACGGGCAGGG - Intronic
1119866951 14:77981794-77981816 GCCTGAGGGGGAAAAGAGCAGGG - Intergenic
1120286993 14:82515733-82515755 TCCATATTGAGAAAATGGCATGG + Intergenic
1121470789 14:94152627-94152649 TGGCTAGTGAGAAAAGAGCATGG + Intronic
1121894597 14:97635099-97635121 GCCATCGTTAAAAAAGAGAAGGG - Intergenic
1124170676 15:27369891-27369913 CCCAAGGTGAGAAAAGAGGACGG - Intronic
1126806253 15:52352228-52352250 GCCATTGTTTGAACAGAGCATGG - Intronic
1128450976 15:67805680-67805702 GCCATAGCGAGGACAGAGAATGG - Intronic
1130181734 15:81636565-81636587 GCCATAGTCACAAAACAGCATGG - Intergenic
1130513715 15:84609712-84609734 GCCCTAGTGAGAATGGAGCTGGG + Intronic
1130566898 15:85003951-85003973 CCCAAAAGGAGAAAAGAGCATGG + Intronic
1133906616 16:10028304-10028326 GGCATAGTAGGGAAAGAGCATGG + Intronic
1134056277 16:11171571-11171593 CCCCTAGTGAGAAAATTGCAGGG + Intronic
1134335252 16:13293323-13293345 GCCATAGGGAGCAAAGAACATGG - Intergenic
1135942173 16:26831410-26831432 GCCATGCTGGGAAAAGATCATGG + Intergenic
1136078844 16:27838503-27838525 ACCATAGGGAGAAAAGGGGAGGG + Intronic
1137859186 16:51829382-51829404 AACATAGTGAGAGAGGAGCAGGG - Intergenic
1138347822 16:56330886-56330908 GCCACAGTGACAGAAGAGAATGG - Intronic
1140292852 16:73679257-73679279 GACATTGTTAAAAAAGAGCAGGG - Intergenic
1141055433 16:80809610-80809632 GTCAGAGAGAGAAAATAGCAAGG + Intergenic
1143187798 17:5020960-5020982 GCCAGAGTGGGAAATGGGCATGG + Intronic
1144100430 17:11937802-11937824 GCCAAAGTGAAGAAAGGGCAGGG + Intronic
1147410074 17:40244329-40244351 CCCAAAATGAGAAAAGAGCCAGG - Intronic
1148511333 17:48172528-48172550 GAGAGAGTGGGAAAAGAGCATGG - Intronic
1149035752 17:52132884-52132906 ACCACAGTGAGACAACAGCAAGG + Intronic
1151693666 17:75703007-75703029 GACATACAGGGAAAAGAGCATGG + Intronic
1152080630 17:78185279-78185301 ACCACAGCCAGAAAAGAGCAGGG + Intronic
1152929629 17:83103242-83103264 GCCAGAGGGAGGAATGAGCAGGG - Intergenic
1153900231 18:9612119-9612141 GCTGTTATGAGAAAAGAGCAAGG - Intronic
1155004595 18:21717016-21717038 GCCATAGTCACCAAACAGCATGG + Intronic
1155224968 18:23721429-23721451 GCCCGAATGAGGAAAGAGCATGG + Intronic
1156416489 18:36897546-36897568 GCCCTAGTGAGAAATTTGCATGG + Intronic
1157313089 18:46566695-46566717 GCCATAGTGAGAAACAAGAGGGG + Intronic
1157816949 18:50736448-50736470 GCCACCTTGAGAAAAGAGGATGG + Intergenic
1158830218 18:61269009-61269031 GCCATAGTCACCAAACAGCATGG + Intergenic
1159379725 18:67641192-67641214 GACAGTGTGAGAAAAGAACATGG + Intergenic
1165856968 19:38885036-38885058 GCCATAGTAAGAAAGGACCCTGG - Intronic
1167266073 19:48483425-48483447 GCCTTAGGGAGGAAAGACCAGGG - Intergenic
1168352705 19:55685785-55685807 GCCCAAGTGAGACCAGAGCAAGG - Intronic
926915610 2:17888808-17888830 GCCATAGTCACCAAACAGCATGG - Intronic
928227908 2:29469545-29469567 GCCAAAGTTAGGAAAGAGTAAGG - Intronic
928467234 2:31533454-31533476 ACCATATAGAGAAAAGATCAGGG + Intronic
928682540 2:33717149-33717171 GCAATAGTCAGAAAAGGGTAGGG - Intergenic
928690028 2:33789686-33789708 GGTATAGGGAGAAAAGGGCAGGG - Intergenic
930328556 2:49952719-49952741 GGCTTAATGAGAAGAGAGCAGGG - Intronic
930481856 2:51958153-51958175 GCCTTAGTGATAAAAGGGGATGG - Intergenic
930950861 2:57143216-57143238 GGCATAGAGACAGAAGAGCATGG + Intergenic
931731777 2:65159947-65159969 GCTATAGTGAAATAAGATCAAGG + Intergenic
932929268 2:76014397-76014419 GTCATAATGAGAAAAGATCAGGG + Intergenic
933862917 2:86487890-86487912 GCCACAGTGCAAAACGAGCAAGG - Intronic
933974232 2:87495361-87495383 ACCATAGATAAAAAAGAGCAAGG + Intergenic
935109570 2:100079941-100079963 TACATAGTGAGTTAAGAGCAAGG - Intronic
935294251 2:101634977-101634999 GGCTTAGTCAGAAAAGAGGAGGG + Intergenic
935465351 2:103389883-103389905 GCCCTGGTGGGAAAAGTGCAGGG + Intergenic
935697388 2:105782089-105782111 GTCATAGTAAGAACAGAGTAAGG - Intronic
936029608 2:109060512-109060534 GCTATAGAGAGACAAAAGCAAGG - Intergenic
936319594 2:111455463-111455485 ACCATAGATAAAAAAGAGCAAGG - Intergenic
938462400 2:131506320-131506342 GCCATAGGAAGCAAAGGGCATGG - Intergenic
938650185 2:133375018-133375040 CCCATTGTAAGAAAAGCGCAGGG - Intronic
939607075 2:144266120-144266142 GTCATTGTGAGAAGAGAACAAGG + Intronic
940137845 2:150459339-150459361 GAGACAGTGAGAAAAAAGCAGGG + Intergenic
941208163 2:162600946-162600968 CCCATGGGGAGAAAAGAACAGGG + Intronic
942805353 2:179925260-179925282 GACATAGTGAGAAAGTAGCCAGG + Intergenic
943637235 2:190319646-190319668 GCCACAGTGGGAAAAGGGCCGGG - Intronic
945023343 2:205596191-205596213 GCCAGAGTAAGAAGAGACCAAGG + Intronic
945037175 2:205714470-205714492 GCCTTAGTGTGAAAATAGCACGG + Intronic
948401087 2:237685971-237685993 GCCACAGAGTGAAGAGAGCAAGG - Intronic
948482670 2:238260113-238260135 GGCAAAGTGAGAACAGAGGATGG + Intronic
1170787388 20:19479455-19479477 GCCAGCATGAGAAAAGAGGATGG - Intronic
1170801616 20:19595103-19595125 GCTAGAGTAAGAAAACAGCAAGG + Intronic
1171003388 20:21438311-21438333 GACATTATGAGAAAAGAGCGAGG + Intergenic
1171807215 20:29690314-29690336 GACAAAGAGAGAAAAGAGAATGG - Intergenic
1172366333 20:34352692-34352714 GGAATATTGGGAAAAGAGCAAGG + Intergenic
1172623859 20:36336440-36336462 GCCATAGGCATAACAGAGCAGGG - Intronic
1173907827 20:46641685-46641707 GGCACAGTGAGAAAAGACAAGGG + Intronic
1174633401 20:51978101-51978123 GCCAAAGTGAGAGAGGAGAAAGG + Intergenic
1174982211 20:55408709-55408731 GCCCTAGTGAGACAATAGCTGGG - Intergenic
1175134549 20:56813209-56813231 TCCATAATGAGAAAAGCCCAGGG - Intergenic
1175979019 20:62727808-62727830 GCCAGAGTGGGAGAAGAGCAAGG + Intronic
1176108387 20:63400010-63400032 GCCACAGTGAGTGAGGAGCAGGG - Intergenic
1178248174 21:30974239-30974261 GCAACAGTGAGAAGAGAGGAAGG + Intergenic
1178755043 21:35340816-35340838 GCCAGACAGAGAAAAGAACAGGG + Intronic
1179649030 21:42794664-42794686 GCCATACAGAGAGGAGAGCAGGG + Intergenic
1180167713 21:46038592-46038614 GGCAGAGTGAGAGAAGAGCCTGG + Intergenic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1181897520 22:26123632-26123654 CACATAGTGAGACAGGAGCAGGG + Intergenic
1181914952 22:26272590-26272612 GCCTTAGAGAGGAAAAAGCAGGG + Intronic
1184331779 22:43832331-43832353 GTTATGGTGAGGAAAGAGCAAGG - Intronic
949438717 3:4057234-4057256 GCCAGATGGAGAAATGAGCAAGG + Intronic
949866282 3:8550099-8550121 GCCATTTTGAGAAAACAGAAAGG + Intronic
950448051 3:13049362-13049384 GCCAGAGTGAGATCAGAGCTGGG - Intronic
950805559 3:15600402-15600424 GCACTACTGAGAGAAGAGCAAGG + Intronic
950998129 3:17526889-17526911 GACATGTTGAGAAAACAGCATGG - Intronic
951891433 3:27571505-27571527 AACATAGTGAGAAAAGAGGCTGG + Intergenic
954320955 3:49831713-49831735 GGAATAATGAGAAAAGAGAAGGG + Intronic
955187182 3:56725746-56725768 GCAGCAGTGAGAAAAGAGGACGG + Intergenic
955199461 3:56837300-56837322 ACCATACTCTGAAAAGAGCACGG + Intronic
955221360 3:57025964-57025986 CCCTAGGTGAGAAAAGAGCATGG - Intronic
955337072 3:58095602-58095624 GCCAATGTGGGAAGAGAGCAGGG - Intronic
955784649 3:62524381-62524403 GGCATAATTAGAAAAGGGCATGG - Intronic
956652549 3:71518593-71518615 GCCAACTTGAGAAAAGAGCAAGG - Intronic
957496656 3:81000353-81000375 GCCTTATTGAAAAAAGAGAAAGG - Intergenic
957772667 3:84714818-84714840 GCCATAGTAACAAAATAGCTTGG + Intergenic
958721167 3:97845601-97845623 GACATAGGTAGAAGAGAGCAGGG - Intronic
960830657 3:121842845-121842867 GGCAAAGTGAGAAAAGTGAAAGG - Intronic
962092924 3:132263904-132263926 GCCATAGAGAGAAAGTAGTAGGG - Intronic
963633933 3:147769436-147769458 GCCAGACTGAGAAAATAGCATGG + Intergenic
963740837 3:149079159-149079181 ACCATAAGGAGAAAAGAGAAAGG + Intronic
963824407 3:149936327-149936349 GACATAGTTAAGAAAGAGCAAGG - Intronic
964921892 3:161907332-161907354 GCCTTACTGAGAAAAAACCATGG + Intergenic
966122762 3:176541181-176541203 GACATAGTTACAAAATAGCATGG + Intergenic
967110971 3:186293618-186293640 GCCATAAAGACAGAAGAGCAGGG - Intronic
969942034 4:10742252-10742274 CCCATAGTAGGAAAAAAGCAGGG - Intergenic
970234221 4:13942263-13942285 GCCACAGTGAGAAGAATGCATGG + Intergenic
970556371 4:17237169-17237191 GCCAGAGTGAGAAAGGAAGAAGG + Intergenic
971767183 4:30847804-30847826 GTGCTAGTGAGGAAAGAGCAAGG - Intronic
973068788 4:45831337-45831359 GCCATAGTCACCAAACAGCATGG - Intergenic
973122402 4:46538455-46538477 GCCTTAGTGAGAACCTAGCAGGG - Intergenic
974129746 4:57739287-57739309 GACATAGGGATAAAAGAACAAGG - Intergenic
974516605 4:62922534-62922556 GCAAGAGAGAGAGAAGAGCAGGG + Intergenic
975705787 4:77110847-77110869 GCCACTGTGAGAAAAGGGCGGGG - Intergenic
976169215 4:82285718-82285740 TCCATGCAGAGAAAAGAGCATGG + Intergenic
976372491 4:84305200-84305222 GCTATAGTAACCAAAGAGCATGG + Intergenic
976768516 4:88623976-88623998 ACTATAGTGACAAAAAAGCAGGG - Intronic
977341068 4:95758843-95758865 GACAAAGTGAGAATAAAGCAAGG + Intergenic
978085419 4:104646205-104646227 GACAAATTTAGAAAAGAGCAAGG - Intergenic
978588411 4:110297879-110297901 GCCATATTGTTAAAAGGGCATGG - Intergenic
979220608 4:118219301-118219323 GCCACAGTAACAAAACAGCACGG + Intronic
980012484 4:127612787-127612809 GCCCCAGAGAGAATAGAGCAAGG + Intergenic
980079871 4:128332922-128332944 GAGATAGTGAGAAAATTGCATGG + Intergenic
980994457 4:139766798-139766820 GCAAAACTGAGAAAAGACCAAGG + Intronic
981647853 4:147020247-147020269 GCCATACTGAGAAGAAAGGATGG + Intergenic
981790004 4:148525979-148526001 TGGATATTGAGAAAAGAGCAGGG + Intergenic
983020637 4:162671513-162671535 GACATAGTGAGAGGAAAGCAAGG + Intergenic
983258315 4:165427299-165427321 GCTAAAGTGAGAGAAGAGAAAGG - Intronic
983601215 4:169531028-169531050 TTTATAGTGAGAAAATAGCAAGG + Intronic
985161100 4:187045870-187045892 CCCATAGTGAGATATCAGCAAGG - Intergenic
985356110 4:189121416-189121438 GCCATAGTCAGCAAAAAGCATGG + Intergenic
985815109 5:2122171-2122193 GCTATAGTAATAAAACAGCATGG - Intergenic
986191135 5:5497121-5497143 GCCCGAGTGAGCAAAGAGAAAGG + Intergenic
986206564 5:5630181-5630203 GCCAGAGGAAGGAAAGAGCAAGG + Intergenic
986328757 5:6702248-6702270 GCCATAGTGAGAGAGAGGCATGG + Intergenic
987037182 5:14030502-14030524 TCCATGGTGAGGAGAGAGCAGGG - Intergenic
987230238 5:15886385-15886407 GCCATAGTGAGAAAAGAGCAAGG - Intronic
987340044 5:16931703-16931725 TCCATTGTGAGAAAAGGGAAAGG + Intronic
991469426 5:66952237-66952259 GGCATTATGAGAAAAGATCAGGG - Intronic
993434509 5:87875034-87875056 GCCAGATTCAGAACAGAGCAAGG - Intergenic
993554768 5:89322488-89322510 GCAACATTGGGAAAAGAGCAGGG - Intergenic
996477342 5:123936736-123936758 ACCATGGGGAGAAAACAGCAGGG - Intergenic
996600655 5:125259040-125259062 GACAGAGTGACTAAAGAGCAGGG + Intergenic
996874308 5:128224601-128224623 GCCAATTTGAGAAAAGAGAATGG + Intergenic
998399941 5:141843411-141843433 GCCACAGTGAGTAGAGTGCAGGG - Intergenic
998543839 5:143008785-143008807 GCCATACTGAGAAAACAGAGAGG - Intronic
999505510 5:152191102-152191124 GCCATTGTGAAAAAAGAGCTTGG - Intergenic
999855521 5:155588952-155588974 CCCTTGGTGAGAACAGAGCACGG + Intergenic
1000573391 5:162943520-162943542 GCCAAAATGAGAATAAAGCAAGG + Intergenic
1001712078 5:173787014-173787036 GCCATATTGAGAAAGTAGCATGG - Intergenic
1003568160 6:7238097-7238119 GCCAGATTGAGAAAAGAACTGGG - Intronic
1006144040 6:31947592-31947614 AACAAAGTGAGGAAAGAGCAGGG - Intronic
1006685194 6:35826927-35826949 GCCAGAGTGAGAAAAGAATAAGG - Intronic
1006816460 6:36853944-36853966 GCTATTGAGAGAAAAGAGAAAGG + Intergenic
1007311629 6:40951105-40951127 GGGATTGTGAGAAAAGAGAAAGG - Intergenic
1007353192 6:41290554-41290576 GCCATTGTGAAAAGAGAACATGG + Intergenic
1007863367 6:44938454-44938476 GCCATAGTAACAAAACAGCATGG - Intronic
1008517345 6:52330556-52330578 GCCAGAGTCAGAAAAGAGCATGG + Intergenic
1010427048 6:75739327-75739349 GCCATAGTGAGCCATGATCATGG - Intergenic
1010545883 6:77155343-77155365 GCTATAGTAACAAAACAGCATGG - Intergenic
1010552588 6:77241292-77241314 GCCATAGTGAGAAATACACAAGG - Intergenic
1012196994 6:96355307-96355329 GACATAGTTGAAAAAGAGCAGGG - Intergenic
1012568137 6:100685999-100686021 TCAATAGTGAGCAAAGAGCCTGG + Intronic
1012593836 6:101017158-101017180 GCCTCATGGAGAAAAGAGCAGGG - Intergenic
1013974762 6:116064553-116064575 TCTATAGTGTGAAAAGAGCCAGG + Intergenic
1014692779 6:124582122-124582144 GCCAGACTGAGAAGAAAGCAAGG + Intronic
1018308990 6:162489034-162489056 GGCACAGGGAGAAAGGAGCAGGG + Intronic
1019029778 6:169000275-169000297 CCCACAGCGAGAAAGGAGCATGG + Intergenic
1019763313 7:2830425-2830447 GCCATAGTGGGACAAACGCAGGG + Intronic
1019781772 7:2944643-2944665 GGCAGAGTGAGTAAAGAGCTTGG - Intronic
1020652517 7:10892744-10892766 GAGACAGTGAGAAAAGAGCAAGG - Intergenic
1021795257 7:24248244-24248266 ACCATAGAAAGAACAGAGCAAGG - Intergenic
1022801746 7:33783241-33783263 GCCACAGTGAGGCTAGAGCAAGG + Intergenic
1023446719 7:40239415-40239437 TCCATTGAGAGAATAGAGCATGG + Intronic
1024270716 7:47639404-47639426 GCCAGAGACAGAAAAGAACAGGG - Intergenic
1024840300 7:53577859-53577881 GCCATAGTCATCAAACAGCATGG + Intergenic
1025129053 7:56366361-56366383 GCCATTGTGAGGAATGAGCTGGG + Intergenic
1025694353 7:63767138-63767160 GCCATTGTGAGGAATGAGCTGGG - Intergenic
1026045087 7:66901673-66901695 GCCGTTGTGAGAAATGAGCTGGG - Intergenic
1026555396 7:71404366-71404388 TCCATAGTGAGATCAAAGCAAGG - Intronic
1028348084 7:89808300-89808322 AACAGAGTGAGAAAAGACCATGG + Intergenic
1030536305 7:110771352-110771374 GACATAATGAGAAAAAAACAAGG + Intronic
1030855082 7:114545756-114545778 GCCCTATTGAGAAAAAAGAAGGG - Intronic
1031282432 7:119820475-119820497 GCTATAGTCATAAAACAGCATGG - Intergenic
1031802273 7:126262620-126262642 GCTATAGTAAGCAAACAGCATGG - Intergenic
1031840627 7:126734858-126734880 GCAGTGGTGAGAAAAGAGAAAGG + Intronic
1032571653 7:133006603-133006625 GCAACAGTGAGAAAAAAACAAGG + Intronic
1034001586 7:147419206-147419228 GGCATAGAGAGAAGAGAGGAAGG - Intronic
1034566737 7:151921581-151921603 GTCAGAGGGAGAAATGAGCAAGG + Intergenic
1035146914 7:156828168-156828190 GTCATAGTGAGAGAAGAGCCTGG - Intronic
1036000396 8:4596058-4596080 GCCCTTGAGAGAAAGGAGCAAGG - Intronic
1037099722 8:15030288-15030310 GCCATCTTCAGAAAATAGCACGG + Intronic
1037333657 8:17769969-17769991 GCAAAAGTGAGAAATAAGCAAGG + Intronic
1037798956 8:22021004-22021026 GCTATAGTAACAAAACAGCATGG + Intergenic
1041484956 8:58365389-58365411 GCTATAGTAACAAAACAGCATGG + Intergenic
1041620792 8:59966019-59966041 GTCATAGTGAAAAAAAAACAGGG + Intergenic
1042057560 8:64782124-64782146 GTCATGGTGGGCAAAGAGCATGG - Intronic
1042954911 8:74239330-74239352 GACATATAGAGAAAAGAGCATGG - Intronic
1044938167 8:97312967-97312989 GCCATAGAGAGGACAGATCAGGG - Intergenic
1045567182 8:103331462-103331484 TCAGGAGTGAGAAAAGAGCAGGG + Exonic
1045811282 8:106223010-106223032 GCCATGAAGAGAAAAGACCACGG + Intergenic
1046559806 8:115821427-115821449 GGAATAGTGAGAAAATAGAATGG - Intergenic
1046639402 8:116710071-116710093 AGCAGAATGAGAAAAGAGCATGG - Intronic
1047493048 8:125390062-125390084 GCCATGGAGAGAAACGAGCCAGG + Intergenic
1048049956 8:130807368-130807390 GACACATTCAGAAAAGAGCAAGG - Intronic
1048096704 8:131303463-131303485 GCAATAGTAACAAAACAGCATGG - Intergenic
1048108631 8:131441525-131441547 GAGAGAGTTAGAAAAGAGCAGGG - Intergenic
1050390417 9:5137380-5137402 GCTATAGTAACAAAACAGCATGG + Intronic
1051277500 9:15411124-15411146 GCCATAGTCACCAAACAGCATGG - Intergenic
1052213410 9:25934784-25934806 TACATAGTGAGAAAACATCAAGG - Intergenic
1052839670 9:33281628-33281650 AGCATTGTGAGGAAAGAGCAAGG + Intronic
1055780187 9:79812560-79812582 GCCAGAGGAAGAAAAGAGAAGGG + Intergenic
1056181138 9:84083501-84083523 GCCATTAGGAGAAAAAAGCAAGG - Intergenic
1057076376 9:92140363-92140385 GCCCTGGTGAGCAAAGGGCACGG - Intergenic
1058858122 9:109086671-109086693 GCCTTAGTGGTTAAAGAGCATGG - Intronic
1059964937 9:119604275-119604297 GACAGAGTGAGAAATGAGCTTGG - Intergenic
1059977900 9:119737331-119737353 GGCAAAGTGAGAACAGAGCTTGG - Intergenic
1061237634 9:129351852-129351874 GCCCCAGAGAGAAAAGACCAGGG - Intergenic
1186127922 X:6434692-6434714 TACAAAGAGAGAAAAGAGCATGG - Intergenic
1186300963 X:8199376-8199398 GACAGAGTGAGAACTGAGCAAGG + Intergenic
1188141219 X:26554399-26554421 GCCATGGTGAGAAAAGATAGGGG - Intergenic
1188271064 X:28141208-28141230 GACATAGTGAGAAAGAATCAAGG - Intergenic
1190004717 X:46724368-46724390 ACCATTGTGAGGAAAGAGCAAGG - Intronic
1190740540 X:53285597-53285619 GGAACAGTGAGAAAAGGGCAGGG + Intronic
1191771508 X:64764759-64764781 GCAATTCTGAGAAAAGAACAAGG + Intergenic
1193405320 X:81093960-81093982 GCCATAGTCACCAAACAGCATGG + Intergenic
1194575246 X:95605104-95605126 GCCAAAGTTAAAAAACAGCATGG - Intergenic
1194617621 X:96126074-96126096 TCCACAGTAAGAAAAGGGCAGGG - Intergenic
1196137648 X:112227452-112227474 CCCATAGGCAGAAAAGAGCCAGG + Intergenic
1196318462 X:114258225-114258247 GGCACAGAGAGAAAAGATCAAGG + Intergenic
1196630668 X:117935823-117935845 GCCATATTGAGAAAAGAGTTGGG + Intronic
1196674937 X:118409502-118409524 GCCACAGTGAGAAAATTTCATGG - Exonic
1196807634 X:119602920-119602942 GCCAGAGGGAAAAAAGAGCAAGG + Intronic
1198037176 X:132812677-132812699 TACATAGTGTAAAAAGAGCAAGG + Intronic
1198229333 X:134674482-134674504 GCCAAAGTGAGAAAGGACCCAGG + Intronic
1198262075 X:134973885-134973907 GCCCTAGTTAGAAAAGAATATGG + Intergenic
1198684289 X:139211366-139211388 GTCATATTGTGGAAAGAGCAGGG - Intronic
1199264463 X:145814655-145814677 CCCATTGTGAGAAAGTAGCACGG + Intergenic