ID: 987230812

View in Genome Browser
Species Human (GRCh38)
Location 5:15891953-15891975
Sequence CACTGCCCAAAGCACCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987230809_987230812 -2 Left 987230809 5:15891932-15891954 CCAGAAGTAAAGGAACTCAGCCA 0: 1
1: 0
2: 0
3: 28
4: 194
Right 987230812 5:15891953-15891975 CACTGCCCAAAGCACCAGGCAGG 0: 1
1: 0
2: 2
3: 34
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987230812 Original CRISPR CACTGCCCAAAGCACCAGGC AGG Intronic
900351913 1:2238996-2239018 CACAACCCGGAGCACCAGGCAGG - Intronic
900380420 1:2381427-2381449 CACTGCCCAGAGCACCCCGTGGG + Intronic
900529774 1:3147425-3147447 CACTGCCCAGGGCACCTGGTCGG - Intronic
901030112 1:6302209-6302231 CACTGGCCAGGGCAGCAGGCAGG + Intronic
901526403 1:9825478-9825500 CCCTTCCCAAAGCACCTGCCTGG + Intergenic
902514809 1:16984411-16984433 CCCTGCCCAAAGAAACAGCCAGG - Intergenic
903127996 1:21260742-21260764 CTCTGTCCCATGCACCAGGCAGG - Intronic
904333607 1:29783461-29783483 CACAGACCAGAGCACCATGCAGG - Intergenic
905381054 1:37561902-37561924 CTCTGCCAAGACCACCAGGCTGG - Intronic
906608203 1:47185408-47185430 CACTGCCCAAGGCACGAGCTGGG - Intronic
907198748 1:52708077-52708099 GACTGCCCCCACCACCAGGCTGG + Intergenic
907250805 1:53137783-53137805 CACAGACCAAGGCCCCAGGCAGG - Intronic
907488041 1:54790576-54790598 CACTTCCCAAAGCAAAAGGCAGG + Intronic
912391682 1:109307246-109307268 CACCCCCCACAGCACCAGGGAGG + Intergenic
915030795 1:152879032-152879054 CAGAGCCCAAACCACCAGGAGGG - Intronic
918313635 1:183304686-183304708 CACTTCCCAGAGCCCCTGGCAGG + Intronic
920512394 1:206560663-206560685 CACTGCCCAAGCCCACAGGCTGG - Intronic
922726628 1:227925856-227925878 CCCTGCCCACAGCCCTAGGCGGG - Intronic
1062878623 10:960955-960977 CACTGCCCAAAGCCCCAGAGAGG + Intergenic
1063486187 10:6423255-6423277 CACTGCCGTGAGCACCAGGCTGG - Intergenic
1070956204 10:80465149-80465171 CACTCCCCAAAGCAGTGGGCAGG - Intronic
1070957494 10:80474017-80474039 CACAGGCCAAAGGAACAGGCAGG - Intronic
1071118614 10:82252021-82252043 CTCTGTCCACAGCACCATGCAGG - Intronic
1072614220 10:97038712-97038734 CACTTCCCAAAGCCCCAGAGAGG + Intronic
1072797111 10:98364585-98364607 CACTGGCCAAAGCATCAGTGTGG + Intergenic
1073531045 10:104232232-104232254 CACTGCCCATGGCGCAAGGCCGG - Exonic
1074219797 10:111425362-111425384 CACAGCAGATAGCACCAGGCTGG + Intergenic
1075831797 10:125418234-125418256 TGCTGCCCACAGCACCAGGTGGG + Intergenic
1076707234 10:132308443-132308465 CCCTGCGCAAAGCAGAAGGCTGG - Intronic
1077113609 11:872963-872985 CACTCGCCAAACCACCAGGCTGG - Intronic
1078642523 11:13109607-13109629 CCCTGCCCCAGGCACCTGGCTGG + Intergenic
1081786925 11:45754248-45754270 CACTGCCCCAAGCTCCCTGCAGG - Intergenic
1083204086 11:61137580-61137602 CACTGTGCCCAGCACCAGGCTGG + Intronic
1084463230 11:69307758-69307780 GACTGGCCAAAGCAGGAGGCAGG + Intronic
1084529182 11:69717085-69717107 CTCTTCCCAAAGCCCCAGCCAGG + Intergenic
1084714657 11:70865990-70866012 AACTGCAGAAAGCACCAGGGAGG - Intronic
1084874942 11:72124277-72124299 CAGTGCCCAGAGCAGCCGGCTGG - Intronic
1085340421 11:75727760-75727782 CACTTCCTACAGCACCATGCTGG + Intronic
1085662710 11:78383974-78383996 CACTGCCCAGAGCAGCAGCGTGG + Intronic
1087868111 11:103258555-103258577 CCCAACCCACAGCACCAGGCGGG - Intronic
1089768408 11:120785178-120785200 CACTGCACAAACAGCCAGGCTGG - Intronic
1089779894 11:120866371-120866393 CTGTGTGCAAAGCACCAGGCAGG + Intronic
1094207369 12:27854627-27854649 CACTGCCTTCATCACCAGGCTGG + Intergenic
1094853341 12:34392102-34392124 GCCAGCCCAAAGCACCAGGAAGG + Intergenic
1094871454 12:34601337-34601359 GTCTGCCCAAAGCAGCAGGAAGG + Intergenic
1096187081 12:49588368-49588390 CACTGCCCACCTCCCCAGGCTGG + Intronic
1097057929 12:56261186-56261208 AATTGCCCAGAGAACCAGGCTGG - Intergenic
1097867297 12:64569398-64569420 CACTGCACAAAGCAGCTGGCTGG - Intergenic
1097943853 12:65344592-65344614 CACTGACCTAAGCACCAAACAGG - Intronic
1098465227 12:70779400-70779422 CACTTCCCCAGGCAGCAGGCAGG - Intronic
1099006246 12:77237890-77237912 CACTCCCCAAAGCATCAAGCAGG - Intergenic
1099443825 12:82728872-82728894 CACTGCCCAGTGCAGCGGGCTGG - Intronic
1100001036 12:89835504-89835526 CTCTGTCCCAAGCACAAGGCTGG + Intergenic
1102034141 12:109761351-109761373 CACTACCCCAGGCTCCAGGCAGG + Intronic
1102222260 12:111202487-111202509 CCCTGCCACAAGCATCAGGCAGG - Intronic
1102465850 12:113130552-113130574 CAGTGCCCGCAGCACCCGGCAGG + Intronic
1102496107 12:113320585-113320607 CAGTGCCCCAAGGGCCAGGCCGG + Exonic
1103730706 12:123026017-123026039 CTCAGCCCAAAGCACCAAGGTGG + Intronic
1104850043 12:131868457-131868479 CACGGCCCAATCCACCAGGAGGG + Intergenic
1105596821 13:21846852-21846874 CCCTCCCCAGAGCAGCAGGCAGG - Intergenic
1106490412 13:30216485-30216507 CAGTGCCAAAAGCAGCAAGCAGG + Intronic
1108742692 13:53355204-53355226 CAATGCTCAGAGCACAAGGCAGG - Intergenic
1113458580 13:110466055-110466077 CACTTCCCAGAGTACCTGGCTGG - Exonic
1114885741 14:26848312-26848334 AACTGCGCAAAGCAAAAGGCAGG + Intergenic
1118006571 14:61568840-61568862 CTCTGCCCCAGGCACCAGCCTGG - Intronic
1122540594 14:102495834-102495856 CCCTGCCCAGAGCAGCCGGCGGG + Intronic
1122697957 14:103566672-103566694 CACTGCTCTAGGCACCAGGGAGG - Intronic
1122782732 14:104150430-104150452 CACTCCCCACAGTCCCAGGCAGG - Intronic
1124144737 15:27113656-27113678 CACTGCTCAAAGCAGGAAGCTGG - Intronic
1124721108 15:32111387-32111409 CACTGGACTAAGAACCAGGCTGG - Intronic
1125608993 15:40958323-40958345 CACAGCGCAATTCACCAGGCCGG - Intergenic
1126002557 15:44224713-44224735 CATGAGCCAAAGCACCAGGCTGG + Intergenic
1127056111 15:55133841-55133863 CACTACCCAAAGTACTGGGCAGG + Intergenic
1128551195 15:68599023-68599045 CCCTGCCCAAACCACTTGGCTGG + Intronic
1129274963 15:74439075-74439097 CACTGTCCAAAGCCTGAGGCAGG + Intergenic
1130830558 15:87594313-87594335 CACAGCCCAAAGAATCAGGCAGG + Intergenic
1130900360 15:88202379-88202401 CACTGCACAGAGCAGCTGGCTGG - Intronic
1131903741 15:97117900-97117922 CACTGACCCAGGCATCAGGCTGG + Intergenic
1132739236 16:1403115-1403137 CAGAGCCCACAGCAGCAGGCAGG + Intronic
1132991299 16:2796381-2796403 CACTTTCCAAAACCCCAGGCAGG + Intergenic
1134522943 16:14926882-14926904 CCCTCCGCAAAGCTCCAGGCAGG - Intronic
1134549683 16:15133176-15133198 CCCTCCGCAAAGCTCCAGGCAGG + Intronic
1134710611 16:16325533-16325555 CCCTCCGCAAAGCTCCAGGCAGG - Intergenic
1134718781 16:16369821-16369843 CCCTCCGCAAAGCTCCAGGCAGG - Intergenic
1134948991 16:18343112-18343134 CCCTCCGCAAAGCTCCAGGCAGG + Intergenic
1134955975 16:18382338-18382360 CCCTCCGCAAAGCTCCAGGCAGG + Intergenic
1138350951 16:56345964-56345986 CAGTGGCCAGAGCACCAGGCTGG + Exonic
1138531181 16:57635205-57635227 CACTGCCCATGGCTCTAGGCAGG - Intronic
1139253769 16:65521401-65521423 TACTGACCAAAGCAAGAGGCTGG + Intergenic
1139958463 16:70704493-70704515 CTCTGCACACAGCCCCAGGCAGG - Intronic
1142420583 16:89967146-89967168 CACTGCCCAAGGCAGAAGGCTGG - Exonic
1143023259 17:3927525-3927547 CACTGGCCGGAGCACCGGGCCGG - Intronic
1143045490 17:4075537-4075559 CCCTGCACAAACCAGCAGGCAGG + Intronic
1143846390 17:9775447-9775469 CAATGTCCAAAGCCCCAGGCTGG - Intronic
1144167183 17:12624626-12624648 CACAGCCCAAACTACCAGCCAGG + Intergenic
1144734155 17:17545517-17545539 CACAGCCCATGCCACCAGGCTGG + Intronic
1145166275 17:20615193-20615215 CACTGCCCAAGGCAGAAGGCTGG - Intergenic
1145230698 17:21171410-21171432 CCCTGCCCCAAGCACCAGCATGG - Intronic
1146402136 17:32508181-32508203 CACTGCACCCAGCACCATGCTGG + Intronic
1146906772 17:36622994-36623016 CACTGCCCCACGCCCCAGGGTGG + Intergenic
1147646904 17:42039657-42039679 CAGTGCCCAGGGCCCCAGGCTGG + Intronic
1148091228 17:45023555-45023577 CACTGTCTAAAGCCCCAGGCTGG - Exonic
1149680614 17:58504555-58504577 AACTGCCCAAAGCAGGAAGCTGG + Intronic
1151655509 17:75494029-75494051 CAGTGGCCACAGCCCCAGGCTGG + Intronic
1152094897 17:78267244-78267266 CAGAGCCCAAACCACCAGGCAGG - Intergenic
1152324723 17:79628895-79628917 CACTGCCCCAAGCAACACGAGGG + Intergenic
1152608104 17:81303068-81303090 CCCGGCCCAGAGCACCAGGCCGG - Intergenic
1152676807 17:81645431-81645453 CACGGCCTCAAGCACCAGGAAGG - Exonic
1154173803 18:12068516-12068538 CACAGCCCAGAGCCCCGGGCGGG + Intergenic
1157157410 18:45281382-45281404 CACTGCCATAAGCACCAGGCAGG + Intronic
1158326569 18:56319661-56319683 CTCTGCCCACAGCACCCTGCTGG - Intergenic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1158950852 18:62493285-62493307 CACTTCCGAGAGCAGCAGGCTGG - Intergenic
1160261677 18:77299971-77299993 CACTGGCCATAGCATCAGCCAGG - Intergenic
1160370169 18:78365544-78365566 CACTGCCCTGAGGACCAGGTGGG - Intergenic
1163411925 19:17160314-17160336 CAGAGCCAAAGGCACCAGGCAGG + Intronic
1163631370 19:18419532-18419554 CACCGCCCCGAGCCCCAGGCGGG - Exonic
1164080372 19:21857120-21857142 CACTGCCCACAGCCACTGGCTGG + Intergenic
1164920651 19:32086193-32086215 CACAGACCAAAGGGCCAGGCTGG + Intergenic
1165392262 19:35545500-35545522 CACTCCCCAAAGCGCTGGGCCGG + Intergenic
1165901938 19:39173277-39173299 CACTGGCCAGACCAGCAGGCTGG - Exonic
1166767244 19:45258985-45259007 CACTGCCCAAGGTGCCATGCTGG - Exonic
925055225 2:852080-852102 CTCTGCCCAGGGCCCCAGGCTGG - Intergenic
926975702 2:18514827-18514849 CAGTGCCCACAGGGCCAGGCAGG + Intergenic
937148064 2:119664317-119664339 CACTGCCTGAAGCTCCAAGCTGG + Intergenic
937239097 2:120449007-120449029 CCCGGCCCACAGCACCAGGCTGG - Intergenic
938086558 2:128405792-128405814 CACTGCCCAAATCACATTGCTGG - Intergenic
940051461 2:149469510-149469532 CATTGCCCAAACCACCAGGAAGG - Intronic
944428826 2:199611656-199611678 ATCTTCTCAAAGCACCAGGCAGG + Intergenic
944824559 2:203468411-203468433 CACTCCCTTAAGCCCCAGGCTGG + Intronic
946702662 2:222428267-222428289 CACTGCCCTGAGCAGAAGGCAGG + Intronic
947702047 2:232242663-232242685 CACTGCCCAAGGCAGCTGGGTGG - Intronic
948329124 2:237151236-237151258 GACTCCCCCTAGCACCAGGCTGG - Intergenic
948640398 2:239372208-239372230 CACTGCCCGAGGCAGCAGGTGGG + Intronic
948778437 2:240302225-240302247 CATTGCCAAGAGCATCAGGCTGG - Intergenic
949055543 2:241926402-241926424 CCCTGCACCCAGCACCAGGCGGG - Intergenic
1170115354 20:12852296-12852318 CACTAGCCAAAGGACCAGGAAGG + Intergenic
1170796477 20:19551828-19551850 CACTGCCCGGAGGACCAGGCAGG + Intronic
1170858007 20:20075312-20075334 CATTCCCCAAAGCACCATTCTGG - Intronic
1170905100 20:20507738-20507760 CACTGCCCTGAGCAACAGGCAGG + Intronic
1171240383 20:23562982-23563004 CACTGCCCCAGGACCCAGGCTGG - Intergenic
1171385864 20:24769259-24769281 CACTCCCCACACCACCAAGCTGG + Intergenic
1171481332 20:25458010-25458032 CACTGCCCACGGCACCTGCCGGG + Intronic
1173117267 20:40257087-40257109 CACAGCACACAGCACCAGGCTGG + Intergenic
1173176815 20:40771076-40771098 CACTGCCCAACCCACCCGCCAGG + Intergenic
1173434196 20:43017619-43017641 CACTGCCAAGAGCACAAGGAAGG + Intronic
1173515614 20:43663570-43663592 ATCTGCCCAAAGCAAGAGGCAGG - Intergenic
1178129428 21:29554878-29554900 CAGTGCCCACAGCACCTGGCAGG + Intronic
1180708537 22:17824314-17824336 CACGGATCAAAGCCCCAGGCTGG + Intronic
1181175653 22:21033290-21033312 CAGTGCCCCACGCCCCAGGCAGG + Intergenic
1182696661 22:32203224-32203246 CACTGCCCACAGCACAGAGCGGG - Exonic
1183034713 22:35132857-35132879 CAATGCAAAAGGCACCAGGCTGG - Intergenic
1183115060 22:35685480-35685502 CTCTGCCCAAAGCACCAGCATGG + Intergenic
1183295204 22:37025201-37025223 CACTGCCCAAAGCACAGGAGGGG - Intronic
1183678404 22:39312658-39312680 CAATGCCCACTGCTCCAGGCTGG + Intergenic
1184033499 22:41908111-41908133 CACTGCCCACAGCCTCAGCCTGG + Intergenic
1184682468 22:46079635-46079657 CAGAGCCCCAAGCCCCAGGCAGG - Intronic
1184944894 22:47796028-47796050 AACTGCTGACAGCACCAGGCTGG - Intergenic
950181286 3:10915227-10915249 CACTGCCCCAAGACACAGGCTGG - Intronic
950259105 3:11531136-11531158 TACTGCTGACAGCACCAGGCAGG - Intronic
950275512 3:11656994-11657016 CACTGCTCTCAGCTCCAGGCTGG - Intronic
950424548 3:12918037-12918059 CTCGGCACAGAGCACCAGGCTGG + Intronic
952407306 3:33015930-33015952 CATTCCCCAAAGCACCTGGTGGG + Intronic
952912674 3:38204114-38204136 CACTGCCCCAAGCTCATGGCAGG + Intronic
953224887 3:41009800-41009822 CATGGACCCAAGCACCAGGCTGG - Intergenic
953224913 3:41009924-41009946 CACAGCCCCAGGCTCCAGGCTGG - Intergenic
953896772 3:46809158-46809180 AAGTGACCAGAGCACCAGGCAGG + Intronic
959892688 3:111574142-111574164 CACTGACCACAGCACATGGCAGG - Intronic
960221385 3:115113456-115113478 CAGTGCCAAAAGCAGGAGGCAGG - Intronic
961467963 3:127092812-127092834 CACTGCCCAATGCAGCAGACGGG + Intergenic
961716570 3:128861641-128861663 CTCTCCTCAAAGCACCAGCCAGG + Intergenic
963529737 3:146460044-146460066 GTCTACCCTAAGCACCAGGCTGG - Exonic
963799183 3:149659244-149659266 CACTTCGCACAGCACCGGGCTGG + Intronic
964134149 3:153325620-153325642 TACTGCCCAAAGCAACTTGCAGG - Intergenic
966071647 3:175885635-175885657 CACTGGCCAGAGCAGCAGGCTGG - Intergenic
968735750 4:2295828-2295850 CACTGGCCAGAGGACCAGGTAGG + Intronic
969521001 4:7677800-7677822 CACTGCCAAAAGCCCCCTGCAGG + Intronic
969725947 4:8918123-8918145 CAGTGCCCAGAGAAGCAGGCAGG + Intergenic
969865796 4:10076314-10076336 CTCTGTCCACATCACCAGGCTGG + Intronic
970393738 4:15643693-15643715 CACTGCACACTGCACCTGGCTGG + Intronic
973791724 4:54384455-54384477 CACTCCACAAAGCACCACGGAGG - Intergenic
976730678 4:88258004-88258026 AACTGCCAAAAGCAAAAGGCAGG + Exonic
979292335 4:118991681-118991703 CTCTGCCCCAAGCACCATTCAGG - Intronic
980001628 4:127496380-127496402 CCCTGTCCAAAACACTAGGCAGG + Intergenic
980132053 4:128825979-128826001 CACTGGCCAAAGACCCTGGCTGG - Intronic
981575531 4:146200605-146200627 CACTGCACAAAGCAACTTGCAGG + Intergenic
981669879 4:147274970-147274992 GCCTGCCCAAGCCACCAGGCTGG - Intergenic
984769116 4:183422406-183422428 CACTGCCCCAGGCTCCAGCCAGG + Intergenic
985419663 4:189771925-189771947 CAGTGCCAAAACCACAAGGCAGG + Intergenic
985658158 5:1142715-1142737 CACTGCCCAGAACTCCAGGCAGG + Intergenic
985673148 5:1216703-1216725 CGCAGCCCAAGGCACCAGGATGG - Intronic
987230812 5:15891953-15891975 CACTGCCCAAAGCACCAGGCAGG + Intronic
988479464 5:31618032-31618054 CTCTGCCCACATCACAAGGCAGG - Intergenic
991398972 5:66234252-66234274 CAGACCCCACAGCACCAGGCTGG - Intergenic
994082576 5:95723831-95723853 CACAGCCCAAAGCACCAGCCAGG + Intronic
996254279 5:121379035-121379057 CACTTCTCACAGCCCCAGGCAGG - Intergenic
996746585 5:126851459-126851481 CACTTTCCAAAGCATCAAGCTGG - Intergenic
997068222 5:130589071-130589093 CACTGCCCAGAGTAGGAGGCTGG - Intergenic
1000443250 5:161287451-161287473 GAATGCCCAAAGCAGCAGGTTGG - Intergenic
1002381405 5:178832183-178832205 CACTGCCCAAGGCAGAGGGCCGG - Intergenic
1004452181 6:15757511-15757533 CACACACCAGAGCACCAGGCTGG + Intergenic
1009437762 6:63636588-63636610 CAAGGCCCAAAGCTCCATGCTGG - Intronic
1010081711 6:71871366-71871388 GACTGACCAAAGCAAAAGGCTGG + Intergenic
1013202190 6:107909650-107909672 CACTGCTATAAGCACCAAGCTGG + Intronic
1016570595 6:145507909-145507931 CACTGACCAAGGGAGCAGGCTGG - Intronic
1016752468 6:147646248-147646270 CACTGCACATACCACCACGCTGG - Intronic
1017117041 6:150987470-150987492 CAATGTACAAAGCACCAAGCAGG - Intronic
1017777161 6:157689322-157689344 CTCTGTCCAAAGCCCCAGACAGG + Intergenic
1018287885 6:162260196-162260218 GCCTGCCAAAAGCACAAGGCTGG + Intronic
1018385433 6:163299274-163299296 CACTGATCTAAGCACCAGGCAGG + Intronic
1019124204 6:169828333-169828355 CACCGCCCAAAGACACAGGCAGG - Intergenic
1019464623 7:1180616-1180638 CTCTGGCTAGAGCACCAGGCAGG - Intergenic
1020006624 7:4786736-4786758 AAGTGCCCAAGGCACCAGGCAGG - Intronic
1022128675 7:27381962-27381984 CACTGCCCAAAGTACAAAACTGG - Intergenic
1027200055 7:76058303-76058325 GTCTGCCCACAGCACAAGGCTGG - Intronic
1028621217 7:92831784-92831806 CACCGCACAAATCACCAGCCTGG + Intronic
1031239530 7:119219834-119219856 AACTGCTCATAGCACAAGGCTGG - Intergenic
1032528292 7:132597098-132597120 CAAAGCCCATAGCACCGGGCTGG - Intronic
1033312735 7:140273606-140273628 CACAGCCCTGTGCACCAGGCAGG - Intergenic
1035405025 7:158591036-158591058 CCCTGCCTCAAGCACCAGGCAGG + Intergenic
1035570204 8:667566-667588 CACAGCCCACAGCACCATGCAGG + Intronic
1045527316 8:102952174-102952196 CACTGCACCAAGCCCCAGCCTGG - Intronic
1046623963 8:116557852-116557874 TACTACCCAAAGCCCCAGGTGGG + Intergenic
1046734756 8:117765428-117765450 CACAGCTGAAAGCACCAGGTTGG - Intergenic
1047983044 8:130203431-130203453 CCCTGAAAAAAGCACCAGGCTGG + Intronic
1048892586 8:138961150-138961172 CACTGCACCATGCACCATGCTGG + Intergenic
1049176076 8:141193483-141193505 CTCTTCCCAAAACACAAGGCTGG + Intronic
1049334992 8:142079528-142079550 CACTGCCACAAGCCCCAGGTGGG - Intergenic
1049662076 8:143824055-143824077 CCCTGCTCCAAGCACCAGGCGGG - Intronic
1053129851 9:35608730-35608752 CCCTTTCCAAAGCACCAGGTGGG + Intronic
1053286375 9:36851958-36851980 CACAGACCCAAGCTCCAGGCCGG + Intronic
1053348336 9:37394610-37394632 CACTGTCCTAAGCACCAGCTTGG - Intergenic
1056211251 9:84367363-84367385 AAATGGGCAAAGCACCAGGCAGG - Intergenic
1056765477 9:89442208-89442230 CACTGGCCAAAGCACTGGGAGGG + Intronic
1056818156 9:89816698-89816720 CACTGCCCAGAGCACAAAGTGGG - Intergenic
1059330557 9:113532831-113532853 CACTGCTCTAAGCTCCAGGATGG - Intronic
1062060213 9:134491361-134491383 CCCTACCCCAAGCACCAGGCTGG + Intergenic
1062060361 9:134492176-134492198 CCCTACCCCAAGCACCAGGCCGG + Intergenic
1062279075 9:135743992-135744014 CTCTGCCCCCAGCACCAGGCAGG - Intronic
1062436629 9:136549283-136549305 CACCGCCCAAGGCAGCAGGCTGG + Intergenic
1062463720 9:136672285-136672307 GACTGCCCAGCGCCCCAGGCTGG + Exonic
1185480124 X:439496-439518 CTCTGCACAACGCACCAGGGTGG + Intergenic
1185609227 X:1384717-1384739 CAGTGACCACAGCTCCAGGCAGG + Intergenic
1190049702 X:47140582-47140604 CACCCTCCAAAGCCCCAGGCAGG + Intergenic
1191044603 X:56122124-56122146 CACAGCCCATACCACAAGGCAGG - Intergenic
1193216927 X:78875091-78875113 CACTGGCCAGTGCAGCAGGCTGG + Intergenic
1194433481 X:93840050-93840072 CACTGCCCAAAGCAATCTGCAGG - Intergenic
1195564360 X:106323849-106323871 CACTTGCCACAGGACCAGGCTGG + Intergenic
1197023148 X:121715945-121715967 ACCTGCCCAAAGAAGCAGGCTGG + Intergenic
1197846568 X:130810375-130810397 GACTGCCCCCAGCACCAGGCTGG + Intronic