ID: 987233699

View in Genome Browser
Species Human (GRCh38)
Location 5:15921440-15921462
Sequence ATGGACAGACAGATCTGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 1, 2: 5, 3: 24, 4: 431}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987233699 Original CRISPR ATGGACAGACAGATCTGAAA AGG (reversed) Intronic
902145033 1:14391542-14391564 ATGTACTGACAGATCAGAAGTGG - Intergenic
902981459 1:20126457-20126479 GTGGTCAGACAGACCTGACATGG + Intergenic
904900138 1:33850632-33850654 GTGGACAGAAAGGTTTGAAAGGG - Intronic
905251932 1:36654858-36654880 AAGGACAGGCAGATCTGAAGGGG - Intergenic
906124767 1:43421027-43421049 ATGGAGGGACAGATTTGCAAAGG + Intronic
906355328 1:45101235-45101257 ATGCACAGACACTTCTCAAAAGG + Intronic
906907301 1:49909888-49909910 ATTGAGAAACAGATTTGAAAGGG + Intronic
908227728 1:62072801-62072823 AAGGCCTCACAGATCTGAAAGGG + Intronic
909139150 1:71841513-71841535 ATGTACAAACATAACTGAAAAGG - Intronic
909760098 1:79275691-79275713 ATGAACAGACACTTCTCAAAAGG + Intergenic
909991960 1:82234603-82234625 ATGAACAGACACTTCTCAAAAGG - Intergenic
910146308 1:84084609-84084631 ATGGAGAAAAGGATCTGAAATGG + Intronic
910942285 1:92549692-92549714 ATGAACAGACACTTCTCAAAAGG + Intronic
911411419 1:97512898-97512920 TTGGAAAGACAGATTTGAAGAGG + Intronic
912150997 1:106858558-106858580 ATGAACAGACACTTCTCAAAAGG + Intergenic
913127798 1:115809354-115809376 ATGGACTGTTAGATCTTAAAGGG + Intergenic
914249182 1:145907728-145907750 ATTCACAGACATGTCTGAAAAGG + Intronic
915686076 1:157636216-157636238 CTGGACAGACAGATTTTTAAAGG + Intergenic
916903140 1:169252358-169252380 ATGAACAGACACTTCTCAAAAGG - Intronic
917167031 1:172123965-172123987 GTGGACAGAAAGTTCTGAGAGGG + Intronic
918194175 1:182206489-182206511 ATGGAGAGACAAAGATGAAAGGG + Intergenic
918405577 1:184208692-184208714 GAGGAAAGACAGGTCTGAAATGG + Intergenic
918621313 1:186609195-186609217 GTGGACAGACAGACCTCCAAGGG - Intergenic
918989585 1:191681597-191681619 ATGAACAGACACTTCTCAAAAGG - Intergenic
919290166 1:195620195-195620217 ATGAACAGACACTTCTCAAAAGG + Intergenic
920317257 1:205086009-205086031 GTGGAAAGATAGATCTGGAAGGG - Intergenic
920727550 1:208450342-208450364 ATGCACAGGCAGATGAGAAAGGG + Intergenic
920955346 1:210615210-210615232 ATGAACAGACACTTCTCAAAAGG - Intronic
920975965 1:210785675-210785697 ATGGAGAGACATATCAGGAATGG - Intronic
921387564 1:214586375-214586397 AGGGACAAATAGATCTGAACAGG - Intergenic
921762980 1:218938304-218938326 ATGGAAAGAGAGCTGTGAAAGGG - Intergenic
921877353 1:220213550-220213572 AGGGACAGTCAGAGCTAAAAAGG - Intronic
922138656 1:222858674-222858696 ATGAACAGACACTTCTCAAAAGG + Intergenic
922916479 1:229262107-229262129 ATGGAGACACAGATGAGAAAGGG - Intergenic
923964982 1:239127509-239127531 AGGGACAGACAGATGAGAACAGG + Intergenic
924543943 1:245007793-245007815 ATGAGCAGCCAGTTCTGAAAGGG + Intronic
1062987635 10:1784128-1784150 ACGAACAGACAGTTCTCAAAAGG - Intergenic
1063135335 10:3211607-3211629 ATGGGGAAACAGATTTGAAATGG - Intergenic
1064346526 10:14537504-14537526 AAGGACTGACAGATCTCACAGGG + Intronic
1064418437 10:15169365-15169387 ATGGATAGATAGATGCGAAATGG - Intergenic
1065048812 10:21769268-21769290 ATGGATCCTCAGATCTGAAAAGG + Intronic
1065762425 10:28994570-28994592 ATGTACAGAGAGATGAGAAAAGG - Intergenic
1066159001 10:32708664-32708686 ATGAACAGACACTTCTCAAAAGG + Intronic
1066176954 10:32917536-32917558 ATGAACAGACACTTCTCAAAAGG + Intronic
1066444566 10:35470052-35470074 ATGGAGAGACAGATGAGATAGGG + Intronic
1067210335 10:44255707-44255729 AAGAACAGACAAATCTAAAATGG + Intergenic
1067328925 10:45296044-45296066 ATGAACAGACATGTCTCAAAAGG - Intergenic
1067985631 10:51140709-51140731 ATGGAGAGAGGGATATGAAAAGG - Intronic
1068807261 10:61211578-61211600 ATGGAGGGTCAGATCTGCAAAGG + Intergenic
1069310770 10:67033681-67033703 AGGTACAGACAGATCCTAAATGG + Intronic
1069970591 10:72164955-72164977 ATGAAAAGACAGTTTTGAAATGG - Intronic
1070233968 10:74604047-74604069 ATGAACAGACACTTCTCAAAAGG - Intronic
1070472035 10:76790348-76790370 ATGAACAGACACTTCTCAAAAGG - Intergenic
1071412421 10:85409959-85409981 ATGAACAGACACTTCTCAAAAGG - Intergenic
1073736677 10:106355530-106355552 AGGGAGATACAGATCAGAAAGGG - Intergenic
1074608659 10:115000042-115000064 TTGTTCAGACAGATGTGAAAAGG + Intergenic
1075850120 10:125580067-125580089 ATGAACATGCAGCTCTGAAAAGG + Intronic
1076001397 10:126915765-126915787 ACAGCCAGACAGATATGAAAAGG - Intronic
1076184152 10:128433634-128433656 CTGGACACACAGCTCAGAAAAGG + Intergenic
1079550151 11:21685976-21685998 ATGAACAGACACTTCTCAAAAGG + Intergenic
1079765589 11:24388220-24388242 ATGAACAGACACTTCTCAAAAGG - Intergenic
1081613708 11:44578444-44578466 ATGTACAGACAGAGGTGAGAAGG - Intronic
1081763740 11:45594807-45594829 ATGTACAGACAGATGTGTAGGGG - Intergenic
1082578944 11:54843189-54843211 ATGAACAGACACTTCTCAAAAGG + Intergenic
1082739578 11:56895646-56895668 ATGGACAGTGAGTTCTGAACAGG - Intergenic
1086520077 11:87659276-87659298 ATGGACAGAGGGAGATGAAAAGG + Intergenic
1087850202 11:103019186-103019208 ATGAACAGACACTTCTCAAAGGG - Intergenic
1088003381 11:104909806-104909828 ATGTAAAGAAAGAGCTGAAAAGG - Intergenic
1088185400 11:107161845-107161867 CTGAACAGACAGGTCTCAAAAGG + Intergenic
1088356515 11:108949701-108949723 ATGAACAGACACTTCTCAAAAGG - Intergenic
1089780200 11:120868474-120868496 ATGGAAAGACAGAAAGGAAAAGG + Intronic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1091160086 11:133411990-133412012 ATGGATAGACAGATCTGGAGGGG - Intronic
1091522144 12:1256042-1256064 ATGAACAGACACTTCTCAAAAGG - Intronic
1091716416 12:2780172-2780194 ATGCACAGATAAAACTGAAAGGG + Intergenic
1092398435 12:8149555-8149577 ATGAACAGACACTTCTCAAAAGG - Intronic
1093403409 12:18776134-18776156 AAGGACAGAAAGACCTCAAAAGG + Intergenic
1095146993 12:38741867-38741889 ATGAACAGACACTTCTCAAAAGG + Intronic
1095195917 12:39317271-39317293 CCAGACAGACAGATCTTAAATGG + Intronic
1097467917 12:59950923-59950945 ATGAACAGACACTTCTCAAAGGG + Intergenic
1097944015 12:65346382-65346404 ATGAACAGACACTTCTCAAAAGG - Intronic
1097977177 12:65699033-65699055 ATGGAAAAACAGAACAGAAATGG - Intergenic
1098034693 12:66289810-66289832 ATCGACAGATAGATTTGGAATGG + Intergenic
1098504663 12:71235828-71235850 AGGGACAGACAGATATGGAAAGG - Intronic
1098820300 12:75219405-75219427 ATGAACAGACACTTCTCAAAGGG - Intergenic
1099513228 12:83563982-83564004 ATGAACAGACACTTCTCAAAAGG - Intergenic
1099528291 12:83742527-83742549 ATGAACAGACACTTCTCAAATGG + Intergenic
1099809607 12:87563742-87563764 ATGAACAGACACTTCTCAAAAGG + Intergenic
1100374334 12:93999133-93999155 ATGAACAGACATTTCTCAAAAGG + Intergenic
1100759286 12:97788902-97788924 ATGAACAGACACTTCTCAAAAGG - Intergenic
1100996620 12:100307833-100307855 ATGAACAGACACTTCTGAAAAGG + Intronic
1101051148 12:100865501-100865523 ATGAACAGACACATCTCAAAAGG + Intronic
1102756655 12:115347007-115347029 ATAGAAAGAGAGATATGAAAGGG + Intergenic
1104157414 12:126147179-126147201 GTGGACAGCCCCATCTGAAAAGG + Intergenic
1104475018 12:129063968-129063990 TTGGACATACAGATGAGAAAGGG + Intergenic
1104475251 12:129065811-129065833 ATGGACAGATAGATAATAAATGG - Intergenic
1105799924 13:23894240-23894262 ATGGCCAGAAAAATCAGAAATGG - Intronic
1105849111 13:24318757-24318779 ATGGCCAGAAAAATCAGAAATGG + Intronic
1106412419 13:29519682-29519704 ATGGAAAGACACAGCTTAAAGGG + Intronic
1106832515 13:33600772-33600794 ATGGTCACACACATATGAAATGG - Intergenic
1107273570 13:38650333-38650355 ATTGACAGACTGATGTCAAAAGG + Intergenic
1108061157 13:46534769-46534791 ATTCACAGACATATCAGAAAAGG + Intergenic
1108852011 13:54741319-54741341 ATGAACAGACACTTCTCAAAAGG - Intergenic
1109575979 13:64259238-64259260 AAGTACATACAGATTTGAAAGGG - Intergenic
1110666644 13:78125071-78125093 AGAGAGAGAGAGATCTGAAAGGG + Intergenic
1111792409 13:92874894-92874916 ATGAACAGACACTTCTCAAAAGG + Intergenic
1111943447 13:94638358-94638380 ATGAACAGACACTTCTCAAAAGG - Intergenic
1112238695 13:97659703-97659725 AGGGCCAGAAAGCTCTGAAAAGG + Intergenic
1112659228 13:101488252-101488274 ATGAACAGATTGCTCTGAAAAGG - Intronic
1113593161 13:111514624-111514646 TTGGTCAGAAAGATGTGAAATGG + Intergenic
1115084896 14:29502761-29502783 ATGGTCAGATAAATCTCAAAAGG + Intergenic
1115932955 14:38518426-38518448 ATGAACAGACACTTCTCAAAAGG + Intergenic
1116136814 14:40935224-40935246 ATGAACAGACACTTCTCAAAAGG - Intergenic
1116161789 14:41276444-41276466 ATGAACAGACACTTCTCAAAAGG + Intergenic
1116483244 14:45416747-45416769 ATGAACAGACACTTCTCAAAAGG + Intergenic
1116551762 14:46249228-46249250 AGGGTCAGACAGCTCAGAAAAGG - Intergenic
1116747065 14:48833768-48833790 ATATACAGACAGCTCTGACAGGG - Intergenic
1118491991 14:66270034-66270056 ATTGCCAGGCAGATCTGAAATGG - Intergenic
1118681072 14:68242100-68242122 AGTGAGAGACAGATCTGGAAAGG - Intronic
1119070588 14:71579147-71579169 ATGCACAGAAAGATCATAAACGG - Intronic
1119542315 14:75448437-75448459 ATGGCCAGTCAGAGCTGGAAGGG - Intronic
1120189646 14:81429008-81429030 ATGGACACACAGCACTAAAATGG + Intronic
1120555383 14:85923799-85923821 ATGGAAAAACAGAGCTGAAGAGG + Intergenic
1121866766 14:97369071-97369093 ATGGTCACACAGCCCTGAAATGG + Intergenic
1122048950 14:99042296-99042318 AAGCACACACAGAGCTGAAACGG - Intergenic
1124654401 15:31497017-31497039 GTGAACAGAGAGCTCTGAAACGG - Intronic
1125102031 15:35925277-35925299 ACTGACAGGCAGACCTGAAATGG - Intergenic
1126444939 15:48731876-48731898 ATGAACAGACACTTCTAAAAAGG + Intronic
1127727628 15:61765718-61765740 CTGCTCAGGCAGATCTGAAAAGG + Intergenic
1128677042 15:69617829-69617851 ATGAACAGACACTTCTCAAAAGG - Intergenic
1128773659 15:70302472-70302494 ATGGATAGATAGATATGAGATGG + Intergenic
1128853370 15:70985426-70985448 ATGAACAGACACTTCTGAAGAGG - Intronic
1129898632 15:79128523-79128545 GTGGACAGACAGAACTGGCATGG + Intergenic
1130453141 15:84077719-84077741 ATGAACAGACACTTCTCAAAAGG + Intergenic
1131704625 15:94979733-94979755 ATGAACAGACACTTCTCAAAAGG + Intergenic
1134899185 16:17919718-17919740 CTGAACAGACATATCTCAAAAGG + Intergenic
1135171106 16:20184442-20184464 ATGGACATACAAATGTGCAAAGG + Intergenic
1136097244 16:27965933-27965955 ATGGAGAGACAGATCACAGAGGG - Intronic
1136657343 16:31717965-31717987 ATGGAAAGACAGAGCTGGAATGG - Intronic
1136673647 16:31879739-31879761 ATGGAAAGACAGAGCTGGAATGG - Intronic
1137983647 16:53090347-53090369 ATGGAATGACTGATCTGAATGGG - Intronic
1138306841 16:55985103-55985125 ATGAACAGACATTTCTCAAAAGG - Intergenic
1138969372 16:62126546-62126568 ATGGTCAGACAGTTTTGGAATGG + Intergenic
1139491604 16:67288941-67288963 ATGGCCACACACATCAGAAAGGG - Exonic
1140697752 16:77551782-77551804 AGTGACAGACAAATCTGAGAGGG + Intergenic
1142790035 17:2256783-2256805 ATAGATAGACAGATTTGATACGG + Intronic
1143139699 17:4734639-4734661 ATGAACCGGCAGATCTGGAAAGG + Exonic
1144183278 17:12772326-12772348 ATGGAGATATAGATATGAAAGGG + Intergenic
1144421084 17:15099102-15099124 ATGAAAAGACACATCTCAAAAGG - Intergenic
1144817335 17:18044612-18044634 ATGGGCAGACTGTTCAGAAATGG - Intronic
1145198556 17:20918247-20918269 ATGAACAGACACTTCTCAAAAGG - Intergenic
1148987229 17:51633595-51633617 ATGCTCAGAAAGATCTGAGATGG + Exonic
1149167856 17:53775089-53775111 ATGAACAGACACTTCTCAAAAGG + Intergenic
1150028389 17:61703443-61703465 ATGAACAGACATTTCTCAAAAGG - Intronic
1150347714 17:64417148-64417170 ATGGACAGCTATATCTGCAAAGG + Intergenic
1150430377 17:65110880-65110902 CTGGACAGACAGAACTCCAAGGG + Intergenic
1152093628 17:78260133-78260155 ATAGATAGACAGATTTGAGATGG + Intergenic
1152267636 17:79305525-79305547 CTGGACAGACCGACATGAAATGG + Intronic
1153483504 18:5571990-5572012 AAGGACAAGCAGTTCTGAAAGGG - Intronic
1155088013 18:22476487-22476509 ATGGCCACACCGAACTGAAAGGG + Intergenic
1155463970 18:26115168-26115190 ATGAACAGACAGTTTTCAAAAGG + Intergenic
1155843836 18:30680673-30680695 ATGGAGAAAATGATCTGAAATGG + Intergenic
1156217176 18:35011468-35011490 ACAGACAGACAGATCAGGAAGGG + Intronic
1157372886 18:47133777-47133799 ATGAACAGACACTTCTCAAAAGG - Intronic
1157955599 18:52094158-52094180 ATGAACAGACACTTCTCAAAAGG - Intergenic
1160440890 18:78891549-78891571 CAGGACAGACAGATGTGACATGG - Intergenic
1162287239 19:9748080-9748102 ATGAACAGACACTTCTCAAAAGG - Intergenic
1163067266 19:14807180-14807202 ATGAACAGACACTTCTCAAAAGG - Intronic
1164352975 19:27375390-27375412 ATGAACAGACACTTCTCAAAAGG - Intergenic
1168533353 19:57148160-57148182 ATGAACAGACACTTCTCAAAGGG - Intergenic
925629608 2:5877296-5877318 ATGTTCAGACAGTTATGAAAGGG + Intergenic
927423600 2:22957341-22957363 AAGGACAGGCAGATATGACAGGG + Intergenic
927484381 2:23478756-23478778 CTGGACAGACAGTACTGAGACGG - Intronic
928851295 2:35750317-35750339 ATGAACAGACACTTCTCAAAAGG + Intergenic
928986241 2:37185167-37185189 ATGTACAGACACATGAGAAATGG + Intronic
929728130 2:44454649-44454671 ATAGAGAAACAGATCAGAAATGG - Intronic
930628812 2:53729539-53729561 ATGGACAGATAGATGTGTTAAGG - Exonic
930941286 2:57017300-57017322 ATGAACAGACACTTCTCAAAAGG - Intergenic
932324513 2:70848617-70848639 ATGAACAGACACTTCTCAAAAGG + Intergenic
932371542 2:71193240-71193262 ATGAACAGACACCTCTCAAAAGG - Intronic
932552248 2:72783644-72783666 ATGGATAGACATTTCTCAAAAGG - Intronic
932906567 2:75759457-75759479 ATGAACAGAGAGTTCTCAAAAGG + Intergenic
933334751 2:80943494-80943516 ATGGTCAGACACAACTGAAAGGG + Intergenic
933887866 2:86736892-86736914 AGGTACAGAAAGATCAGAAATGG + Intronic
933922312 2:87059820-87059842 AGGTACAGAAAGATCAGAAATGG - Intergenic
935546948 2:104410253-104410275 ATGGAACCACAGATCTGAACAGG + Intergenic
935567470 2:104624533-104624555 ATGAACAGACACCTCTCAAAAGG - Intergenic
935965210 2:108466080-108466102 ATGAATAGACATTTCTGAAAAGG - Intronic
936928941 2:117766815-117766837 ATGAACAGACACTTCTCAAAAGG - Intergenic
936969055 2:118158030-118158052 ATGGACAGCCAGATCAAAGAAGG + Intergenic
939478158 2:142713194-142713216 ATGAACAGACACTTCTCAAAAGG + Intergenic
940109089 2:150130858-150130880 AAGGACAGACAGAGATCAAATGG + Intergenic
941237024 2:162987612-162987634 ATGAACAGACACTTCTCAAAAGG + Intergenic
942376013 2:175338803-175338825 ATGAACAGACACTTCTCAAAAGG - Intergenic
942755089 2:179331150-179331172 ATGAACAGACATTTCTCAAAAGG + Intergenic
942758730 2:179373129-179373151 ATGGAAAGAACCATCTGAAAGGG - Intergenic
943227132 2:185191974-185191996 ATGAACAGACACTTCTCAAAAGG - Intergenic
944499557 2:200344867-200344889 ATGAACAGACACTTCTCAAAAGG - Intronic
945480611 2:210340645-210340667 ATGAACAGACATTTCTCAAAAGG - Intergenic
946687456 2:222284985-222285007 AAGGCAAGAAAGATCTGAAAAGG + Intronic
947949537 2:234135452-234135474 ATTGACAGAAAGAAATGAAAAGG + Intergenic
948966604 2:241386461-241386483 ATGGGGAGACAGATCTGAGCCGG - Intronic
1169580297 20:7015284-7015306 ATGGATACACAGATCACAAATGG - Intergenic
1169796316 20:9466623-9466645 ATGAACAGACACTTCTCAAAAGG + Intronic
1169905691 20:10600977-10600999 ATGGACAGACAGATGAGAAAAGG + Intronic
1170018087 20:11805272-11805294 ATGGACAAATATATATGAAATGG - Intergenic
1170282121 20:14661348-14661370 ATGAACAGACAGTTCTGAAAAGG - Intronic
1170306430 20:14943675-14943697 ATGCACAGACAGTTTTGGAAAGG + Intronic
1170458125 20:16552493-16552515 TTGGAGAGACAGACCTGAAGTGG - Intronic
1171081572 20:22191448-22191470 ATGAACAGACACTTCTCAAAAGG + Intergenic
1171249093 20:23635254-23635276 ATGACCAGCCACATCTGAAAAGG - Exonic
1172373432 20:34415620-34415642 ATGGAAAGAAATTTCTGAAATGG + Intronic
1172441741 20:34971011-34971033 ATGGACAGAAAGACCTGAGCTGG - Intergenic
1172559939 20:35878241-35878263 CTGGACAGAAAGACCTGGAAGGG - Intronic
1173391384 20:42637597-42637619 AGGGACAGACAGTAATGAAAGGG - Intronic
1173937986 20:46884442-46884464 ATGGAATCACAGATTTGAAAAGG - Intergenic
1174127691 20:48319338-48319360 AAGGAGAGACAGATCTAGAATGG - Intergenic
1175666361 20:60863653-60863675 ATGGACAGACAGATAAATAAAGG + Intergenic
1176545900 21:8198755-8198777 ATAGACAGACAGAGATGTAAAGG - Intergenic
1176564851 21:8381800-8381822 ATAGACAGACAGAGATGTAAAGG - Intergenic
1177514618 21:22132928-22132950 ATGGAAAGACAGAAATGGAATGG + Intergenic
1177780887 21:25621476-25621498 ATGGACAGACCTCTCTGAATGGG - Intergenic
1177949816 21:27521065-27521087 ATGAACAGACACTTCTCAAAAGG - Intergenic
1178746707 21:35258560-35258582 ATGGAGAGACAAGTCAGAAAGGG + Intronic
1182380350 22:29882959-29882981 ATGGCTAGACAGATGGGAAATGG - Intergenic
1184357708 22:43993619-43993641 ATGGACAGTGAGCTCTGAACGGG + Intronic
1185413033 22:50695910-50695932 CTGGACTGACAGAACTGTAAAGG - Intergenic
1203250771 22_KI270733v1_random:114992-115014 ATAGACAGACAGAGATGTAAAGG - Intergenic
949659344 3:6259770-6259792 ATGAACAGACACTTCTCAAAAGG - Intergenic
949664380 3:6320097-6320119 ATGAACAGACACTTCTCAAAAGG + Intergenic
949666599 3:6346137-6346159 ATGAACAGACACTTCTCAAAAGG + Intergenic
950165775 3:10797411-10797433 ATGAACAGACACTTCTCAAAAGG + Intergenic
950250740 3:11463184-11463206 ATGGATAGAAATATCTGAGAGGG - Intronic
950258070 3:11522104-11522126 AGGGATAGACAGATCTGAAACGG - Intronic
950806953 3:15613316-15613338 ATGGAAATACAGAATTGAAAAGG - Intronic
951175206 3:19591054-19591076 ATGAACAGACAGTTCTCCAAAGG - Intergenic
951361293 3:21727512-21727534 ATGAACAGACACTTCTCAAAAGG + Intronic
951440542 3:22718250-22718272 ATGAACAGACACTTCTCAAAAGG - Intergenic
951494139 3:23307158-23307180 ATGGAAAGACAAAACGGAAAGGG - Intronic
952506180 3:34008597-34008619 AAGGAGAGACAGCTCTGAGATGG + Intergenic
952518294 3:34128185-34128207 ATGAACAGACACTTCTAAAAAGG + Intergenic
953289009 3:41642988-41643010 ATGAACAGACACTTCTCAAAAGG - Intronic
953497303 3:43399122-43399144 CTGGACAGATAGTTCTTAAAAGG + Intronic
953631387 3:44620999-44621021 ACAGACATTCAGATCTGAAATGG + Intronic
954042668 3:47901169-47901191 ATGGAAATACAGAGCAGAAAGGG - Intronic
954195353 3:48993433-48993455 ATGAACAGACACATCTGAGGAGG + Intronic
955128270 3:56136790-56136812 ATGTACAAAGAGATCTTAAAAGG + Intronic
955135947 3:56218333-56218355 ATGAACAGACACTTCTCAAAAGG + Intronic
955180881 3:56668305-56668327 GGGGACAGAGAGAACTGAAAGGG + Intronic
955586615 3:60484996-60485018 ATGAACAGACATTTCTTAAAAGG + Intronic
955688361 3:61566328-61566350 ATAGAAAGGCAAATCTGAAAGGG - Intronic
956897005 3:73672660-73672682 ATGGGTAGAAAGAACTGAAAGGG - Intergenic
956934353 3:74082836-74082858 ATGGAAAAACAAATCAGAAAGGG + Intergenic
957514730 3:81235353-81235375 AAAGAAAGACAGATCTTAAAGGG - Intergenic
957697690 3:83663097-83663119 ATTCACAGATTGATCTGAAAAGG + Intergenic
957822660 3:85398803-85398825 ATGAACAGACACTTCTCAAAAGG - Intronic
958203853 3:90362150-90362172 ATGAACGGACACATCAGAAAGGG + Intergenic
958523464 3:95221976-95221998 ATGAACAGACACTTCTCAAAAGG - Intergenic
958747919 3:98159913-98159935 ATGAACAGACATTTCTTAAATGG + Intergenic
961666495 3:128496346-128496368 ATGGACAGACTGAGATGGAAAGG + Intergenic
962373965 3:134844973-134844995 ATTCACAGACAAATCTGAAGTGG - Intronic
962439694 3:135401758-135401780 ATGAACAGACACTTCTCAAAAGG + Intergenic
962602334 3:137002572-137002594 ATGAACAGACACTTCTCAAAAGG - Intronic
962825375 3:139096016-139096038 CTGGTCAGCCAGATGTGAAAAGG + Intronic
963570625 3:146990574-146990596 CTGCACAGACAGAGCAGAAAGGG + Intergenic
963907862 3:150788241-150788263 ATGGACAGACAGGGCTGGTAAGG - Intergenic
964488623 3:157210666-157210688 AGGGACAGACAGCTCTCCAATGG - Intergenic
965002245 3:162969210-162969232 ATGAACAGACACTTCTCAAAAGG + Intergenic
965172837 3:165290332-165290354 ATGAACAGACACTTCTCAAAAGG - Intergenic
965233013 3:166077615-166077637 ATGAACAGACACTTCTAAAAAGG + Intergenic
965657520 3:171004289-171004311 ATATACAGACAGAGCTGAGATGG + Intronic
965822470 3:172698535-172698557 TGGGACAGGCAGCTCTGAAAAGG + Intronic
966578522 3:181531854-181531876 ATGGAAAGACAGATCTTAAAGGG - Intergenic
967188703 3:186967004-186967026 TTGGACATACAGATCTGACAGGG + Intronic
967434393 3:189427815-189427837 ATGAACAGACACTTCTCAAAAGG + Intergenic
969191387 4:5523477-5523499 ATGAACAGACACTTCTCAAAAGG + Intergenic
970009805 4:11446640-11446662 AAGTACAGACAGATCAGAAATGG + Intergenic
971356943 4:25903666-25903688 ATGGATAGACAGAGATGAGAGGG + Intronic
971474953 4:27064176-27064198 AAGGACAGACAGAAAGGAAAAGG + Intergenic
972146490 4:36033444-36033466 ATGAACAGACACTTCAGAAAAGG - Intronic
972825547 4:42754931-42754953 ATGAACAGACACTTCTCAAAAGG - Intergenic
973605289 4:52580859-52580881 ATGCAAAAACAGATCTGTAAGGG + Intergenic
974554455 4:63425910-63425932 ATGAACAGACACTTCTCAAAAGG - Intergenic
974832567 4:67207483-67207505 CTGGACATACAGATTTGGAAGGG - Intergenic
976103403 4:81590158-81590180 AAGGACAGAAAGATCTGTAAGGG - Intronic
976545284 4:86328195-86328217 ATGAACAGACACTTCTCAAAAGG + Intronic
977122420 4:93119851-93119873 ATGAACAGACACTTCTTAAAAGG - Intronic
978346497 4:107775773-107775795 ATGAACAGACACTTCTCAAAAGG - Intergenic
978996111 4:115155253-115155275 ATGGAAATACCGGTCTGAAATGG + Intergenic
980808395 4:137843153-137843175 ATGAACAGACACTTCTCAAAAGG - Intergenic
980873315 4:138634921-138634943 ATAGACTGACAGAACTGGAAGGG - Intergenic
981043859 4:140248249-140248271 ATAGACAGACGGATTAGAAATGG - Intergenic
981068838 4:140513540-140513562 ATGAACAGACATTTCTCAAAAGG + Intergenic
981319152 4:143371346-143371368 ATGAACAGACACTTCTCAAAAGG - Intronic
982315954 4:154032204-154032226 ATGAACAGACACTTCTCAAAAGG - Intergenic
982693106 4:158570504-158570526 ATGGACAGAATGTTCTGAATTGG - Intronic
983739974 4:171118055-171118077 CTGGAAAGACAGATGTGACATGG + Intergenic
983892324 4:173042822-173042844 ATGAACAGACAACTCTCAAAAGG - Intergenic
984637229 4:182124423-182124445 AGGGAAAGAGAGATCTGAACTGG + Intergenic
984830902 4:183971989-183972011 GTGGACAGAAAGATCTTCAAGGG + Intronic
986433062 5:7700829-7700851 TTTGTCAGACAGATCAGAAATGG + Intronic
986996973 5:13618552-13618574 ATGAACAGACACTTCTCAAAAGG + Intergenic
987233699 5:15921440-15921462 ATGGACAGACAGATCTGAAAAGG - Intronic
987321745 5:16776715-16776737 AAGAACAGACAGTTCTGAAGTGG + Intronic
987883618 5:23782827-23782849 ATAGACAGACACAAGTGAAATGG - Intergenic
988328160 5:29798311-29798333 ATGAACAGACACTTCTCAAAAGG - Intergenic
988379772 5:30485175-30485197 ATGAACAGACACTTCTCAAAAGG - Intergenic
989299316 5:39870324-39870346 ATGAACAGACACTTCTCAAAAGG - Intergenic
989356625 5:40550738-40550760 ATGAACAGACAGTTCTCAAAAGG - Intergenic
990647300 5:57858842-57858864 ATGGATAGACACATATGGAAAGG + Intergenic
990941108 5:61203959-61203981 ATGAACAGACAATTCTCAAAAGG + Intergenic
993239652 5:85365717-85365739 ATTGATGGACATATCTGAAAGGG - Intergenic
993659888 5:90620398-90620420 ATGAACAGACACTTCTCAAAAGG - Intronic
993763183 5:91822056-91822078 ATGAACAGACACTTCTCAAAAGG - Intergenic
993804532 5:92388054-92388076 ATGAACAGACACTTCTCAAAAGG + Intergenic
994083578 5:95733926-95733948 AAGGACACACAGACCTGAAATGG - Intronic
994672213 5:102776136-102776158 TTGAACAGACACTTCTGAAAAGG - Intronic
994943849 5:106359933-106359955 ATGCACAGAAATTTCTGAAATGG + Intergenic
994979202 5:106851630-106851652 ATGGGCAGATACATCTGGAAAGG - Intergenic
995682476 5:114735403-114735425 ATGAACAGACACTTCTCAAAAGG - Intergenic
997484717 5:134220519-134220541 ATACACAGGCAGATCTGAATTGG - Intronic
997509223 5:134441951-134441973 GTGGATACACAGGTCTGAAATGG + Intergenic
1003439872 6:6130358-6130380 ATGGGCAAAAAGATCTGAATAGG - Intergenic
1004496888 6:16172878-16172900 ATGGAGAGACAGAAGAGAAAAGG - Intergenic
1005405043 6:25477815-25477837 GAGGACAGACATTTCTGAAAAGG - Intronic
1006245642 6:32732481-32732503 ATGAACAGACACTTCTCAAAAGG - Intergenic
1008173673 6:48239749-48239771 ATGTACAGACACTTCTCAAAAGG + Intergenic
1008463785 6:51806820-51806842 ATGGACTGAGATATCTGAAAAGG + Intronic
1008674251 6:53802580-53802602 ATGGACAGCCAGATGTGTTAAGG + Intronic
1008715177 6:54280389-54280411 ATGAACAGACATTTCTCAAAAGG + Intergenic
1008748790 6:54707342-54707364 ATGGAGAGAAACATCAGAAATGG - Intergenic
1009247087 6:61251825-61251847 ATGAACAGACACTTCTCAAAAGG + Intergenic
1010446476 6:75954410-75954432 GTGAACAGACACTTCTGAAAAGG - Intronic
1010603460 6:77859664-77859686 ATGAACAGACACTTCTCAAAAGG - Intronic
1010901310 6:81431644-81431666 ATGAACAGACACTTCTCAAAAGG - Intergenic
1011332360 6:86224482-86224504 ATGAACAGACATTTCTCAAAGGG - Intergenic
1013333912 6:109135758-109135780 ATGAACAGACAGTTCTCAAAAGG + Intronic
1013397659 6:109758794-109758816 ATGAACAGACACTTCTCAAAAGG + Intronic
1013607743 6:111765953-111765975 TTGGACAGACAGATCATAAAAGG + Intronic
1013614994 6:111834651-111834673 CTGGGCAGACAGATTAGAAATGG - Intronic
1015418124 6:132973769-132973791 ATGAATGGACAGATCTAAAAAGG + Intergenic
1015762531 6:136680484-136680506 ATGGAAACAAAGATCTGCAATGG - Intronic
1016585386 6:145678593-145678615 ATGAACAGACACTTCTCAAAAGG + Intronic
1017852598 6:158317955-158317977 ATGAACAGACACTTCTCAAAAGG - Intronic
1018648840 6:165973739-165973761 ATATCCAGACAGATGTGAAATGG + Intronic
1020513338 7:9087220-9087242 TTGGAAAGACAGCTCTGAAGAGG - Intergenic
1020974007 7:14983072-14983094 ATGAACAGACACTTCTCAAAAGG - Intergenic
1021679620 7:23116950-23116972 AAGTTCAGACAGATTTGAAAAGG - Intronic
1022128466 7:27380207-27380229 ATGAACAGCCAGAGCTGAAGAGG + Intergenic
1022491025 7:30817781-30817803 ATGGACAGACATATAGGAAGTGG - Intronic
1022578897 7:31527882-31527904 GTTGGCAGACAGACCTGAAAGGG + Intronic
1023211828 7:37814070-37814092 ATGAACAGACACTTCTGAAAAGG + Intronic
1023956073 7:44887635-44887657 ATGGAGGGACAGATTGGAAAGGG + Intergenic
1024407951 7:49004404-49004426 ATGAACAGACACTTCTCAAAAGG - Intergenic
1024439164 7:49395962-49395984 ATAGACAGAGAGCTCTGAAGTGG + Intergenic
1024623814 7:51187560-51187582 ATGGGCAGGCAGAGGTGAAAAGG + Intronic
1025874244 7:65465283-65465305 ATGAACAGACACTTCTCAAAAGG - Intergenic
1025876565 7:65485613-65485635 ATGAACAGACACTTCTCAAAAGG + Intergenic
1026428388 7:70319339-70319361 ATAGACCTGCAGATCTGAAATGG - Intronic
1027312433 7:76962972-76962994 GTGGACATAGAGAACTGAAAAGG + Intergenic
1027896018 7:84046069-84046091 ATGGAAAGAAAGATCTGGACCGG - Intronic
1027903746 7:84151885-84151907 ATGAACAGACACTTCTCAAAAGG + Intronic
1028115068 7:86987540-86987562 ATGAACAGACACTTCTCAAAAGG + Intronic
1028270219 7:88778916-88778938 ATGAGCAGAAAGATCAGAAATGG - Intronic
1028319569 7:89442148-89442170 ATGAACAGACACTTCTCAAAAGG - Intergenic
1028649236 7:93132174-93132196 ATTTACAATCAGATCTGAAAAGG - Exonic
1028857356 7:95606788-95606810 ATGAACAGACACTTCTCAAAAGG - Intergenic
1028863354 7:95679701-95679723 ATGGGCACACAGAACTGGAAGGG - Intergenic
1030176194 7:106657776-106657798 ATGGACAATCAGATCCAAAATGG + Exonic
1031539584 7:122977350-122977372 ATGAACAGACATTTCTCAAAAGG + Intergenic
1031694601 7:124834437-124834459 ATGAACAGACAGTTCTTAAAAGG + Intronic
1032016344 7:128382650-128382672 CTGGCCAGACAGATCTGAGTGGG + Intergenic
1032382194 7:131496995-131497017 AAGGAAAGACTGAACTGAAATGG + Intergenic
1032768109 7:135020252-135020274 ATGAACAGACACTTCTCAAAAGG + Intronic
1033049402 7:137990348-137990370 ATGGAATGACAAATCTGAAGGGG - Intronic
1033255254 7:139795312-139795334 ATGAACAGACACTTCTCAAAAGG - Intronic
1033618049 7:143036253-143036275 ATGAACAGACATTTCTCAAAAGG + Intergenic
1035421219 7:158730205-158730227 ATGGACAGACAGATGGACAAAGG + Intergenic
1037629675 8:20643200-20643222 ATAGAAAGACAGAACTGACATGG - Intergenic
1038093886 8:24285865-24285887 ATGAACAGACACCTCTCAAAAGG + Intergenic
1038808877 8:30819733-30819755 ATGAACAGACACTTCTAAAAAGG - Intergenic
1039593085 8:38767248-38767270 ATGGATACACAGGTGTGAAAAGG - Intronic
1040373744 8:46802653-46802675 ATGAACAGACACTTCTCAAAAGG + Intergenic
1042107780 8:65347511-65347533 ATGGACAAGCAGATCAGGAAGGG + Intergenic
1042464266 8:69108917-69108939 ATGAACAGACACTTCTCAAAAGG - Intergenic
1043351949 8:79372343-79372365 ATGAACAGACACTTCTCAAAAGG + Intergenic
1043629828 8:82315881-82315903 ATGAACAGACACTTCTCAAAAGG + Intergenic
1044652490 8:94511707-94511729 GTCAACAGAAAGATCTGAAATGG - Exonic
1045589440 8:103577267-103577289 ATGAACAGACACTTCTCAAAAGG + Intronic
1046147222 8:110176691-110176713 ATTAAATGACAGATCTGAAATGG + Intergenic
1047710135 8:127543478-127543500 ATGGAAAGGTAGAGCTGAAATGG - Intergenic
1050239427 9:3619137-3619159 ATGAACAGACACTTCTCAAAAGG - Intergenic
1050517120 9:6456333-6456355 ATGAACAGACAGTTCTCAAAAGG - Intronic
1050675021 9:8042413-8042435 ATGAACAGACACTTCTCAAAAGG - Intergenic
1050790318 9:9460524-9460546 ATGAACAGACACTTCTCAAAAGG + Intronic
1051007046 9:12357989-12358011 ATGAACAGACATTTCTCAAAAGG + Intergenic
1051321263 9:15907848-15907870 ATGAACAGACACTTCTCAAAAGG + Intronic
1051539491 9:18198452-18198474 ATGAACAGACACTTCTCAAAAGG + Intergenic
1051613401 9:18983187-18983209 ATTGACACACAGTTCTGCAATGG + Intronic
1051827598 9:21237387-21237409 ATGAACAGACATTTCTCAAAAGG - Intronic
1052419224 9:28220793-28220815 ATGGAGATACAGATCTGGCATGG - Intronic
1052554995 9:30001898-30001920 ATGAACAGACACTTCTTAAAAGG - Intergenic
1052814506 9:33090752-33090774 ATGAACAGACACTTCTCAAAAGG + Intergenic
1052885103 9:33638681-33638703 ATGGACAGACAGTTCTGAAAAGG + Intergenic
1052885104 9:33638700-33638722 AAGGACAGACAGTTCTGAAAAGG + Intergenic
1053276681 9:36788458-36788480 ATGGATAGACAGATGTGTGAAGG + Intergenic
1053450655 9:38191754-38191776 AAGGACAGACAGTGCTAAAAAGG + Intergenic
1053558738 9:39166744-39166766 AATTACAGACAGATATGAAATGG - Intronic
1053636339 9:40009127-40009149 ATGAACAGACATTTCTCAAAAGG + Intergenic
1053646103 9:40120437-40120459 GTGGACATACAGATCTGAGGTGG + Intergenic
1053769653 9:41455521-41455543 ATGAACAGACATTTCTCAAAAGG - Intergenic
1053822865 9:41986979-41987001 AATTACAGACAGATATGAAATGG - Intronic
1054138373 9:61452197-61452219 AATTACAGACAGATATGAAATGG + Intergenic
1054538467 9:66255539-66255561 GTGGACATACAGATCTGAGGTGG - Intergenic
1054548321 9:66367000-66367022 ATGAACAGACATTTCTCAAAAGG - Intergenic
1054607710 9:67200386-67200408 AATTACAGACAGATATGAAATGG + Intergenic
1055704190 9:78979691-78979713 ATAGACAGACAGATGAGAGAGGG - Intergenic
1055852388 9:80647819-80647841 ATGGACAAATAGAACTGAGAGGG - Intergenic
1056092097 9:83215566-83215588 ATGGACTCACAGTTTTGAAATGG - Intergenic
1056675038 9:88668460-88668482 ATGAACAGACACTTCTCAAAAGG - Intergenic
1058387298 9:104452962-104452984 CTGGCCAGATAGATCTTAAAAGG - Intergenic
1058962063 9:110000810-110000832 ATGAACAGACACTTCTCAAAAGG - Intronic
1060599956 9:124870720-124870742 ATGGACAGTCAGTGCTGAAAGGG + Intronic
1060961352 9:127683017-127683039 ATGGACAGACAGCTGTGAGCAGG + Intronic
1203467172 Un_GL000220v1:98260-98282 ATAGACAGACAGAGATGTAAAGG - Intergenic
1187058255 X:15761438-15761460 ATGAACTGGCACATCTGAAATGG - Intronic
1187428462 X:19200374-19200396 AGGGACAGAAAAATATGAAATGG + Intergenic
1188125379 X:26361295-26361317 ATGGACAGTGAGATCCTAAATGG + Intergenic
1188339746 X:28984662-28984684 ATAAAGAGACAGATCTTAAAAGG - Intronic
1188463960 X:30457069-30457091 ATGAACAGACACTTCTCAAAAGG - Intergenic
1188638987 X:32474659-32474681 ATGAATAGACAGTTCTCAAAAGG - Intronic
1189095117 X:38130346-38130368 ATGGACAGATAGATCAATAATGG - Intronic
1189214638 X:39312420-39312442 AAGGACAGTCACATCTGAACAGG + Intergenic
1191045933 X:56136948-56136970 ATGAACAGACACTTCTCAAAAGG + Intergenic
1191810569 X:65182765-65182787 GTGGACAGACACATTTTAAAAGG + Intergenic
1191981021 X:66925648-66925670 ATGAACAGACACTTCTCAAAAGG - Intergenic
1192144278 X:68670642-68670664 GTGGAAAGACAGGTCTGAAAAGG + Intronic
1192248274 X:69390764-69390786 ATGGTAAGGCAAATCTGAAAGGG - Intergenic
1192692566 X:73380041-73380063 ATGAACAGACACTTCTCAAAGGG + Intergenic
1193722246 X:85000921-85000943 ATGAACAGACACTTCTCAAAAGG - Intergenic
1193789666 X:85802225-85802247 ATGTACAGGGAGATCTAAAACGG - Intergenic
1193976374 X:88124591-88124613 ATGGATAAACATATCTGTAATGG - Intergenic
1194482751 X:94446861-94446883 GTGGACAGACATCTCTGAATGGG + Intergenic
1194583794 X:95708591-95708613 ATGGAATGACAGATGTGAAGTGG + Intergenic
1194649505 X:96498481-96498503 ATGGATAGACCTATCTGAATGGG + Intergenic
1194772868 X:97926388-97926410 ATGAACAGACACTTCTCAAAAGG + Intergenic
1194873146 X:99158029-99158051 ATGAACAGACACTTCTCAAAAGG + Intergenic
1195101338 X:101557014-101557036 ATGAACAGACACTTCTCAAAAGG - Intergenic
1195139245 X:101942472-101942494 ATGAACAGACAGTTCTCAAAAGG + Intergenic
1196027575 X:111057155-111057177 ATGAACAGACATTTCTCAAAAGG + Intronic
1196240529 X:113338622-113338644 ATGAACAGACACTTCTCAAAAGG - Intergenic
1196516229 X:116615533-116615555 ATGAACAGACACTTCTCAAAAGG + Intergenic
1197297359 X:124735293-124735315 ATGAACAGACATTTCTCAAAAGG + Intronic
1197473165 X:126888184-126888206 ATGTACAGACAGTTCTCAAAAGG + Intergenic
1199100114 X:143789789-143789811 AGAGACAGATAGATATGAAAGGG + Intergenic
1199364606 X:146965726-146965748 ATGAACAGACATTTCTCAAAAGG + Intergenic
1200362805 X:155628515-155628537 ATGAACAGACACTTCTCAAAAGG + Intronic
1200743676 Y:6882788-6882810 ATGAACAGACACTTCTCAAAAGG + Intergenic
1201050672 Y:9930714-9930736 ATGAACAGACACTTCTCAAAAGG + Intergenic
1201993269 Y:20053463-20053485 ATGAACAGACACTTCTCAAAAGG - Intergenic
1202341741 Y:23876340-23876362 ATGAACAGACACTTCTCAAAAGG - Intergenic
1202529025 Y:25793746-25793768 ATGAACAGACACTTCTCAAAAGG + Intergenic