ID: 987234694

View in Genome Browser
Species Human (GRCh38)
Location 5:15930886-15930908
Sequence GTTGATGCAGAGAGGCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 304}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987234685_987234694 24 Left 987234685 5:15930839-15930861 CCTACTAAGGGTGCCCTCCTCTT 0: 1
1: 0
2: 0
3: 8
4: 100
Right 987234694 5:15930886-15930908 GTTGATGCAGAGAGGCCAGAGGG 0: 1
1: 0
2: 2
3: 36
4: 304
987234689_987234694 10 Left 987234689 5:15930853-15930875 CCTCCTCTTCTGAGGGCATCTGG 0: 1
1: 1
2: 2
3: 29
4: 309
Right 987234694 5:15930886-15930908 GTTGATGCAGAGAGGCCAGAGGG 0: 1
1: 0
2: 2
3: 36
4: 304
987234688_987234694 11 Left 987234688 5:15930852-15930874 CCCTCCTCTTCTGAGGGCATCTG 0: 1
1: 0
2: 2
3: 25
4: 335
Right 987234694 5:15930886-15930908 GTTGATGCAGAGAGGCCAGAGGG 0: 1
1: 0
2: 2
3: 36
4: 304
987234691_987234694 7 Left 987234691 5:15930856-15930878 CCTCTTCTGAGGGCATCTGGAAA 0: 1
1: 0
2: 2
3: 24
4: 290
Right 987234694 5:15930886-15930908 GTTGATGCAGAGAGGCCAGAGGG 0: 1
1: 0
2: 2
3: 36
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987234694 Original CRISPR GTTGATGCAGAGAGGCCAGA GGG Intronic
900536262 1:3179240-3179262 GGTGAGGCAGAGAGGCCAGCAGG + Intronic
900602669 1:3509733-3509755 GTTGGCCCAGAGAGGCCAGGGGG + Intronic
900970850 1:5991906-5991928 GGGGCTGCAGAGAGGCCAGGGGG + Intronic
902776897 1:18680604-18680626 GTAGAGGCAGTGAGGTCAGACGG - Intronic
904316696 1:29670522-29670544 GTTCCTGCAGAGAGGACAGAGGG + Intergenic
904358813 1:29959452-29959474 GGGGATGCCGAGGGGCCAGAGGG - Intergenic
904383106 1:30124689-30124711 GTTCCTGCAGAGAGGACAGAGGG - Intergenic
904479989 1:30787612-30787634 GTTGAAGCAGAGAGGGAAGTGGG - Intergenic
904584386 1:31571823-31571845 GTGGATTTAGAGAGGTCAGATGG - Intergenic
905894999 1:41539966-41539988 ATTGAGGCAGAAAGGCCAGTTGG + Intronic
905942562 1:41875422-41875444 GCAGATGAAGAGGGGCCAGAAGG - Intronic
906419051 1:45648003-45648025 GTAGCTGCAGTGAGCCCAGATGG - Intronic
906784907 1:48606736-48606758 GTAGAAACAGAGAGGCCAGCTGG - Intronic
907325330 1:53634402-53634424 GTTGAGGAAGAGTAGCCAGAGGG + Intronic
907762108 1:57371158-57371180 GTGGATTCAGAAAGACCAGACGG + Intronic
907951766 1:59190011-59190033 TTTGAGGCAAAGAGGACAGAAGG - Intergenic
908429092 1:64038301-64038323 GTGGTGGCAGAGAGGCCAGATGG - Intronic
908756653 1:67474739-67474761 GAGGTTGCAGAGAGGCAAGATGG + Intergenic
909729398 1:78874229-78874251 CTAGATCCAGAGGGGCCAGAAGG + Intergenic
911621755 1:100073239-100073261 ATGGAAGCAGAGAGACCAGATGG - Intronic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
913209149 1:116569291-116569313 TTGGAGGCAGGGAGGCCAGAAGG - Intronic
915081002 1:153352600-153352622 CCTGATGCAGATAGGCCACAAGG + Intergenic
915606126 1:156952322-156952344 GTTCAGACAGAGAGGGCAGATGG + Intronic
917493177 1:175515749-175515771 CTGGATGCAGGTAGGCCAGATGG + Intronic
918920582 1:190704302-190704324 GATGAGGCAGAGAACCCAGAGGG + Intergenic
919624314 1:199896316-199896338 GTGGTTGCAGTGAGCCCAGATGG - Intergenic
920081752 1:203379805-203379827 GTTGTAGGAGAGAGACCAGAGGG + Intergenic
920764432 1:208818191-208818213 GGTGATCCAGAGAAACCAGAGGG - Intergenic
920805022 1:209224865-209224887 GTTGGAGCACAGAGGGCAGAGGG - Intergenic
923452151 1:234128296-234128318 GGTGATGCAGAGACAGCAGAGGG - Intronic
924246712 1:242092610-242092632 GTTGCTGCAGAGGGGACGGAAGG - Intronic
924572187 1:245247031-245247053 GTAAGTGCAGAGGGGCCAGAGGG + Intronic
1064009089 10:11721049-11721071 GATGGTGCTGAGAGGCCCGAGGG - Intergenic
1064919515 10:20501545-20501567 ACTGATGCAGAGAAGACAGAGGG - Intergenic
1067045560 10:42983315-42983337 GTTGCTGCAGCTGGGCCAGAGGG - Intergenic
1067222670 10:44355342-44355364 TTAGATTCAGAGGGGCCAGAAGG + Intergenic
1067441377 10:46310888-46310910 ATGGATCCAGAGAGGCCAAATGG - Intronic
1067749693 10:48962600-48962622 TTTCATGCATAGAGCCCAGATGG - Intronic
1068690141 10:59906220-59906242 CTTGCTGCAGCGAGGCCAGGCGG + Exonic
1069785846 10:70987520-70987542 GTTGATGCAGAGTGGGCAGTGGG - Intergenic
1070139720 10:73730260-73730282 ATTGCTGCAGAGAGCCCGGACGG - Intergenic
1070322964 10:75368178-75368200 GTTGATGCAGAGAGGTTTGAAGG - Intergenic
1070781202 10:79138329-79138351 GTGGGTCCACAGAGGCCAGAAGG - Intronic
1071440051 10:85682082-85682104 CTTGCTGCAGAGAAGCCAGCTGG - Intronic
1071573122 10:86708788-86708810 GTGGATCCAGAGAGGTCTGAGGG - Intronic
1072533151 10:96338684-96338706 GAAGATGCAGAGATTCCAGAGGG + Intergenic
1074288031 10:112116621-112116643 GTCGCTGCAGGGAGACCAGAGGG - Intergenic
1074529583 10:114288128-114288150 GGGGATGCAGAGAGGCCTGTGGG - Intronic
1077959785 11:7063377-7063399 GCTGATGAAGAGGGTCCAGATGG + Intronic
1078471340 11:11589307-11589329 GTTTATTCAGAGAAGCAAGAAGG - Intronic
1079643007 11:22829918-22829940 GTTGCCGCAGAGAGGCGAGGCGG - Intronic
1083464241 11:62834575-62834597 GAGGATGCAGAGACGCCAGAGGG - Intronic
1084693091 11:70738325-70738347 GTTGGTGCACAGAAGACAGAGGG - Intronic
1084744058 11:71156364-71156386 GTTCATCCAGAGATGCCAGCAGG - Intronic
1084981420 11:72830752-72830774 GATGAAGCTGAGAGGCCAGCAGG - Intronic
1085570160 11:77551890-77551912 CTAGATCCAGAGGGGCCAGAAGG + Intronic
1087715767 11:101607014-101607036 GGTGATGCAGAAAGGCTGGATGG - Intronic
1087777482 11:102269465-102269487 GTTGAAGCAGAGAGGAAACATGG + Intergenic
1088114948 11:106303123-106303145 GTTAATCCAGAGTTGCCAGAGGG - Intergenic
1089065633 11:115659896-115659918 GCTGGTGCAGAGAGGAAAGAAGG + Intergenic
1089199354 11:116714462-116714484 GGTGAGGCAGCGAGACCAGAGGG - Intergenic
1089403649 11:118180210-118180232 TTTGAGGCAGAGTTGCCAGAAGG + Intergenic
1089404119 11:118183240-118183262 GTTGATGTGGGGAGGCAAGAAGG + Intergenic
1089608837 11:119658158-119658180 TTGGATGCAGAGTTGCCAGAGGG + Intronic
1092354419 12:7782789-7782811 GATGATGCAGTGAGCCAAGATGG - Intergenic
1092516823 12:9223437-9223459 GGTGATGCAGACAGACCACAAGG - Intergenic
1093742369 12:22703595-22703617 TCTGAAGCATAGAGGCCAGATGG + Intergenic
1094769935 12:33644351-33644373 GCTGATGCATAGTAGCCAGAGGG + Intergenic
1095486447 12:42689701-42689723 GAGGATGCACAGAGGCCAGGAGG + Intergenic
1095568152 12:43650294-43650316 GTCCATGCAGAGAGGCGAGAGGG - Intergenic
1095775582 12:46006033-46006055 GTGTATGCAAAGAGGCCACATGG - Intergenic
1095999064 12:48113875-48113897 CTAGACCCAGAGAGGCCAGAAGG - Intronic
1096144430 12:49268038-49268060 GTTAATTTAGAAAGGCCAGAGGG - Intronic
1097446540 12:59678891-59678913 GTTGATGCCCAAAGCCCAGAGGG + Intronic
1098354895 12:69603167-69603189 GTTTATCCTGAGGGGCCAGATGG + Intergenic
1099032912 12:77550648-77550670 TGTGAAGCAGAGAGGGCAGAAGG + Intergenic
1101598754 12:106190083-106190105 TTTTAAGCATAGAGGCCAGAGGG + Intergenic
1103376056 12:120457000-120457022 GATGATGGAGAGGGGCAAGAAGG - Intronic
1103922677 12:124407241-124407263 GTTGACAAAGACAGGCCAGATGG + Intronic
1107646554 13:42500007-42500029 GTGGAGACAGAGAGGCAAGACGG - Intergenic
1108282104 13:48870876-48870898 CTAGACCCAGAGAGGCCAGAAGG - Intergenic
1109292206 13:60490419-60490441 GTGGAAGCAGAGAGAACAGAGGG + Intronic
1111951191 13:94711062-94711084 GTAGAGGCAGAGAGGCCAGGCGG - Exonic
1113084323 13:106552028-106552050 TTTCATGGAGAGAGGACAGAAGG + Intronic
1114221642 14:20702542-20702564 CTAGACCCAGAGAGGCCAGAAGG + Intergenic
1114771081 14:25429434-25429456 CTAGACCCAGAGAGGCCAGAAGG - Intergenic
1116412035 14:44635599-44635621 GTTGCTGGAGAGAGGCCAGGAGG - Intergenic
1117481589 14:56151148-56151170 GATGCTGCAAAGAGGCCACACGG - Intronic
1117964238 14:61190403-61190425 GTAGAGGCAGAGAGACTAGAAGG - Intronic
1118253421 14:64183838-64183860 GAGGTTGCAGTGAGGCCAGATGG + Intronic
1120196082 14:81484287-81484309 GTTGCTGCTCAGAAGCCAGACGG + Exonic
1121695434 14:95908446-95908468 CTTGATGCTAAGAGGACAGATGG - Intergenic
1122199520 14:100114013-100114035 GCGGAGGCAGAGAGGCCAGTTGG + Intronic
1122354912 14:101117047-101117069 GTTGGGGGAGAGGGGCCAGAAGG + Intergenic
1122370445 14:101226377-101226399 GGGGGTGCAGAGAGGCCAGGGGG + Intergenic
1122485807 14:102078913-102078935 GTGACTGCAGAGAGGCAAGAAGG - Intergenic
1122640343 14:103155876-103155898 TTTGGGGCAGAGAGGCCTGAAGG + Intergenic
1122742700 14:103881279-103881301 GAAGATGGGGAGAGGCCAGAGGG - Intergenic
1124063660 15:26319625-26319647 GGGGATGCAGAGAGGCAAGAGGG + Intergenic
1124806124 15:32884884-32884906 GGTGTTGCTGAGAGGCCAGCTGG - Intronic
1125297862 15:38222176-38222198 TTTGATGGATAGATGCCAGAAGG - Intergenic
1125609018 15:40958446-40958468 ATTGGAGGAGAGAGGCCAGAGGG + Intergenic
1125933403 15:43615816-43615838 GTGGTGGCAGAGAGGGCAGAAGG + Exonic
1125946501 15:43715278-43715300 GTGGTGGCAGAGAGGGCAGAAGG + Intergenic
1125999565 15:44195762-44195784 GCTGGAGCACAGAGGCCAGACGG - Intergenic
1127419405 15:58790422-58790444 GTTGATGCAGTCAGGTCATATGG + Intronic
1127873310 15:63091068-63091090 CTGGGAGCAGAGAGGCCAGACGG + Intergenic
1128555167 15:68626802-68626824 GCTGCTCCAGAGAGGCCAGGAGG + Intronic
1128718218 15:69925869-69925891 TTAGAGGCAGAGAGACCAGAAGG + Intergenic
1129562845 15:76589831-76589853 GGGGATGCAGAGAGCCCACAGGG + Intronic
1130044182 15:80431224-80431246 GAACATGCAGAGAGGACAGAGGG - Intronic
1130444774 15:83990578-83990600 GTTGATGAAGACAGGACAGAAGG - Intronic
1131168318 15:90158834-90158856 GCTGAAGCAGAAAAGCCAGAGGG - Intergenic
1132835175 16:1949625-1949647 GTGGAGACAGAGAGGCCAGCGGG + Intronic
1133202530 16:4212869-4212891 GGTGATGGAGAGAGGAGAGAGGG - Intronic
1133278069 16:4649903-4649925 GCTGATGCAGACAGGCCAGCGGG - Intronic
1133647576 16:7778624-7778646 GTAGATTCACAGAGACCAGAAGG - Intergenic
1134252830 16:12586656-12586678 GTTGAGTAAGAGAGGCCAGACGG - Intergenic
1135597643 16:23755801-23755823 GGTAAGGCAGAGATGCCAGACGG - Intronic
1136360461 16:29776081-29776103 CCTGATTCAGAGAGGTCAGAGGG + Intergenic
1136470063 16:30473955-30473977 TTTTTTGCAGAGAGGCCAAACGG + Intronic
1137400702 16:48152192-48152214 GTAAATGCAGAGAGGTCAGCAGG - Intronic
1137955529 16:52825234-52825256 ATAGAGGCAGGGAGGCCAGATGG - Intergenic
1140253149 16:73312494-73312516 GTTGTTGCCGAGAGGACAGTGGG + Intergenic
1140332802 16:74073910-74073932 GTAGAAGCAGGTAGGCCAGAGGG + Intergenic
1141817769 16:86424724-86424746 GCGGAGGCAGAGAGGGCAGAAGG + Intergenic
1141995416 16:87634086-87634108 GTGGGTGCAGAGAGGCAGGAGGG + Intronic
1142387581 16:89775741-89775763 GCTGCTGAAGAGAAGCCAGAAGG - Exonic
1142558210 17:793900-793922 GCTGGTGCAGAGAGGACAGGCGG + Intergenic
1142754112 17:2005558-2005580 GTACATCCAGAGAGGCCACAGGG + Intronic
1143010314 17:3862421-3862443 CGTGATGTAGGGAGGCCAGAGGG - Intronic
1143500781 17:7337253-7337275 GATGAGGCAGACAGACCAGATGG + Intronic
1143556949 17:7667963-7667985 CTGGATGGAGAGAGGCCAGTGGG - Intronic
1144554653 17:16271313-16271335 TTTGATGAAGAGAAGCCTGAGGG - Intronic
1144633511 17:16888373-16888395 GTTGATGTTGACAGCCCAGAAGG - Intergenic
1146658081 17:34646883-34646905 GTGGATGGAGAGAGGCCTGTCGG + Intergenic
1147539010 17:41341177-41341199 GTTGTAGAAGACAGGCCAGATGG - Intergenic
1147842695 17:43383253-43383275 GTTGAGGCAGAAAGGCCTGAAGG + Intergenic
1147988963 17:44321877-44321899 GTAGAGGCAGGGAGGCCTGAGGG - Intronic
1148338137 17:46855204-46855226 GTGGCTGCAGAGAGGCCGAAGGG + Intronic
1150634412 17:66902771-66902793 GTTGATGCAGACAAAGCAGAGGG - Intergenic
1151291640 17:73155031-73155053 GAGGTTGCAGTGAGGCCAGATGG + Intergenic
1151440865 17:74128249-74128271 GCAGATGCTGAGAGGCGAGATGG + Intergenic
1152109657 17:78350800-78350822 GAAGTTGCAGAGAGCCCAGATGG - Intergenic
1152639701 17:81444456-81444478 CATGATGCAGAGCGGCCAGCTGG + Exonic
1152795564 17:82304509-82304531 CTTGGTGCTCAGAGGCCAGAGGG - Intergenic
1155245336 18:23903104-23903126 GCTGATGGAGAAAAGCCAGAAGG + Exonic
1155763893 18:29603378-29603400 GTTGCTACAGAGAGACCATATGG - Intergenic
1156036013 18:32769585-32769607 GTAGAGCCAGAGAGGCCGGAGGG - Intronic
1156379030 18:36540769-36540791 CTGGAAGCAGAGATGCCAGATGG - Intronic
1159879047 18:73840607-73840629 GTTGAGGCAGAGAAGTCAGAGGG + Intergenic
1159906447 18:74097077-74097099 GTGGATCCAGAGAGCCCACAGGG - Intronic
1159929186 18:74294423-74294445 CTAGACCCAGAGAGGCCAGAAGG + Intergenic
1160558660 18:79742235-79742257 GTTGGTGGAGAGAGGCCTGAGGG + Intronic
1160910758 19:1472778-1472800 CCTGGTGCAGAGAGGCCAGGTGG - Exonic
1161400110 19:4063507-4063529 GGTGAGGCAGGGAGGCGAGAGGG + Intronic
1161727173 19:5936249-5936271 CCTGATGCACAGAGGACAGAGGG + Intronic
1162262175 19:9542177-9542199 CTAGAACCAGAGAGGCCAGAAGG + Intergenic
1164161282 19:22627143-22627165 GGGGATGCAGAGAGCCCAGCAGG - Intergenic
1164258726 19:23551224-23551246 CTAGACCCAGAGAGGCCAGAAGG + Intronic
1164609247 19:29621089-29621111 GTGGATGCAGGGAGGCCAGCGGG - Intergenic
1164833574 19:31341373-31341395 GTAGGTGCACAGAGGCCTGATGG + Intronic
1165151978 19:33766370-33766392 GTTGGGGGAGAGAGGCCTGAGGG - Intronic
1167485202 19:49758671-49758693 ACTGAGGCAGGGAGGCCAGAGGG - Intronic
1167564837 19:50249657-50249679 GTTGATGCAGAGCTGCTCGAAGG - Exonic
1167605462 19:50479505-50479527 GGTCATGCAGAGAGGCCCCAGGG + Intronic
926340148 2:11898657-11898679 GGTGAGGGAGAGAGGCCACAGGG + Intergenic
926389042 2:12368597-12368619 GTTGGAGAACAGAGGCCAGATGG + Intergenic
926489830 2:13511706-13511728 GTTGATGCAGAGGGTACACAAGG - Intergenic
926609835 2:14935752-14935774 GCTGAGGCAGACAGACCAGAGGG - Intergenic
927293851 2:21430848-21430870 GTTGTTGCAGTGAGCCAAGATGG + Intergenic
927880722 2:26688260-26688282 GCTGCTGCAGAAAGCCCAGAAGG - Intergenic
927943812 2:27122716-27122738 GTAGAAGCAGAGAGGCCACTGGG - Intergenic
930231213 2:48845582-48845604 TTTGATTCAGACAGGCCAAAGGG + Intergenic
930952568 2:57161053-57161075 GCTAATGCAGAGGGCCCAGATGG + Intergenic
931246135 2:60494227-60494249 GGTGATGCTGACAGGCCACATGG + Intronic
931684883 2:64784597-64784619 GTTGAAGCAGGGAGGCCAGTGGG + Intergenic
931721079 2:65068235-65068257 GTTGATGCTGAGAGCCCTGGTGG - Intronic
933137897 2:78759858-78759880 CTAGACCCAGAGAGGCCAGAAGG + Intergenic
935080592 2:99789575-99789597 GGGGATGCAGAGAGGCCTGGTGG - Intronic
936015245 2:108953866-108953888 GTTGAACCAGACAGGTCAGAGGG + Intronic
937140443 2:119595676-119595698 GTTGGAGCAGAGATGCCAGTCGG + Intronic
937451360 2:122004499-122004521 CTTGAGGAAGAGGGGCCAGAAGG - Intergenic
938067373 2:128288447-128288469 GTTAATGCAGAGTCCCCAGAAGG - Intronic
940182903 2:150955024-150955046 TTGGACCCAGAGAGGCCAGAAGG + Intergenic
941102001 2:161307104-161307126 GATGTTGCAGTGAGCCCAGATGG + Intergenic
941244159 2:163075999-163076021 GTTGATGCAGAGTTAGCAGAAGG + Intergenic
941748990 2:169116072-169116094 GCTGTTGCAGAGAGGGGAGAGGG - Intergenic
943785645 2:191875578-191875600 GTTGAAGCAGAGAGGCAGGGTGG + Intergenic
944825941 2:203483253-203483275 GTGAATGCAGAAAGACCAGAAGG + Intronic
945254704 2:207793828-207793850 GAAGATGCACAGAGGACAGAAGG + Intergenic
946073647 2:217055488-217055510 GATGATGCAGAGAGGCTAAGGGG + Intergenic
946443020 2:219712899-219712921 GTGTAGGCAGAGAGGTCAGATGG + Intergenic
947148056 2:227086547-227086569 TTTAATGCAGAGAAGCCATATGG + Intronic
947871539 2:233441436-233441458 GGTGATGCAGGCAGCCCAGAGGG + Intronic
1170434723 20:16314761-16314783 GTGGATGCAGAGAGGCCACAAGG - Intronic
1170915896 20:20625116-20625138 GTGGGTGCAGATAGGCCAGCTGG - Intronic
1171203298 20:23258881-23258903 GTGGCTGCAGAGAAGTCAGATGG - Intergenic
1171371493 20:24665224-24665246 GTTGATGCAGAGAAGGCTGAGGG - Intronic
1172234350 20:33360067-33360089 CTCGCTGCAGAGAGGCCAGGAGG - Intronic
1172706624 20:36886961-36886983 GTGGATGCAGAGGGACCAGCTGG + Intronic
1174065243 20:47860023-47860045 GTGGCTGCAGAGAGGCAGGATGG - Intergenic
1174820376 20:53721692-53721714 GTTGCTACAGAGAGGCCAGGTGG - Intergenic
1178432712 21:32530595-32530617 GTTGATGCAGAGATTCCTGGAGG + Intergenic
1179545456 21:42110116-42110138 GAAGCTGCAGAGAGGCCCGATGG + Intronic
1179632366 21:42686431-42686453 GTGGAGGCAGAGAGGCCCGGAGG - Intronic
1179907952 21:44433937-44433959 GTGGAGGCAGGGAGGCCAGCTGG + Intronic
1181365803 22:22376212-22376234 GGAGATGCAGAGAGGGAAGACGG - Intergenic
1182318538 22:29463695-29463717 TTTGCTGGAGAGAGCCCAGAGGG + Intergenic
1182484111 22:30629078-30629100 GGTGATGCAGAGAGGCTTTACGG - Intergenic
1184514648 22:44954616-44954638 ATTGCTCAAGAGAGGCCAGATGG - Intronic
949950518 3:9225267-9225289 TTGGGTGCAGAGAGACCAGATGG - Intronic
953405059 3:42655888-42655910 TTTCCTGCTGAGAGGCCAGAGGG + Intronic
953484766 3:43285469-43285491 GTTGATGCATAGAAGCTAAAAGG + Intergenic
954305301 3:49722410-49722432 GGTGAGGCAGGGAGGCCACAGGG - Exonic
954433030 3:50481372-50481394 GTTGATCCAGACAGGCCATCTGG - Intronic
954609132 3:51935044-51935066 GATGAGGCAGAGAGCTCAGATGG - Intronic
954757605 3:52849971-52849993 GCTGATGCAGGGTGGCCTGAGGG + Intronic
956035838 3:65090336-65090358 CTTGATTCAGACAGGCCTGAGGG - Intergenic
956702720 3:71972896-71972918 GTAGATGCAGGGAGCCCAGAAGG - Intergenic
959211115 3:103382219-103382241 GTGGATGGACAGAGGCCATAAGG - Intergenic
959502095 3:107118397-107118419 ATTGCTGCAGTAAGGCCAGAGGG - Intergenic
959943103 3:112100117-112100139 GATGAGGCAGAGAGGCCAACAGG - Intronic
960979569 3:123210212-123210234 GTGGAAGCAGAGAGGTCAGATGG + Intronic
961465596 3:127079072-127079094 GTGGAGGCAGAGAGGCCAGTAGG - Intergenic
961538816 3:127586820-127586842 CTTGAGGCACAGAGGCCAGTGGG + Intronic
961745948 3:129063453-129063475 GTTCTTCCAGAGAGGTCAGAAGG + Intergenic
962374056 3:134845909-134845931 GTGTAAGCAGAGGGGCCAGAGGG - Intronic
962467294 3:135672753-135672775 GTTAATGCAGCCAGGGCAGATGG + Intergenic
964609340 3:158594572-158594594 GTGGAGGCAGGGAAGCCAGAAGG + Intronic
966014339 3:175122700-175122722 GTGAGTGCAGTGAGGCCAGAGGG - Intronic
966228752 3:177627456-177627478 TTTGATGCAGAGGTGCCAAAGGG - Intergenic
967125604 3:186421316-186421338 GTTGTTGCAGTGAGCCAAGATGG - Intergenic
968426463 4:526639-526661 GTGGATGCCCAGAGGCCAGGCGG - Intronic
969365199 4:6690132-6690154 GGAGAAGCAGAGAGGCCAGGAGG - Intergenic
970389019 4:15588548-15588570 GTTTATCCAAAGAGGCCACAAGG + Intronic
971571609 4:28218876-28218898 GAAGATGCAGTGAGCCCAGATGG + Intergenic
971681979 4:29711660-29711682 ATTGATGAAGAGATGCCAGAGGG + Intergenic
972172585 4:36364805-36364827 TTGGAAGCAGAGAGGCCAAAAGG + Intergenic
972574092 4:40335823-40335845 GTAGCTGCAGAGACGGCAGATGG + Exonic
972858373 4:43136288-43136310 GTTGATGTGGGGAGCCCAGAAGG + Intergenic
973133298 4:46675070-46675092 GTTGATGCAGGAAGTCTAGAGGG + Intergenic
976657095 4:87500183-87500205 GTTGTTGCTAAGAGGTCAGATGG - Intronic
978362388 4:107945129-107945151 GATGATGGAGAAAGGGCAGAAGG - Exonic
978839648 4:113196173-113196195 TTTGATTCAGAGAGGCAATAAGG - Intronic
980671098 4:136008459-136008481 GTTGGTGCCCAGAGTCCAGAGGG - Intergenic
982774380 4:159427198-159427220 GATGATGCAGATAGGCGACAGGG + Intergenic
984801886 4:183723337-183723359 GGTGGGGCAGAGAGGCCAGGTGG - Intergenic
984801892 4:183723355-183723377 GATGCAGCAGAGAGGCCAGGTGG - Intergenic
985828716 5:2212729-2212751 GAGGAGGCAGAGAGGCCAGAGGG + Intergenic
985956433 5:3269249-3269271 GTTAGTGAAGAGAGGCAAGAGGG + Intergenic
986015187 5:3751487-3751509 GTTGATGAAGGAAGGCGAGAAGG + Intergenic
986625186 5:9717041-9717063 GTGGATGCAGAGAGCAGAGAGGG + Intergenic
987234694 5:15930886-15930908 GTTGATGCAGAGAGGCCAGAGGG + Intronic
988988870 5:36649789-36649811 GTTGGTGTAGAGAGAGCAGAAGG + Intronic
989105865 5:37862384-37862406 GTAGCTCCAGAGAGGCCAGCGGG - Intergenic
989615185 5:43331695-43331717 CTAGACCCAGAGAGGCCAGAAGG - Intergenic
990085225 5:51968542-51968564 GTTGATGTAAAGAGGCCATGTGG - Intergenic
990134819 5:52632329-52632351 GTTGCTGGAGGGAGGCCATATGG - Intergenic
992049425 5:72929274-72929296 GGTGGTTCAGAGAGGACAGAGGG + Intergenic
992844152 5:80728252-80728274 GATGAAGCAGTGAGACCAGATGG + Intronic
993152156 5:84174581-84174603 GTTGATGCAGAGAGGGTCCAAGG + Intronic
993411901 5:87584459-87584481 ATTAATGCAGAGAAGCCATAGGG + Intergenic
994057459 5:95434366-95434388 GTTGCTGGAGAAAGGCCACATGG - Intronic
995998305 5:118326999-118327021 GTCTATGCAGAGAGCACAGATGG - Intergenic
998006998 5:138663653-138663675 GATGAGGCAGAGAGGGCAGAGGG - Intronic
998960800 5:147484303-147484325 GCTGAGGCAGGAAGGCCAGATGG - Intronic
999467519 5:151821849-151821871 GTTGAAGCACAGAAGCAAGAGGG + Intergenic
999774565 5:154802030-154802052 GCTGAGGCAGAGAGGTCAGGTGG - Exonic
1000606894 5:163336003-163336025 CTAGACCCAGAGAGGCCAGAAGG + Intergenic
1001089610 5:168727663-168727685 TTTCATGCAGGGAGGGCAGAGGG - Intronic
1001124180 5:169004513-169004535 CGTGATGCAGAGAGGAGAGAAGG + Intronic
1002329377 5:178430983-178431005 GTGGAGGAAGAGATGCCAGAGGG + Intronic
1002439172 5:179255529-179255551 GTGGAGGCAGAGAGGGAAGATGG - Intronic
1002897452 6:1388043-1388065 GTAGATGCAGAGAGGGCGGGTGG - Intergenic
1003725664 6:8760123-8760145 GAGGTTGCAGAGAGCCCAGATGG + Intergenic
1003761779 6:9186670-9186692 GTGAATGCTGAGAGACCAGAAGG + Intergenic
1004434132 6:15574122-15574144 GGTGATGCAGAGAATCCACATGG - Intronic
1004527884 6:16426296-16426318 GAAGGTGCAGAGAGGACAGAAGG + Intronic
1007202411 6:40121138-40121160 GGGGATGCAGAGAGGCCAAAGGG - Intergenic
1007725593 6:43913886-43913908 AAGGCTGCAGAGAGGCCAGAGGG + Intergenic
1007754551 6:44090445-44090467 GTGGAGGCAGAGTGGGCAGAGGG + Intergenic
1008143474 6:47859902-47859924 GTTGATGCAGAGAGAACAAAGGG + Intergenic
1008221691 6:48862313-48862335 GATGAGGCATAGAGGGCAGAAGG - Intergenic
1009463305 6:63940349-63940371 GTTGCTGCAGCTAGGCCAGCGGG + Intronic
1012445844 6:99306394-99306416 ATTCATGGAGAGAGGTCAGAGGG + Intronic
1012450843 6:99350900-99350922 TTTCAAGGAGAGAGGCCAGAAGG + Intergenic
1013756496 6:113467846-113467868 GTTGATGCAAAGAGTGAAGAAGG + Intergenic
1015077881 6:129184563-129184585 CTTGTTGAAGACAGGCCAGAGGG - Intronic
1017354637 6:153489052-153489074 GTTGCTGCTGAGAGCCCAGCAGG - Intergenic
1019214229 6:170432947-170432969 GCAGATGCAGAGAGCTCAGAGGG + Intergenic
1020093570 7:5355116-5355138 CTAGCTGCAGGGAGGCCAGAAGG - Intronic
1020460756 7:8427090-8427112 GTAGTTGAAGAGGGGCCAGATGG + Intergenic
1020936202 7:14466850-14466872 GTTTATATAGAGAGGCTAGATGG + Intronic
1021113446 7:16722367-16722389 GTTGATTCAAAGAGGTCAGAAGG - Intergenic
1021952100 7:25785296-25785318 ATTGATGCTGAAAGTCCAGATGG - Intergenic
1022180295 7:27912551-27912573 GGTGATGCAGAGAGGGAGGAAGG + Intronic
1022371633 7:29777072-29777094 GTGGAGGCAGAGAGACCAGTTGG + Intergenic
1022974383 7:35544164-35544186 TATGATGCAGACAGGCTAGAGGG - Intergenic
1024709232 7:51996355-51996377 GAACATGCACAGAGGCCAGAAGG - Intergenic
1025850029 7:65237657-65237679 GGTGATGGAGAGAGCCCAGCAGG + Intergenic
1027953532 7:84850796-84850818 GTTTATGCAGAGAGGGTACATGG + Intergenic
1030283300 7:107799135-107799157 GTTGATTAAGAGAGCTCAGAAGG + Intronic
1030563081 7:111115730-111115752 GTGGCTGCAGTGAGCCCAGATGG - Intronic
1032986937 7:137347409-137347431 GTGGAAGCAGAGAGCCCAGTAGG + Intergenic
1033455263 7:141497263-141497285 TTCTATGCTGAGAGGCCAGAAGG + Intergenic
1034254614 7:149717695-149717717 GTAGATGCAGCCTGGCCAGAGGG + Intronic
1036706366 8:11049886-11049908 TCTGCTGCAGAGAGGCTAGAAGG + Intronic
1036961095 8:13245233-13245255 GTTGATGCAGACACCCCAGTGGG - Intronic
1037150189 8:15626786-15626808 GTTTATGCCGAAAGTCCAGAGGG - Intronic
1037814021 8:22102539-22102561 CTTGATGCAGAGAATCCAGAGGG + Exonic
1039105097 8:33981721-33981743 CTTGATGCACAAAGTCCAGAGGG + Intergenic
1039358430 8:36847063-36847085 GTTGATGCAGAGGTGACAGAAGG - Intronic
1039765418 8:40623171-40623193 GTGGATGCTAAGAGGGCAGAGGG + Intronic
1040325360 8:46338845-46338867 GTAGAAGCAGACAGGCCACAGGG + Intergenic
1041658350 8:60376509-60376531 GTAGATGCAGAAAAGGCAGAGGG + Intergenic
1042255155 8:66795243-66795265 GTTAAGGAAGAGAGGACAGAGGG - Intronic
1043502417 8:80871145-80871167 GTAGAGGCAGGGAGGCCAGTTGG - Intronic
1047448723 8:124943340-124943362 CTGGATGCAGAGAGACCAGCTGG - Intergenic
1048102208 8:131365088-131365110 ATTGATACACAGAGGACAGAGGG - Intergenic
1048115489 8:131517215-131517237 GTTGAAGCAGAGATCCAAGAGGG - Intergenic
1048267359 8:132999222-132999244 GATGGTGCAGAGAGGACAGGCGG + Intronic
1048534298 8:135277991-135278013 GATGTATCAGAGAGGCCAGAGGG - Intergenic
1049359242 8:142204140-142204162 GCGGATTCAGAGAGGCCAGGAGG + Intergenic
1049377026 8:142294142-142294164 GAGGATGCAGAGTGGCCAGAGGG + Intronic
1051334649 9:16054974-16054996 GTGGATGCAGAGAGGCCAGTTGG + Intronic
1051501103 9:17778664-17778686 GTGGAAGCAGGGAGGCCAGCAGG + Intronic
1052965505 9:34337735-34337757 GCTGATGCAGAGAGGGCAGCTGG - Intronic
1060458177 9:123820413-123820435 CTGAATGCAGAGAGGCCACATGG + Intronic
1061636641 9:131914767-131914789 GTGGAGGCAGAGAGGCCAGTTGG + Intronic
1062546353 9:137065285-137065307 GATGCTGCAGAGAGCCTAGAGGG + Intronic
1062732292 9:138116960-138116982 GTGGACGCAGAGATGGCAGAAGG - Intronic
1185954900 X:4478486-4478508 GAGGATGAAGAGAGGCCATAGGG + Intergenic
1187203689 X:17160716-17160738 GGTGAAGCTGAGAGCCCAGAAGG + Intergenic
1192580613 X:72278015-72278037 GTTCAAGCAGAGAAGCAAGAGGG - Intronic
1193657075 X:84211436-84211458 GAGGTTGCAGTGAGGCCAGATGG - Intergenic
1195304954 X:103572907-103572929 CTTGATGCTGAAAGGCTAGATGG + Intergenic
1197829862 X:130630132-130630154 ATTCATTCAGAGAGGCAAGATGG - Intronic
1198229767 X:134677824-134677846 GTTGAAGCAGGGAGACCAGTTGG + Intronic
1198972321 X:142296281-142296303 GTGGATGCTAAGGGGCCAGATGG + Intergenic
1199703580 X:150404683-150404705 GATGATGGAGAGGGGCCAGAGGG - Intronic
1201236312 Y:11915341-11915363 TTCCAAGCAGAGAGGCCAGAAGG - Intergenic