ID: 987235319

View in Genome Browser
Species Human (GRCh38)
Location 5:15936404-15936426
Sequence GCTCAGAGCAACCTGCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987235319_987235321 1 Left 987235319 5:15936404-15936426 CCTGCTGGCAGGTTGCTCTGAGC 0: 1
1: 0
2: 2
3: 16
4: 214
Right 987235321 5:15936428-15936450 TGTGTTCTGTCTCTTTGTGCAGG 0: 1
1: 0
2: 1
3: 31
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987235319 Original CRISPR GCTCAGAGCAACCTGCCAGC AGG (reversed) Intronic
901936648 1:12631338-12631360 GCTCAGAGGAAACTGGCAGGGGG - Intergenic
903731884 1:25502497-25502519 GCTCACTGCAACCTGCCTTCTGG - Intergenic
906655829 1:47547900-47547922 GTTCAGAGCAAGCTGACAGCTGG - Intergenic
906655954 1:47548443-47548465 GTTCAGAGCAAGCCGACAGCTGG + Intergenic
909042919 1:70675467-70675489 GCACAGAGCTGCCTGCCATCAGG - Intergenic
911105294 1:94125845-94125867 GCTGAGTGGAAGCTGCCAGCAGG + Intergenic
913479537 1:119274365-119274387 GCTTAGAGCTACTTGACAGCTGG + Intergenic
915165606 1:153946327-153946349 CCTCCGAGCCACCCGCCAGCGGG - Exonic
916822106 1:168409868-168409890 GCTCCCAGCAACCTGACAGTGGG - Intergenic
922584297 1:226722192-226722214 GTTCCTAGCAACCTGCCACCTGG + Intronic
924304009 1:242668352-242668374 GCCCAAAGCAACCTGTCAACTGG + Intergenic
1063063706 10:2587310-2587332 GCTCACTGCAACCTGCCTCCTGG + Intergenic
1063119971 10:3098598-3098620 GCTCACTGCAACCTGCCTCCCGG - Intronic
1064686754 10:17869647-17869669 GCTCAGAACTCCCTGCCAGATGG + Intronic
1067831118 10:49611554-49611576 GCTCGGGCCAACCTGCCAGTGGG + Exonic
1068629626 10:59285883-59285905 TCTCAGATCAAGGTGCCAGCAGG - Intronic
1069562356 10:69439633-69439655 TCTCAGAGCCATCTGCCTGCAGG - Intergenic
1070830938 10:79417806-79417828 GCTCAGAGAAACGGGGCAGCAGG - Intronic
1070968202 10:80542927-80542949 GCTCAGAGCACTCTGCTGGCTGG - Intronic
1071085977 10:81869240-81869262 GCTCACTGCAACCTGCCTCCTGG - Intergenic
1071856694 10:89633008-89633030 GCTCAGAGAAAAGTCCCAGCAGG - Intronic
1076217914 10:128710804-128710826 GGTCAGAGCTACTGGCCAGCTGG + Intergenic
1077097050 11:803524-803546 GCCCTGACCAACCTGCCCGCTGG - Exonic
1077250994 11:1560637-1560659 GCTCAGGGGAACCTGCAAGCTGG - Intronic
1081775162 11:45671420-45671442 GCTCATCCCCACCTGCCAGCAGG - Intergenic
1082620238 11:55411508-55411530 TCACAGAGCCACCTCCCAGCAGG - Intergenic
1083312247 11:61790037-61790059 GCTCAGAGCAGCCAGGCAGAGGG + Intronic
1084171182 11:67401716-67401738 GCCCCGACCAACCTTCCAGCAGG + Exonic
1084352869 11:68615844-68615866 GCTCAGAGTGAGCTGCCTGCGGG - Intergenic
1084654913 11:70509500-70509522 ACTCAGAGCTACATGCCAGCTGG - Intronic
1085453050 11:76648407-76648429 GCTCAGAGCAGCCTTGGAGCAGG - Intergenic
1085530216 11:77187959-77187981 GCCCAGGGCCACCTGCCAACAGG + Intronic
1089293098 11:117450223-117450245 GCTCAGAGGAAGCTCCCAGCAGG - Intronic
1091648534 12:2292009-2292031 GCTCAGAGCAGCCTGAGACCTGG - Intronic
1091708868 12:2722955-2722977 GAGCAGAGCAACTTGCCAGAGGG - Intergenic
1092807448 12:12237609-12237631 TCTCAGGGCATCCTGTCAGCAGG - Intronic
1092906294 12:13102970-13102992 GATCAGAGCTGCCTTCCAGCAGG + Intronic
1093075084 12:14749796-14749818 GCTCACTGCAACCTGCCTCCCGG + Intergenic
1096227351 12:49874652-49874674 GCTCAGAGCCACCCGCAGGCAGG + Intronic
1096870039 12:54587548-54587570 GCTCAGAGCAGCCTGGCAGAGGG - Intronic
1097647704 12:62256595-62256617 GCTCAGTGCCACTTGCTAGCTGG - Intronic
1098992440 12:77078544-77078566 TCTAAGAGCAACATGCCAGCAGG - Intergenic
1100507225 12:95234358-95234380 GCTCACCGCAACCTCCCCGCCGG + Intronic
1102589134 12:113944170-113944192 GCTCATTGCAACCTGCCTCCTGG + Intronic
1102624544 12:114224584-114224606 TCACACAGCCACCTGCCAGCTGG - Intergenic
1103731800 12:123032860-123032882 GCTCAGAGCAAACAGCCCCCCGG + Intronic
1103737119 12:123067664-123067686 TCTCAGATCAAGCTGTCAGCAGG - Intronic
1104719812 12:131039025-131039047 GCTCAGAGGGAACTGCCTGCGGG + Intronic
1106587577 13:31070588-31070610 GCTCAGAGCAGACTTCTAGCAGG - Intergenic
1108968480 13:56341957-56341979 GCACAGAGCCAGCTGCCAGTGGG + Intergenic
1109859131 13:68173959-68173981 CCCCAGAGCAACCTGCAAGAGGG - Intergenic
1111358813 13:87146527-87146549 GCCTAGTGCAAGCTGCCAGCAGG - Intergenic
1112829716 13:103434268-103434290 GCTGAGATCAAGGTGCCAGCAGG + Intergenic
1113330195 13:109319330-109319352 ACTCGGAGCGGCCTGCCAGCGGG - Intergenic
1114322821 14:21561206-21561228 GCTAAGAGCAATGTGCTAGCAGG - Intergenic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1119137799 14:72236786-72236808 GCTCAGCGCCCCCTGCCATCTGG - Intronic
1120587346 14:86329394-86329416 GCTCACAGTAGCCTGCCATCAGG - Intergenic
1121017311 14:90556604-90556626 GCACAGAGCAGCCTGGAAGCTGG + Intronic
1122050864 14:99058785-99058807 GCTCAGAGCAGCTTTTCAGCAGG - Intergenic
1123130465 14:105981630-105981652 CCTAAGATCAAGCTGCCAGCTGG + Intergenic
1123409987 15:20050169-20050191 CCTAAGATCAAGCTGCCAGCTGG - Intergenic
1123519319 15:21056876-21056898 CCTAAGATCAAGCTGCCAGCTGG - Intergenic
1123580703 15:21712851-21712873 CCTAAGATCAAGCTGCCAGCTGG + Intergenic
1123617352 15:22155474-22155496 CCTAAGATCAAGCTGCCAGCTGG + Intergenic
1126357920 15:47815700-47815722 CCTCAGAACTACCTGTCAGCAGG - Intergenic
1128071871 15:64802285-64802307 GCTCAGAGCCTCCTGCCACTGGG + Intergenic
1128341033 15:66822684-66822706 CCTCACAACAACCTGCCAGGGGG - Intergenic
1128481655 15:68045490-68045512 GAGCTGAGCCACCTGCCAGCAGG + Intergenic
1128510636 15:68312030-68312052 GCTGAGGGCAAGCTGACAGCTGG - Intronic
1129184756 15:73899316-73899338 GCTCACAGGAAGCTGCCATCTGG + Intergenic
1129849277 15:78782681-78782703 GCTGAGAGCCAACTGCCTGCAGG + Intronic
1130994162 15:88894991-88895013 GCTGAGGGCAACCTGCGAGGCGG - Intronic
1131341886 15:91610141-91610163 TCTCAGCTCAGCCTGCCAGCTGG - Intergenic
1132336248 15:101050393-101050415 TCCCAGAGCAGCCTGCCAGGGGG + Intronic
1202989573 15_KI270727v1_random:447096-447118 CCTAAGATCAAGCTGCCAGCTGG + Intergenic
1132468457 16:88820-88842 GCGCAGAGCTACTTCCCAGCGGG - Exonic
1132591058 16:726691-726713 GCTCAGGGCATCCTGCGGGCGGG - Intronic
1132656493 16:1043822-1043844 GCCCAGAGCTCCCTGCCGGCCGG - Intergenic
1132975893 16:2711053-2711075 GCTCTGAGCCATCTGCCAGGTGG - Intergenic
1133094650 16:3434430-3434452 CCTCAGAGAAACCTGGAAGCTGG + Exonic
1136373161 16:29848620-29848642 GCTGAGAGCTACCAGGCAGCTGG - Intergenic
1136403718 16:30031432-30031454 GCTCAGGGCCCCCTCCCAGCTGG - Intronic
1137454456 16:48607934-48607956 GCTCACTGCAACCTGCCTTCCGG + Intronic
1139075409 16:63440927-63440949 GATCGAAGCAACCTGCAAGCAGG - Intergenic
1139393951 16:66624870-66624892 GCTCAGACGCATCTGCCAGCAGG + Intronic
1142016391 16:87750431-87750453 GACCTGAGCAACCTGGCAGCAGG + Intronic
1142311356 16:89315964-89315986 GCCCAGAGCAACCGGCAACCAGG + Intronic
1142380634 16:89730022-89730044 GCTCAGAGCCACCTGCCCTCTGG - Intronic
1142795776 17:2305770-2305792 GCTCACTGCAACCTGCCTCCTGG + Intronic
1143919213 17:10317597-10317619 GCTCAGAGCACCCTGCAAGGAGG + Intronic
1144492678 17:15728034-15728056 GCTCACTGCAACCTGCCTACCGG + Intergenic
1144509870 17:15866866-15866888 GCTCACTGCAACCTCCCTGCCGG + Intergenic
1144945152 17:18965959-18965981 GCTCATAGCATCCTACCAGGTGG - Intronic
1146190071 17:30757117-30757139 GCTCACTGCAACCTCCCACCTGG - Intergenic
1146386114 17:32375044-32375066 GCTCAGAGTAAACTGCTATCTGG - Exonic
1147421440 17:40323914-40323936 TCCCAGGGCAAACTGCCAGCAGG - Intronic
1147527123 17:41236244-41236266 GCTCAGAGCATCCTTCCTGAAGG + Intronic
1147528251 17:41247906-41247928 GCTCAGAGCATCCTTCCTGAAGG + Intronic
1147528721 17:41253271-41253293 GCTCAGAGCATCCTTCCTGAAGG + Intronic
1150008315 17:61483256-61483278 GCTCAGAGCTCCCAGCCACCAGG + Exonic
1151598860 17:75094174-75094196 GTTCAGAGAGACCAGCCAGCTGG - Intronic
1152390519 17:80001465-80001487 GCCCAGCGCAGCCTGGCAGCCGG - Intronic
1152428061 17:80229502-80229524 GCTCACTGCAACCTGCCTCCTGG + Intronic
1152673157 17:81621398-81621420 GCTCACAGCCAACTGCCAGCAGG + Intronic
1152876724 17:82790538-82790560 GCTGAGAGCCACCTGCCACCTGG - Intronic
1155178684 18:23324253-23324275 GCCAAGAGCAAGGTGCCAGCAGG - Intronic
1155374132 18:25137582-25137604 GCTCAGAGGAAAATGTCAGCAGG + Intronic
1156887953 18:42157610-42157632 GCTCTCAGCAAGTTGCCAGCTGG - Intergenic
1157227466 18:45880212-45880234 GCTCCGCGGAGCCTGCCAGCAGG + Exonic
1157595583 18:48861688-48861710 GCTCAGAGCAAGCTTCACGCAGG + Exonic
1158026315 18:52901355-52901377 GCTCATAGCAACCTGTCTCCTGG - Intronic
1160008855 18:75088775-75088797 GCTCAGAGCAACTGGACACCGGG - Intergenic
1160455539 18:78996410-78996432 TCCCAGGGCCACCTGCCAGCAGG - Intronic
1162683095 19:12361801-12361823 GCTCACTGCAACCTCCCTGCTGG + Intronic
1164509054 19:28882784-28882806 GCTCAGAGCAATGTGCCAGCTGG + Intergenic
1167116517 19:47492149-47492171 GCTCAGGGCAAGCAGCCAGAGGG + Intronic
925141981 2:1557205-1557227 ACTCTGAGCATCCTGCAAGCAGG - Intergenic
925340467 2:3132125-3132147 GCTCAGAGGTACCTGCCAGCCGG + Intergenic
925865067 2:8220114-8220136 GCACAGAGCGGCCGGCCAGCGGG - Intergenic
925919313 2:8628278-8628300 GCTCCGAGCTCCCTCCCAGCAGG + Intergenic
926961831 2:18365495-18365517 CTTCAGTGCAAGCTGCCAGCAGG + Intergenic
927777792 2:25915588-25915610 ACTCAGAGCAGCCGGCCGGCTGG + Intergenic
928263610 2:29789988-29790010 CTTCAGAGCTGCCTGCCAGCTGG - Intronic
930755487 2:54968291-54968313 CCTCAGAGTAACCTCCCTGCAGG + Intronic
931005857 2:57849773-57849795 GCTGAGAGCAACTTGGCAGCTGG - Intergenic
931127380 2:59293105-59293127 GCTCAGCAGAACCTGCCAGCAGG + Intergenic
942069471 2:172303393-172303415 GCTCAGAGCTGCCAGCCACCTGG + Intergenic
947575706 2:231272588-231272610 GCTCACTGCAACCTGCCTCCTGG + Intronic
948146503 2:235712095-235712117 GCTCACTGCAACCTGCCTCCTGG + Intronic
948220335 2:236264477-236264499 GCGGAGGGCCACCTGCCAGCAGG + Intergenic
948254579 2:236556627-236556649 GCTGAGATCAATGTGCCAGCAGG - Intergenic
948371898 2:237494973-237494995 CCTCAGAGCTACATTCCAGCTGG + Intronic
948449132 2:238058131-238058153 ACTCGGAGCGGCCTGCCAGCCGG - Intronic
1169029309 20:2395589-2395611 GGTCAGAGAAACCTGGTAGCAGG + Intronic
1169713494 20:8590584-8590606 GCTAAGATCAAGGTGCCAGCAGG + Intronic
1170114294 20:12839816-12839838 CCTCATAGCAACCTGTGAGCTGG - Intergenic
1170806868 20:19639907-19639929 ACTCGGAGCAGCCGGCCAGCCGG - Intronic
1172754658 20:37274616-37274638 GCTCACTGCAACCTGCCTCCCGG - Intergenic
1174495895 20:50942428-50942450 GCTCACTGCAACCTGCCTCCTGG - Intronic
1176946379 21:14987451-14987473 GGTCAGTGGAACCTGGCAGCAGG - Intronic
1179342526 21:40526162-40526184 GCTCCCATCAACCTCCCAGCTGG + Intronic
1179513584 21:41891535-41891557 GCTCAGAGCCCCCTGACAGCTGG - Intronic
1180517322 22:16157885-16157907 ACTAAGAGCAAACTTCCAGCAGG - Intergenic
1180861543 22:19085538-19085560 ACTCAGAACCACCTGGCAGCAGG - Intronic
1181696196 22:24593981-24594003 GCTCTGGGCAAGCTGGCAGCAGG + Intronic
1182713050 22:32334523-32334545 GCTCACAGCAGCCAACCAGCAGG - Intergenic
1183437069 22:37802500-37802522 GCGCAGAGCCATCTTCCAGCTGG - Intergenic
1183732424 22:39626111-39626133 GCACAGAGCAAACCTCCAGCTGG - Intronic
1183939532 22:41285593-41285615 CCGCAGAGCCACCTCCCAGCAGG - Intronic
1184213929 22:43053817-43053839 GTTCAGAGGCACCTGCCAGAGGG + Intronic
1184950893 22:47842000-47842022 GCTCAGAGGAGCCTGACAGCAGG + Intergenic
1185398219 22:50603395-50603417 GCTCAGAGGCACCTGCCCCCGGG + Exonic
949892108 3:8740896-8740918 GCTCAGGTCAGCCTGACAGCAGG - Intronic
954708734 3:52494727-52494749 GTTCAGAGAGACCAGCCAGCTGG + Intergenic
956329353 3:68088365-68088387 GCTCAGAGCAACCAGGAAGGTGG + Intronic
963068237 3:141280844-141280866 GCTCACTGCACCCTGCCTGCTGG - Intronic
965907661 3:173728837-173728859 TCTGAAATCAACCTGCCAGCAGG - Intronic
966795778 3:183712281-183712303 GCTCACTGCAACCTGCCTTCTGG + Intronic
968878774 4:3288095-3288117 GCTCAGAGCAACGAGCACGCAGG - Intergenic
969263260 4:6046864-6046886 GCTGAAAGCCTCCTGCCAGCTGG + Intronic
969543785 4:7810852-7810874 GCCCAGAGTCAGCTGCCAGCTGG + Intronic
972041322 4:34603800-34603822 GCAAAGAGCAGCCTGCAAGCTGG - Intergenic
981540735 4:145843929-145843951 TCTCAGAGGAACCTGCAAGGAGG - Intronic
984971928 4:185199296-185199318 GCTCACTGCAACCTGCCTCCTGG - Intronic
986614503 5:9602483-9602505 TCTGAGAGCAAGGTGCCAGCAGG - Intergenic
987235319 5:15936404-15936426 GCTCAGAGCAACCTGCCAGCAGG - Intronic
988538277 5:32087814-32087836 GCTCAGGGCCACCCACCAGCCGG + Exonic
992859297 5:80894959-80894981 GCTCACTGCAACCTGCCTCCTGG - Intergenic
995551839 5:113289254-113289276 GCTCACTGCAACCTGCCTCCCGG - Intronic
996702254 5:126462069-126462091 GCTCTGAGCACCCTGACAACAGG + Intronic
996835445 5:127786952-127786974 CCTCAGAGCCACCATCCAGCAGG - Intergenic
997623762 5:135318114-135318136 GATCAGAGCAGCCTGACAACTGG + Intronic
997639435 5:135439008-135439030 GCTCAGAGCTTCCTCCCAGGTGG + Intergenic
999213137 5:149907461-149907483 GCTGAGAGCCACCTGAGAGCAGG - Intronic
999691562 5:154150456-154150478 GCTCAGAGCAAATTGCCATAAGG + Intronic
1001456071 5:171860647-171860669 GCTCTGTGCAACAAGCCAGCAGG + Intergenic
1003152973 6:3568498-3568520 GCTCAGAGGGAGCTGCCAGATGG + Intergenic
1003308600 6:4949623-4949645 TCTCAGAGCAACGTGCTAGCTGG + Intronic
1006825186 6:36929424-36929446 GCTGAGAGCAGCCTGTCATCTGG - Intergenic
1008160049 6:48066059-48066081 ACCCAGAGTAACCTGCAAGCTGG - Intronic
1012294086 6:97497913-97497935 GCACAGCGCCACCTGGCAGCAGG - Intergenic
1012880379 6:104781029-104781051 CCTCAGAGCATCCTATCAGCTGG + Intronic
1013204170 6:107931672-107931694 GCTCACTGCAACCTGCCTCCCGG - Intronic
1015138472 6:129901678-129901700 GTTCGGAGCAAGCTTCCAGCAGG + Intergenic
1015822295 6:137277181-137277203 GCTCAGGTCAACCTTCCAGATGG - Intergenic
1016404404 6:143715340-143715362 GCACATAGCAACCTTCCTGCTGG - Intronic
1016433553 6:144012285-144012307 GCTCACCGCAACCTGCCTCCCGG + Intronic
1016971340 6:149767132-149767154 GCTCACTGCAACCTGCCTCCTGG - Intronic
1020243997 7:6416667-6416689 GCTCAGAGCCGCCTACCCGCAGG - Exonic
1023353758 7:39346685-39346707 ATTCAGAGCAAAGTGCCAGCCGG - Intronic
1024064599 7:45721986-45722008 GCCCAGAGCATCCTGCCTGTGGG + Exonic
1026846181 7:73700287-73700309 GCTCAGAGCACCCTCCCTCCCGG - Exonic
1029173535 7:98647463-98647485 GCTCAGAACAACCTGCCTACAGG + Intergenic
1030051119 7:105538478-105538500 GCCCACAACAACCTGCCTGCAGG - Intronic
1030706481 7:112697942-112697964 GCTCACTGCAACCTCCCTGCCGG - Intergenic
1032478361 7:132227350-132227372 GATCAAAGCAACCTGCAGGCAGG - Intronic
1032758124 7:134911274-134911296 GCCCATAGCAACATGGCAGCAGG + Intronic
1033364544 7:140661709-140661731 GCTCAGAACAATCTGCCACAGGG + Intronic
1037620247 8:20557306-20557328 CCACAGATCAAGCTGCCAGCTGG - Intergenic
1039481125 8:37874293-37874315 GCTCAGAGCTACTGCCCAGCAGG - Intronic
1042166279 8:65948929-65948951 TCTCAGAGAAACTTTCCAGCTGG + Intergenic
1045743353 8:105387563-105387585 ACTCAGAGCGGCCAGCCAGCCGG - Intronic
1046249639 8:111612571-111612593 ACTCAGAACTACCTGCCTGCAGG - Intergenic
1048138211 8:131767290-131767312 GCTCACAGCAACCTGACCTCAGG + Intergenic
1049343588 8:142126841-142126863 GCTGACAGCAAGGTGCCAGCAGG + Intergenic
1049362722 8:142219908-142219930 GCTGAGAGTCACATGCCAGCTGG + Intronic
1049466474 8:142753254-142753276 GCCCCCAGCCACCTGCCAGCTGG + Intergenic
1051199222 9:14598114-14598136 GCCCAGAGCAAGCTGCCTGGAGG + Intergenic
1055243008 9:74207068-74207090 GCTCAAAACAACCTGGCAGGAGG + Intergenic
1056796028 9:89659569-89659591 TCTCATCGCAGCCTGCCAGCAGG + Intergenic
1059588402 9:115630995-115631017 ACTCACAGCAACCTGCAAGAGGG + Intergenic
1060408899 9:123386965-123386987 GCCCACAGCAACCTTCCAGGGGG - Intronic
1060534867 9:124377191-124377213 GCTCACAGCAACGTGCAGGCAGG + Intronic
1060872287 9:127052215-127052237 GCTAAGAGAAACCTGCTAACAGG - Intronic
1061083704 9:128387056-128387078 GCTCAGAGCCACCTGTCTTCAGG - Intronic
1061597143 9:131638577-131638599 ACTTAGAGCAGCCTGCCTGCTGG - Intronic
1061796793 9:133090286-133090308 GCTCAGAGTCACCTGCAATCTGG + Intergenic
1061943553 9:133895511-133895533 TCTCACCGCAACGTGCCAGCGGG + Intronic
1062191613 9:135250752-135250774 GCTCAGAGGAGCCTGCCTGGAGG + Intergenic
1062388868 9:136326258-136326280 GCGCAGCGCAAGCTGCCTGCTGG - Intergenic
1185603425 X:1354328-1354350 GCTCCGAGGAACCTCCCAGGTGG + Intronic
1188892663 X:35629782-35629804 GCACAGATCATCCTGCCACCTGG - Intergenic
1190097062 X:47490135-47490157 CCTCAGTGCTAGCTGCCAGCTGG - Intergenic
1191974569 X:66858140-66858162 GCTGAGAGATACCTCCCAGCAGG + Intergenic
1192343422 X:70282057-70282079 GCGCAGTGCAAGCTGCCAGGAGG + Intergenic
1195047750 X:101069204-101069226 GCTCAGAGGATCCTCCCACCTGG - Intergenic
1196071268 X:111525177-111525199 GCCCAGAGAAACTTGCAAGCAGG + Intergenic
1196869895 X:120102819-120102841 GCTTACTGCAACCTGCCTGCTGG + Intergenic
1199693435 X:150326883-150326905 GCTCTGAGCCACCTGAAAGCTGG + Intergenic
1200132956 X:153861431-153861453 GCTAGGAGCGACCTGCCAGGCGG - Intergenic
1201254819 Y:12096906-12096928 GATGAGAGCCACCTGCAAGCTGG - Intergenic
1201370123 Y:13254131-13254153 TCTCAGAGCAGCCTGGCAGTTGG - Intronic