ID: 987237611

View in Genome Browser
Species Human (GRCh38)
Location 5:15958700-15958722
Sequence GTGGACGTGCAATTCAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987237611_987237613 -6 Left 987237611 5:15958700-15958722 CCTGTGTTGAATTGCACGTCCAC No data
Right 987237613 5:15958717-15958739 GTCCACACTGAGTCAGCTCAGGG No data
987237611_987237612 -7 Left 987237611 5:15958700-15958722 CCTGTGTTGAATTGCACGTCCAC No data
Right 987237612 5:15958716-15958738 CGTCCACACTGAGTCAGCTCAGG No data
987237611_987237615 7 Left 987237611 5:15958700-15958722 CCTGTGTTGAATTGCACGTCCAC No data
Right 987237615 5:15958730-15958752 CAGCTCAGGGACCTTGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987237611 Original CRISPR GTGGACGTGCAATTCAACAC AGG (reversed) Intergenic
No off target data available for this crispr