ID: 987241756

View in Genome Browser
Species Human (GRCh38)
Location 5:16007099-16007121
Sequence ATCTTCCTCAAGAAGACATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987241754_987241756 19 Left 987241754 5:16007057-16007079 CCATCTGGGGTCTATGCCATTAG No data
Right 987241756 5:16007099-16007121 ATCTTCCTCAAGAAGACATAAGG No data
987241755_987241756 3 Left 987241755 5:16007073-16007095 CCATTAGATTAAAGCTTGCTAGT No data
Right 987241756 5:16007099-16007121 ATCTTCCTCAAGAAGACATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987241756 Original CRISPR ATCTTCCTCAAGAAGACATA AGG Intergenic
No off target data available for this crispr