ID: 987242388

View in Genome Browser
Species Human (GRCh38)
Location 5:16013900-16013922
Sequence GATGGAGTTAAGCTTCTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987242379_987242388 22 Left 987242379 5:16013855-16013877 CCTAGCAACGGATGCCAAGGAAC No data
Right 987242388 5:16013900-16013922 GATGGAGTTAAGCTTCTTTAGGG No data
987242384_987242388 -6 Left 987242384 5:16013883-16013905 CCACCTATTTCCAAGGAGATGGA No data
Right 987242388 5:16013900-16013922 GATGGAGTTAAGCTTCTTTAGGG No data
987242385_987242388 -9 Left 987242385 5:16013886-16013908 CCTATTTCCAAGGAGATGGAGTT No data
Right 987242388 5:16013900-16013922 GATGGAGTTAAGCTTCTTTAGGG No data
987242382_987242388 0 Left 987242382 5:16013877-16013899 CCAAATCCACCTATTTCCAAGGA No data
Right 987242388 5:16013900-16013922 GATGGAGTTAAGCTTCTTTAGGG No data
987242380_987242388 8 Left 987242380 5:16013869-16013891 CCAAGGAACCAAATCCACCTATT No data
Right 987242388 5:16013900-16013922 GATGGAGTTAAGCTTCTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987242388 Original CRISPR GATGGAGTTAAGCTTCTTTA GGG Intergenic
No off target data available for this crispr