ID: 987249954

View in Genome Browser
Species Human (GRCh38)
Location 5:16089871-16089893
Sequence GTGAGAAAACAGAAGTATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 1, 2: 2, 3: 36, 4: 445}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987249949_987249954 25 Left 987249949 5:16089823-16089845 CCTTTATTTAGACTTGCATGGTT 0: 1
1: 0
2: 1
3: 24
4: 149
Right 987249954 5:16089871-16089893 GTGAGAAAACAGAAGTATGGAGG 0: 1
1: 1
2: 2
3: 36
4: 445
987249952_987249954 -6 Left 987249952 5:16089854-16089876 CCTTTGCATTTTTATAGGTGAGA 0: 1
1: 1
2: 2
3: 35
4: 312
Right 987249954 5:16089871-16089893 GTGAGAAAACAGAAGTATGGAGG 0: 1
1: 1
2: 2
3: 36
4: 445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987249954 Original CRISPR GTGAGAAAACAGAAGTATGG AGG Intronic
900660856 1:3782652-3782674 GTGAGAAGACAAAGGTAGGGTGG - Exonic
900904192 1:5539399-5539421 GGGAGAAAGCAGGAGTTTGGGGG + Intergenic
901101284 1:6721025-6721047 CTGGGAAAACAGAACTAAGGTGG - Intergenic
902957340 1:19934549-19934571 GTGAGAAAACAGAGGCCCGGGGG - Intergenic
903585357 1:24411243-24411265 ATGAGAAAACTTAAGTTTGGTGG + Intronic
904466242 1:30709344-30709366 ATGAGGAAACTGAAGCATGGAGG - Intergenic
904735895 1:32632837-32632859 GGGGGAAAACAGATATATGGTGG + Intronic
905254870 1:36673990-36674012 ATGAGAAAACTGAGATATGGAGG - Intergenic
906217030 1:44048171-44048193 GTGAGAAAACCAAAGCTTGGAGG + Intergenic
906227309 1:44132554-44132576 GTGAGAAAATGGAAGAAAGGCGG - Intronic
907165087 1:52403667-52403689 GTTAGAAAAGAGAAGTAGGAAGG + Intronic
907249262 1:53127273-53127295 GTGAGAAATCAGATGAAAGGGGG + Intronic
908019881 1:59888627-59888649 GTGAGACAATTGAATTATGGGGG - Intergenic
909228350 1:73054838-73054860 ATGAGAAAACAGAATTAAGCAGG - Intergenic
909349008 1:74626666-74626688 GTGGGAACACAAAAGTCTGGAGG + Intronic
909418428 1:75434123-75434145 GTGAGAACACAGAGGAAAGGAGG - Intronic
910274256 1:85431436-85431458 GTGAGAAAACAAAAGTTTCAGGG + Intronic
910855519 1:91691210-91691232 GAGAGAAAACAGAAAAAAGGGGG + Intronic
911035823 1:93546189-93546211 GTGAGAAAGCAGAGGTGAGGAGG + Intronic
911858679 1:102915869-102915891 GTGAGTAGACAGAAATATGCAGG + Intronic
912142682 1:106750484-106750506 GGGGGAAAAGAGAACTATGGAGG - Intergenic
912423433 1:109564405-109564427 GTGAGAAAACAGAATGAATGGGG - Intronic
913177650 1:116289610-116289632 GGGAGAAAACAGAGATATAGAGG + Intergenic
913268972 1:117074148-117074170 GTGAGGAACTAGAAGTAGGGAGG + Intronic
913310994 1:117493115-117493137 AGGAGAAAACAGAAGGATAGAGG - Intronic
913428647 1:118763904-118763926 TTGAGAAAGCAGAACAATGGTGG + Intergenic
914452454 1:147804748-147804770 ATGAGAAAACTGAGGCATGGAGG - Intergenic
914898585 1:151698455-151698477 GTGAAGAAACAGCAGTATGCTGG - Exonic
916202466 1:162285037-162285059 GTTAGAAAAGAGAAGTATATGGG + Intronic
916611379 1:166395247-166395269 GGGAGAAAAGAGAGGCATGGAGG + Intergenic
916899025 1:169200776-169200798 GTCAGGAAACAGAAGAATAGGGG - Intronic
917249787 1:173045922-173045944 AAGAGAAAATAGAAGTACGGAGG - Intronic
917259499 1:173151443-173151465 GTCAGAAAACAGAGGTGTTGGGG - Intergenic
917626394 1:176850795-176850817 GTGAGGTCAGAGAAGTATGGAGG + Intergenic
917659087 1:177160248-177160270 TGGAGAAAACAGAAGAATGGGGG - Intronic
917830043 1:178873014-178873036 ATGAGGAAAAAGAAGAATGGTGG + Intronic
918068841 1:181120297-181120319 ATAAGAAAACAGAACTGTGGAGG + Intergenic
918162370 1:181913290-181913312 TTGGGAAAACAGAAGTATCCAGG + Intergenic
919706682 1:200682963-200682985 TTGAGAATCCAGAAGGATGGGGG + Intergenic
919908109 1:202092243-202092265 GGGACAAAACAGAAGCATTGTGG - Intergenic
920369978 1:205472813-205472835 GTGAGAAAAGAGAGCTGTGGAGG + Intergenic
920770518 1:208880704-208880726 GAAAGAAAACATAAGTAGGGAGG + Intergenic
921097120 1:211896122-211896144 ATGAGAAAACTGAGGCATGGAGG - Intergenic
921577460 1:216853510-216853532 GTGAAAGAACAGAAAAATGGAGG - Intronic
921594613 1:217040698-217040720 ATGAGAAAACTGAATTAAGGAGG + Intronic
923892018 1:238226614-238226636 GGGAGAAAACTGAATCATGGGGG - Intergenic
924818902 1:247469034-247469056 GTGAGGACACAGAAATAAGGCGG + Intergenic
1063195688 10:3740629-3740651 CTGAGAAAACAGAGGTATTAAGG - Intergenic
1064528863 10:16286208-16286230 GGGAGATAACTGAATTATGGGGG - Intergenic
1065334644 10:24644189-24644211 GTGAGAAGAGAGAATTATGGTGG - Intronic
1066354622 10:34670351-34670373 GTAAGAAATCAGAAGCATAGTGG - Intronic
1068622954 10:59207395-59207417 GTGGGAAAAGTGTAGTATGGGGG - Intronic
1069093527 10:64230128-64230150 GTGGGAAAAGAGTAGTATGTGGG + Intergenic
1069112321 10:64463195-64463217 GTGAGAAAGCTGAAGCTTGGAGG + Intergenic
1069875474 10:71560378-71560400 GTAAGAGAACAGAGGTTTGGTGG - Intronic
1070391725 10:75976736-75976758 ATGAGGAAACTGAGGTATGGAGG + Intronic
1071075817 10:81751148-81751170 TTGAGAAAGCTGAAGTTTGGAGG - Intergenic
1071321435 10:84463386-84463408 GTTAGAAATCAGAAGAATGATGG - Intronic
1074624982 10:115173061-115173083 CTGAGAAAACAGAAGTAATCAGG + Intronic
1074773798 10:116751436-116751458 TTGAGAAAACAGATATATTGTGG - Intergenic
1076491514 10:130864860-130864882 GTGAGACAACAGAGGGTTGGGGG - Intergenic
1076623118 10:131805769-131805791 GTGAGAAAACTAAATTAGGGTGG - Intergenic
1077581287 11:3418848-3418870 GTGGGAAAACAGGAGCCTGGAGG + Intergenic
1077730673 11:4726062-4726084 GTGAGAAACCAGTAGTTTGTTGG + Intronic
1078030715 11:7748475-7748497 GTGAGAACACTGAACTCTGGTGG + Intergenic
1079950968 11:26803924-26803946 GTGAGAAAAAAGGAGCATGGTGG - Intergenic
1081101679 11:39009688-39009710 TTGAGAAAATAGAAGAATGCAGG - Intergenic
1081216912 11:40411949-40411971 GTGAGAAAACAGACTTATTGAGG + Intronic
1081280069 11:41198620-41198642 GAGAGGAAAAAAAAGTATGGAGG + Intronic
1081307841 11:41535254-41535276 ATGAGAAAACAGAACTCGGGGGG - Intergenic
1081322147 11:41704510-41704532 GAAAGAAAACTGAAGTATGGAGG - Intergenic
1081611680 11:44566602-44566624 GTGAGGAAACTGAAGTTTGGAGG - Intronic
1081998548 11:47379268-47379290 ATGGGAAAACAGATGAATGGTGG - Intergenic
1082178080 11:49084973-49084995 GTAAGAAAATGGAAGTATGATGG - Intergenic
1083054172 11:59803813-59803835 GGGAGATAACAGAAAAATGGAGG - Intergenic
1084167084 11:67380042-67380064 TGGAGAAAACAGAGGTGTGGAGG - Intronic
1084238208 11:67801687-67801709 GTGGGAAAACAGGAGCCTGGAGG + Intergenic
1085290580 11:75396369-75396391 GAGAGATAACAGATGGATGGGGG + Intergenic
1085325592 11:75604098-75604120 GTGAGGAAGGAGAAGTATGAAGG - Intronic
1085919502 11:80935288-80935310 GTGAGAAGCCAGAGCTATGGTGG - Intergenic
1086791041 11:91038571-91038593 GTGAGATAACTGAATCATGGGGG - Intergenic
1087830236 11:102811851-102811873 GTGAGAAAACAGTATTAGAGAGG - Intergenic
1089843215 11:121436907-121436929 ATGATAAAACAAAAGTAGGGAGG + Intergenic
1090157449 11:124455930-124455952 GTGAGAAAACGGCAGAATGCAGG - Intergenic
1091010024 11:131992550-131992572 ATGAGAAAACAGCAGAATTGAGG - Intronic
1091811180 12:3399122-3399144 ATGAAGCAACAGAAGTATGGTGG - Intronic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1093265160 12:16994650-16994672 GAGAGAAAAAAGAGGTAGGGTGG + Intergenic
1093331478 12:17848340-17848362 ATGAGAAAACAGAAGGCTAGAGG + Intergenic
1093680268 12:21994172-21994194 GTGAGGATACAGCAGAATGGTGG + Intergenic
1094121381 12:26978295-26978317 ATGAGAAAACAGAAATAAAGAGG - Intronic
1095180531 12:39142863-39142885 GGGAGATAACTGAATTATGGCGG + Intergenic
1095433932 12:42166951-42166973 ATAAGAAAACAGAAAAATGGTGG - Intronic
1095613283 12:44157823-44157845 GTGACTAAAAAGAAGTATTGAGG + Intronic
1095617964 12:44215098-44215120 GTGTGAAAAAAAATGTATGGTGG + Intronic
1095696649 12:45151492-45151514 ATGAGAGAACAGAACTAAGGGGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096896143 12:54822010-54822032 GTGAGAAAACATGAGTTTTGGGG + Intergenic
1097930710 12:65182045-65182067 GTGAGAAAACGGAAAGATAGAGG + Intronic
1099473255 12:83076380-83076402 GTGAGTAAAAAGAAATATGTTGG - Intronic
1099536205 12:83848179-83848201 AGGAGAAGACAGAAGTAGGGAGG - Intergenic
1099776644 12:87140940-87140962 GTGATAAAATAGAAGTATTTGGG + Intergenic
1100018220 12:90038100-90038122 GTGACAAAACAGTAATATTGGGG - Intergenic
1100139787 12:91603321-91603343 ATGAGAAAACCGAGGTCTGGAGG + Intergenic
1100625447 12:96326828-96326850 GTGAGACCACAGAGGTAAGGAGG + Intronic
1101433118 12:104643391-104643413 ATGAGGAAGCAGAAGTTTGGAGG + Intronic
1101465713 12:104946923-104946945 ATGAGAAAACTGAGGTATAGAGG - Intronic
1101610770 12:106289585-106289607 ATATGAAAACAGAAGCATGGTGG + Intronic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1103043258 12:117713702-117713724 GTGAGAGGACAGAATTTTGGAGG - Intronic
1103205619 12:119126406-119126428 ATGAGAAAACTGAGGCATGGGGG + Intronic
1103316960 12:120063924-120063946 GTGAGAAAACAGAGGCAAAGAGG - Intronic
1103336108 12:120190995-120191017 ATGAGAAAACTGAAGATTGGGGG - Intronic
1103881519 12:124169745-124169767 GTGAGATATCAGAGGTGTGGAGG - Intronic
1106646782 13:31643556-31643578 CAGAGAAAACAGAAGTATATAGG + Intergenic
1106694259 13:32154516-32154538 GTGAGGAAACTGAGGTATAGTGG - Intronic
1106925083 13:34605437-34605459 TTGAGAAAACAGAAGCAGGAAGG + Intergenic
1107247102 13:38309717-38309739 GTGAGAACACAGTAATATTGTGG - Intergenic
1107765323 13:43728140-43728162 GTGAAAAAACAGAAATGAGGTGG + Intronic
1108093425 13:46875550-46875572 CTGAGAAACATGAAGTATGGTGG - Intronic
1108140932 13:47420342-47420364 ATGAGAAAACTGACTTATGGAGG + Intergenic
1108756353 13:53507723-53507745 ATGAGGACACAGAAGCATGGTGG - Intergenic
1110340644 13:74385999-74386021 GGGAGATAACTGAATTATGGGGG - Intergenic
1110560837 13:76909364-76909386 GTGAGACAGCAGAATTATGAGGG - Intergenic
1110675294 13:78235816-78235838 GTGGGAAAACATAAGTGTAGTGG + Intergenic
1111254107 13:85642707-85642729 GGGAGAAAAGAAAATTATGGTGG + Intergenic
1111284880 13:86076256-86076278 GGGAGAAAAGAGAACTTTGGTGG + Intergenic
1112515975 13:100053381-100053403 GTTAGAAATCAGAATAATGGTGG - Intergenic
1112892493 13:104255403-104255425 CTGAGAAAACAGATGTAAGTAGG - Intergenic
1113467943 13:110525181-110525203 ATGAGGAAACTGAAGTGTGGGGG + Intronic
1114267452 14:21081377-21081399 GTGAGAAAACAGGAGAGTGACGG + Intronic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1115435397 14:33366482-33366504 GTGAGAAAACAGGAGTGTTCGGG + Intronic
1115522560 14:34247365-34247387 CTCAGAAAACAGAATTATGAAGG - Intronic
1116022648 14:39480544-39480566 GTGAGAAATTTGAAGTGTGGGGG + Intergenic
1118054173 14:62062183-62062205 GTGACAAAACAGATGTTTGCAGG + Intronic
1119113770 14:71999414-71999436 AGGAGAAATCAGAAGTATGATGG + Intronic
1120406944 14:84102344-84102366 CTCAGGAAACAGAATTATGGTGG - Intergenic
1120442464 14:84558136-84558158 GGGAGAAAATAGAATCATGGGGG - Intergenic
1120601053 14:86510412-86510434 ATAAGAAAACAGAAGTATGAAGG - Intergenic
1120956321 14:90086344-90086366 GTGAGAAAACTGAAGCACAGAGG + Intronic
1121068320 14:90991394-90991416 GTGAGAAAATAGAAGTAAAGAGG + Intronic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121659766 14:95626007-95626029 GGGAGATAACTGAATTATGGGGG - Intergenic
1121838597 14:97114445-97114467 ATGAGAAAACAGAGGCACGGGGG - Intergenic
1122451044 14:101807882-101807904 GTGGGAATACAGAAATAAGGGGG - Intronic
1125930348 15:43595272-43595294 TTCAGAAAACTTAAGTATGGGGG - Intronic
1125943516 15:43695104-43695126 TTCAGAAAACTTAAGTATGGGGG - Intronic
1126299245 15:47176804-47176826 GTGAGCACACAGCAATATGGTGG - Intergenic
1126390344 15:48142537-48142559 ATTATAAAACAGAAGTTTGGGGG + Exonic
1127438825 15:58986083-58986105 GTGAGAAAATAGGAGGATTGAGG + Intronic
1127499606 15:59544007-59544029 GTGAGAAAGGAGAAGTCAGGAGG + Intergenic
1129372711 15:75107986-75108008 GTAAGAAAACAGAAGAATGATGG + Intronic
1129509300 15:76108827-76108849 GTGAGAAAACTTAAGTGTGGGGG + Intronic
1129698742 15:77755386-77755408 ATGAGGAAACTGAAGCATGGAGG + Intronic
1130313289 15:82772836-82772858 GAGAAAAAAAAGAATTATGGAGG - Intronic
1130894923 15:88162511-88162533 GAAAGAAAACAGGAGCATGGAGG + Intronic
1131715561 15:95106944-95106966 ATGAGTAAACAGAGGCATGGAGG - Intergenic
1135050985 16:19192896-19192918 GTGGGAAATCAGAATTAGGGAGG - Intronic
1136074799 16:27809657-27809679 GAGAGAAAAGAGAGGGATGGAGG - Intronic
1136287062 16:29250571-29250593 GGGAGAAAACTGAACCATGGGGG + Intergenic
1137867897 16:51919817-51919839 GTGAGAAGAAGAAAGTATGGAGG - Intergenic
1138754880 16:59471750-59471772 GTGGGAGAAGAGAAGTATAGTGG - Intergenic
1138810330 16:60141471-60141493 TTGAAAAAAAAGAAGGATGGAGG + Intergenic
1138877197 16:60966379-60966401 GTGAGAACACAGCAAGATGGTGG + Intergenic
1139914799 16:70421351-70421373 GTGAGAAAAACGAAGGTTGGGGG + Intronic
1140020786 16:71236773-71236795 GTGAGAAGACAGATATGTGGGGG - Intergenic
1142092666 16:88223203-88223225 GGGAGAAAACTGAACCATGGGGG + Intergenic
1148727783 17:49807827-49807849 GTGAGAAAAGAGAAGAATCTAGG + Intronic
1148904936 17:50905855-50905877 ATGAGAAAACAGAAGTGTAGCGG - Intergenic
1148907648 17:50921361-50921383 CAGAGAAAGCAGAAGTGTGGAGG - Intergenic
1149451139 17:56750977-56750999 ATGAGAAAACAGAGGCTTGGAGG - Intergenic
1150239132 17:63618016-63618038 GAGAAAATACAGAACTATGGGGG + Intergenic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1153198275 18:2624544-2624566 GCTAGAAAATAGAAGTATGCAGG + Intergenic
1153198322 18:2624859-2624881 AAGAGAAAATAGAAGTATGTAGG + Intergenic
1153466528 18:5394573-5394595 GTGAGAGAACAGAGGAAAGGAGG + Intronic
1155373703 18:25133287-25133309 GGGAGCAAACAGAAGTAGTGAGG - Intronic
1156195957 18:34774363-34774385 GTAAGAAAACAGAAGTCAGTCGG + Intronic
1156358714 18:36364894-36364916 GGGAGAAAGCAGAAGGGTGGTGG + Intronic
1156928595 18:42613857-42613879 GTCAGAAAACAAAAGAATGTAGG + Intergenic
1157648485 18:49302622-49302644 GTGAAAGAAGAGAAGTAAGGGGG + Intronic
1158188488 18:54798387-54798409 ATGACAAAACAGAAGCATGAAGG + Intronic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1158380053 18:56919709-56919731 ATGAGATAACAGAACCATGGAGG - Intronic
1158844220 18:61424797-61424819 GTTAGAAAACAAAAATATGAAGG - Intronic
1159538340 18:69743705-69743727 GTAAGCAAAAAGAAGTGTGGGGG + Intronic
1160115649 18:76076736-76076758 CTGAGAAAGCAGAAGTGAGGAGG + Intergenic
1160859535 19:1231791-1231813 GTGAGAAAACTGAGGCACGGAGG + Intronic
1162864995 19:13538982-13539004 GTGAGAAAACAAAATAATCGTGG + Intronic
1163375395 19:16927211-16927233 GGGAGATAACTGAATTATGGGGG + Intronic
1163845663 19:19637030-19637052 CTGAGAAGACAGAAGTTTGAAGG + Intronic
1164486545 19:28660902-28660924 GGGAGAAAACTGAATCATGGGGG + Intergenic
1164700336 19:30280249-30280271 GAGGGAAAACAAAAGTAAGGGGG - Intronic
1165019733 19:32914127-32914149 GTAAAAAAACAGACATATGGTGG + Intronic
1165286380 19:34846200-34846222 GGGAGAAAACAGAGGAATGATGG - Intergenic
1167024007 19:46901204-46901226 GTGAGAAAAAGGCAGAATGGTGG + Intergenic
925895401 2:8467759-8467781 GACTGAAAACAGAAGCATGGTGG - Intergenic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
926651948 2:15356394-15356416 GTGAGAACCCAGAAGAAAGGCGG - Exonic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
926804662 2:16696089-16696111 GGGAGGAAACTGAATTATGGGGG + Intergenic
926851844 2:17206707-17206729 CTTAAAAAATAGAAGTATGGAGG - Intergenic
927398072 2:22678442-22678464 GCCAGAAAACAGAAGTAGGCTGG + Intergenic
927432257 2:23036711-23036733 GTGACAAAACAGCAGTTTGCTGG + Intergenic
928141605 2:28734143-28734165 GTGAGCAAACAAAAATGTGGTGG - Intergenic
928215642 2:29359312-29359334 GTGTGGACCCAGAAGTATGGAGG - Intronic
928520702 2:32085660-32085682 GTGAAGAAACAGAAGAATCGGGG + Intronic
929408819 2:41673321-41673343 GGGAGAAAACAGAGATATAGAGG - Intergenic
929955926 2:46458689-46458711 GTGAGAAAACTGAAATCTGGAGG + Intronic
930326140 2:49921322-49921344 GAGAGGAAAAAAAAGTATGGAGG - Exonic
930740612 2:54828997-54829019 GAGAGAAAAGACAACTATGGAGG - Intronic
931210199 2:60186476-60186498 GTGAGGACACAGAAGAAAGGTGG - Intergenic
931332175 2:61299050-61299072 GTGAGAAAACAGAGGTTTCATGG + Intronic
932155984 2:69418096-69418118 GAAAGAAAACTGAAGAATGGGGG + Intronic
932375998 2:71236284-71236306 CTAAGAAAAGAGAAGAATGGCGG + Intergenic
934234925 2:90222264-90222286 GTGGGAAAACAGGAATTTGGGGG + Intergenic
934950292 2:98571266-98571288 GTGAGGAAACTGAGGCATGGAGG + Intronic
935872208 2:107463425-107463447 GTAAGAAAACAGAAGCAGGCCGG + Intergenic
936626961 2:114158670-114158692 GTGAGAGAACAAATGTATGTTGG - Intergenic
936637500 2:114275890-114275912 CTTAGAAATCAAAAGTATGGTGG - Intergenic
936748078 2:115604517-115604539 CTGACAGAACAGAACTATGGTGG - Intronic
936984039 2:118291117-118291139 GTGTGAAAACAGGAGTTTGCAGG - Intergenic
938061485 2:128258481-128258503 GGGACAAAACAGATGTGTGGGGG + Intronic
938427713 2:131205836-131205858 GTGATAACACAGAAATATGAAGG + Intronic
938654645 2:133418528-133418550 GTGAGAAAAGAGAAGGATCAGGG + Intronic
939011590 2:136853326-136853348 GAGAGATAAGAGAAATATGGAGG - Intronic
939018805 2:136933725-136933747 GTGATAATACTGAAGGATGGGGG - Intronic
939908533 2:147950427-147950449 GGGAGAGAACAAAAGTATAGAGG - Intronic
939970585 2:148654727-148654749 GCCAGAAAACAGAAGGAAGGAGG - Intronic
940032766 2:149281860-149281882 GAGAGAACACAGAACTATTGAGG - Intergenic
940436331 2:153660321-153660343 GTGAGAAAGAAGAGGAATGGTGG + Intergenic
940492799 2:154386287-154386309 GTGGGAAAACAGAATAAGGGAGG + Intronic
940495662 2:154424782-154424804 CTCAGAAAAGACAAGTATGGTGG - Intronic
940937683 2:159517315-159517337 GTGAAAAAACAGCAATTTGGGGG - Intronic
941072837 2:160973823-160973845 GACAGAAAACATATGTATGGGGG + Intergenic
941301707 2:163810697-163810719 GTCAGAAATGAGAACTATGGTGG - Intergenic
941712846 2:168732586-168732608 GTGAGAAAATAATAGAATGGAGG - Intronic
941965616 2:171297525-171297547 GTTAGAAAACTGAGGTTTGGAGG - Intergenic
942919248 2:181351259-181351281 GGGAGAAAAGAGAAGTGTGGAGG - Intergenic
943077504 2:183213490-183213512 GTGAGAAAACAGAGGCAATGTGG - Intergenic
943091192 2:183376794-183376816 GTATAAAAACAGAAGTAAGGTGG - Intergenic
944068264 2:195642383-195642405 GGGAGAAAGCAGAAGTGAGGGGG - Intronic
944256944 2:197632666-197632688 GTGAGAAAAGAGGAGGGTGGTGG + Intronic
944301707 2:198131201-198131223 GTGTGAAAACAACAGGATGGGGG - Intronic
945455657 2:210049301-210049323 GAGAGGAAAGAGAAGTGTGGTGG - Intronic
945492158 2:210468879-210468901 AAAAGAAAACAGAAGTATAGTGG - Intronic
946389462 2:219406747-219406769 GTGAGAAGACAGAAGGATGATGG + Intergenic
946818933 2:223610445-223610467 GTGGGAATGCAGAAGTATGAGGG - Intergenic
947752082 2:232538449-232538471 GGGAGAAAACAGGAGGGTGGAGG + Intergenic
1169825980 20:9769181-9769203 GTGAAAATACAGACATATGGGGG + Intronic
1170370664 20:15644467-15644489 GTAAGAAAACAGAAGGAAAGAGG - Intronic
1170399248 20:15961892-15961914 GAAAGAAATCAGAAGGATGGAGG + Intronic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1172509749 20:35492291-35492313 GGCAGAAAACAGATTTATGGTGG + Intronic
1173058486 20:39639078-39639100 TGCAGAAAACAAAAGTATGGTGG + Intergenic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1174740458 20:53008485-53008507 GTCAGAAAAGAGAACTTTGGGGG + Intronic
1175581341 20:60102159-60102181 GTGAGAAAGCAGAAGCCTGGGGG + Intergenic
1175967072 20:62665089-62665111 GTGAGAAAACTGAATCTTGGGGG + Intronic
1176768877 21:13051670-13051692 AGGAGAAAACAAAAGTTTGGTGG + Intergenic
1177438136 21:21082835-21082857 GAGAGGAAACAGAAGTACGAAGG - Intronic
1178387629 21:32166489-32166511 CTCAAAAAACAGAAGGATGGAGG + Intergenic
1178420742 21:32441363-32441385 GGGAGAAAGCAGATGTTTGGAGG + Intronic
1179385547 21:40938480-40938502 GGGAGAAAACAGACAGATGGGGG - Intergenic
1179560649 21:42214049-42214071 GTGAGAAGACTGAATTCTGGAGG + Intronic
1180616889 22:17134325-17134347 GTGAGAAAATGGAAGCTTGGAGG + Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1182574935 22:31266648-31266670 CTGAGTGAACAGAAGTCTGGGGG - Intronic
1184131882 22:42521399-42521421 GGGAGATAACAGAACGATGGTGG - Intergenic
1185051980 22:48558892-48558914 GTGAGAGAATAGGAGCATGGCGG + Intronic
1185417256 22:50717010-50717032 ATGAGAAAACTGAAGCAAGGAGG + Intergenic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949346857 3:3084782-3084804 GTGAGAAAACAGATGCAGAGAGG - Intronic
949815148 3:8050234-8050256 GGATGAAAACAGAAGTATGTAGG - Intergenic
950753877 3:15155952-15155974 GGGAGAAAAGAGAAGTAGGAAGG + Intergenic
951378451 3:21952557-21952579 GTGAGAAAACTGAGGTTTAGGGG - Intronic
952223647 3:31351277-31351299 GTGAGAAAACTGAAGCATAAAGG - Intergenic
952548224 3:34446118-34446140 GGGAGATAACTGAAGCATGGGGG + Intergenic
953317241 3:41940226-41940248 GTGGGAAAACAGACCTCTGGAGG - Intronic
953536868 3:43783279-43783301 GAGAGAAAAGAGAGGTATGGGGG - Intergenic
953917162 3:46927425-46927447 GTGAGAAATCAGAAGGAGAGAGG + Intronic
955126874 3:56121105-56121127 GTGAGAAAACAGAGGCCTAGAGG - Intronic
955375451 3:58392176-58392198 CTGAGAAAACAGAACTAATGAGG + Intronic
955600925 3:60644275-60644297 ATGAGAAAACAAAAATATTGTGG - Intronic
955672650 3:61418151-61418173 ATGAGAAAACAGAGGCAGGGAGG + Intergenic
956020610 3:64929560-64929582 GTGAGGAAACTCAAGCATGGAGG + Intergenic
956687527 3:71844058-71844080 GTGAGAGAACAGAGGAAAGGAGG - Intergenic
957542349 3:81588722-81588744 GTAAGAAAACAGAACTAGAGAGG - Intronic
958536862 3:95414986-95415008 GAAAGAAAACAGAAGGAAGGAGG + Intergenic
959364665 3:105442204-105442226 GGGAGAAAAAAGAAGTATAAAGG - Intronic
961101480 3:124202743-124202765 GTGATGAAGCAAAAGTATGGTGG - Intronic
961300683 3:125920229-125920251 GTGGGAAAACAGGAGCCTGGAGG - Intergenic
961862368 3:129927091-129927113 GAGGGAGAACAGAAGTAAGGAGG + Intergenic
961887817 3:130107859-130107881 GTGGGAAAACAGGAGCCTGGAGG + Intronic
962114520 3:132488591-132488613 GTTGGAAAGCAGAAGAATGGGGG + Intronic
965117368 3:164508486-164508508 GAGAGAAAACAGAAGAAAGAAGG - Intergenic
965413848 3:168367489-168367511 GTGAGAAAACACCAATATTGTGG + Intergenic
966026881 3:175294979-175295001 ATGAGAAAACAGAAGCATAGAGG - Intronic
966424165 3:179763155-179763177 GTGAAAAAACACCAGAATGGGGG - Intronic
966774251 3:183530071-183530093 GTGAGAAAATACATGTATGTTGG + Intronic
967900196 3:194442038-194442060 ATGAGAAAACTGAAGCAGGGTGG + Intronic
968996954 4:3951791-3951813 GTGGGAAAACAGGAGTCTGGAGG + Intergenic
970158408 4:13164716-13164738 GTGAGAAAACAGACTCAGGGAGG - Intergenic
970500624 4:16673047-16673069 GTGAAAGAAAAGAAGGATGGAGG - Intronic
971106717 4:23533846-23533868 GTGAGAACACAGCAGTAAGGTGG - Intergenic
971227830 4:24771271-24771293 GAGTGAAGACAGAAGTTTGGTGG - Intergenic
973634778 4:52851900-52851922 AAGAGAAAACAGGAGTTTGGAGG - Intergenic
974166724 4:58213942-58213964 TTGAGAATACAGAAGGATTGGGG + Intergenic
974412487 4:61560129-61560151 GTGCCATAATAGAAGTATGGAGG - Intronic
976212279 4:82683129-82683151 GAGAGAAAACAGGAGCATGGCGG + Intronic
977181031 4:93874414-93874436 GTAAGAAAACTGAAATAAGGTGG + Intergenic
978178509 4:105764567-105764589 GTGAGGACACAGCAATATGGTGG - Intronic
978215876 4:106202323-106202345 ATAAGAAAACAGAAGAATGATGG + Intronic
978333581 4:107642388-107642410 GTGAGGAACCTGAAGTAGGGAGG - Intronic
980004418 4:127525105-127525127 GTGAGGAAACAGAAGCTTAGAGG - Intergenic
980324609 4:131324884-131324906 GGGAGATAACTGAATTATGGGGG + Intergenic
981658587 4:147140519-147140541 GTGAGAGAACACAAGTGGGGAGG + Intergenic
981741703 4:148009115-148009137 GAGAAAAAAGAGAAGTATTGAGG - Intronic
982634764 4:157880251-157880273 GTGATAAAAAAGAAATATGAAGG - Intergenic
982804337 4:159745219-159745241 GTGAGAGAAGTGAAGTATTGTGG + Intergenic
982990182 4:162263766-162263788 GGGAGAAAACAAAGATATGGGGG - Intergenic
983071231 4:163270188-163270210 GTGAGAGAAGAGAGGTCTGGAGG + Intergenic
983694552 4:170511931-170511953 GAGAGAAAACAGAACTTTGGTGG + Intergenic
984123637 4:175778146-175778168 ATAAGAAAACAGAATTCTGGTGG - Intronic
985618194 5:937202-937224 GTGATAAAAGAGGAGTGTGGTGG + Intergenic
985999835 5:3621596-3621618 ATGAGAAAAAAGAAGTACTGGGG - Intergenic
986248631 5:6034077-6034099 GTGAGATACCAAAAATATGGAGG - Intergenic
986815809 5:11409091-11409113 TAGTAAAAACAGAAGTATGGGGG - Intronic
986939224 5:12930024-12930046 TTTAGAAGACAGTAGTATGGTGG + Intergenic
986947360 5:13039283-13039305 GAGAGAAAAAAGAAGTAGGTAGG + Intergenic
987249954 5:16089871-16089893 GTGAGAAAACAGAAGTATGGAGG + Intronic
987738021 5:21869963-21869985 GGAAGAAAACTGAATTATGGGGG + Intronic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
989087916 5:37695418-37695440 GTGAGAAACCAAAGGCATGGTGG - Intronic
989410484 5:41114153-41114175 CAGAGAAAACAGAAGTATACAGG - Intergenic
990512815 5:56504190-56504212 GTGAGAACACAGCAATAAGGCGG - Intergenic
990529391 5:56658775-56658797 GTAAGAGCAAAGAAGTATGGTGG - Intergenic
990951833 5:61305961-61305983 ATGAGAAAACAGAGGGATGGGGG - Intergenic
991282155 5:64927492-64927514 GTGGGGAAACAGAAGTTTGGTGG - Intronic
991354509 5:65754027-65754049 GGGAGAAACCAACAGTATGGAGG - Intronic
994292296 5:98042247-98042269 ATGAGAAAAATGAAGTATTGGGG + Intergenic
994540462 5:101089723-101089745 GTAATAAAACAGAAGAATGAGGG + Intergenic
994913994 5:105948800-105948822 GTAAGAAAACGGAAGTAGGGAGG + Intergenic
995092163 5:108190757-108190779 GGTAGAAAATAGAAGTGTGGGGG - Intronic
995349776 5:111161769-111161791 TCATGAAAACAGAAGTATGGGGG - Intergenic
995448202 5:112270240-112270262 CTGAGAAAACTGAAGGATGTAGG + Intronic
995453700 5:112330591-112330613 ATGAGAAAACTGAGGAATGGGGG + Intronic
995739623 5:115341761-115341783 GTGAGAACACTGAGGTATAGAGG + Intergenic
995783321 5:115801198-115801220 TTTAGAAAACAAAAGTATGTGGG - Intergenic
996546621 5:124685862-124685884 GTGAGGAAAATGAAGTATGGGGG - Intronic
996611891 5:125392324-125392346 GTAAGAGAACAAAATTATGGAGG + Intergenic
996783018 5:127208977-127208999 ATGAGAAAACTGAAGTATCTTGG - Intergenic
998248031 5:140527035-140527057 GTCAGAAAAGAGAAGAAGGGTGG + Exonic
998387267 5:141764675-141764697 ATGAGAAAACAGAAGCAGAGAGG - Intergenic
998701804 5:144711307-144711329 GTGAGAAAAGAGAAGTGGGAAGG - Intergenic
998955049 5:147430193-147430215 GGAAGAAAAAAGAAGGATGGGGG + Intronic
999050782 5:148522007-148522029 GGGAGATAACTGAATTATGGGGG + Intronic
1000125848 5:158243184-158243206 GTAAGAAACCAGATGCATGGAGG + Intergenic
1000432560 5:161167693-161167715 GGAAGAAAACAGAAGTTTAGGGG + Intergenic
1001419064 5:171573336-171573358 ATGAGAAAACAAAGGCATGGAGG + Intergenic
1001656764 5:173356631-173356653 ATGGGAAAACACAAGTATGTTGG + Intergenic
1001857069 5:175022152-175022174 GTGAGCAAAGAGGAGTGTGGAGG + Intergenic
1003467353 6:6393390-6393412 CTGAGAAAATAGAATTATTGTGG - Intergenic
1003662426 6:8075086-8075108 GGGAGAAGACAGAAGTGTTGGGG + Intronic
1003773302 6:9331919-9331941 GTGCAGAAACAGAAGGATGGAGG + Intergenic
1004042450 6:11993889-11993911 GGGAGAAAACAGAAGCAGGAGGG + Intergenic
1005201243 6:23347213-23347235 GTGAGATTACAGAGGTATGCTGG + Intergenic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1007228760 6:40333485-40333507 GTGAGGAAACTGAGGCATGGGGG - Intergenic
1008483307 6:52008773-52008795 ATGAGAAAACTGAAGTACAGAGG + Intronic
1008512705 6:52291613-52291635 GGGAGATAACTGAATTATGGGGG + Intergenic
1010088414 6:71949527-71949549 GTGAGAAAACTGAAGTTTAGAGG - Intronic
1012114060 6:95271122-95271144 ATGACAAGACTGAAGTATGGTGG + Intergenic
1012153457 6:95785459-95785481 GACAGAAAACAGAAGTGAGGTGG - Intergenic
1012844341 6:104370449-104370471 GTGAGAGAACAAGAGTATGCTGG - Intergenic
1012879349 6:104766935-104766957 GTGAGGAAACAGAAGCATATAGG - Intronic
1013066331 6:106687593-106687615 TAGAGAAAACAGAAATATTGGGG - Intergenic
1013456462 6:110334094-110334116 GAGAGAAAACAGAGGAAAGGGGG + Intronic
1013604551 6:111735636-111735658 GGGAGAAAAGAGAAGCATGGGGG + Intronic
1014346055 6:120270751-120270773 GGGAGATAACTGAATTATGGGGG + Intergenic
1014963257 6:127713798-127713820 GTGAGAAAGGAGAAGTAGAGAGG + Intronic
1015209728 6:130683408-130683430 GGGAGAAAACAGAATCCTGGGGG + Intergenic
1015523311 6:134152483-134152505 GGGAGATAACTGAATTATGGGGG + Intergenic
1015901564 6:138073622-138073644 GGGAGATAACTGAATTATGGGGG + Intergenic
1016027285 6:139300184-139300206 GTTAGAAAACAGGTGTGTGGTGG + Intergenic
1020080034 7:5282229-5282251 GGGAGAAAAGAGGAGGATGGAGG + Intronic
1020384939 7:7590797-7590819 GTGAGAAATGTGAAGTATGAGGG - Intronic
1020522810 7:9215374-9215396 GTGAAAAACAAGAAATATGGAGG - Intergenic
1021524717 7:21574520-21574542 GAGGGAAAACAAAAGTATGCAGG - Intronic
1022964398 7:35459081-35459103 GGGAGATAACTGAATTATGGCGG - Intergenic
1024158163 7:46647522-46647544 GGGAGATAACTGAATTATGGGGG - Intergenic
1024528772 7:50373136-50373158 GGAAGGAAACAGAAGCATGGGGG - Intronic
1025064379 7:55840542-55840564 GTGAGAACACAGAGATAAGGTGG + Intronic
1025198882 7:56949987-56950009 GGGAGAAAAGAGGAGGATGGAGG - Intergenic
1025673064 7:63626946-63626968 GGGAGAAAAGAGGAGGATGGAGG + Intergenic
1026107701 7:67433995-67434017 GGGAGATAACTGAATTATGGGGG + Intergenic
1026131836 7:67627380-67627402 TTGAGAAAACAGAAGTATGGAGG + Intergenic
1026715471 7:72785572-72785594 ATGAGAAAACAGAAGCACAGAGG + Intronic
1027158083 7:75782528-75782550 GGGAGAAAAAGGAAGAATGGAGG - Intronic
1027332857 7:77117653-77117675 ATAAGAAAACAGAAGAATGATGG + Intergenic
1027469769 7:78558631-78558653 GTGAAGAAACTGAAGGATGGAGG - Intronic
1027972526 7:85103619-85103641 GTGAAAAAGAAGAATTATGGTGG - Intronic
1028650681 7:93147401-93147423 GAGAGAAAACTGAAGTGTTGAGG - Intronic
1029503873 7:100950370-100950392 CAGAGAAAAGAGAAGTATAGAGG - Intronic
1029782927 7:102753644-102753666 ATAAGAAAACAGAAGAATGATGG - Intronic
1030438057 7:109551436-109551458 ATTAAAAAACAGGAGTATGGGGG + Intergenic
1030933526 7:115555735-115555757 GTGAGTAACCAGTAGTATGCAGG - Intergenic
1030957150 7:115868391-115868413 GTGAGTAACCAGAAGTCTGGGGG + Intergenic
1031785224 7:126021950-126021972 TTGAGAAAAGAGAAGTTTGCTGG - Intergenic
1032172918 7:129600631-129600653 GTGAGAAAGCACAAAAATGGCGG - Intergenic
1033033538 7:137848542-137848564 GTGAAAAATCAGAAGTATTTTGG - Intergenic
1033429971 7:141280377-141280399 GGGAGATAACAGAATCATGGGGG + Intronic
1034079704 7:148265111-148265133 GTAAGTAAACAGAAGTGCGGTGG + Intronic
1034276762 7:149827243-149827265 GTGAGGAAACTGAGGTCTGGAGG + Intergenic
1034310522 7:150083786-150083808 GAGAGAAAACAGCAGTATGGAGG - Intergenic
1034796317 7:154016844-154016866 GAGAGAAAACAGCACTATGGAGG + Intronic
1034965305 7:155387171-155387193 ATGAGGAAACAGATGTGTGGAGG + Intronic
1035452263 7:158985122-158985144 GGGAGATAACAGAATCATGGGGG - Intergenic
1035700470 8:1635268-1635290 CTGGGAAAACAAAATTATGGAGG + Intronic
1038136081 8:24787134-24787156 GTGAGAAAACTGAGGTGTGTGGG + Intergenic
1038670966 8:29582623-29582645 GTTAGAAAACTGAAGTATACAGG - Intergenic
1038954527 8:32452672-32452694 ATGGAAAAACAGAAGTATAGAGG + Intronic
1039118222 8:34116161-34116183 GTGAGATAAAAGAATCATGGGGG + Intergenic
1039235407 8:35497395-35497417 TTGAGAAAACAGCAGTAGGGAGG - Intronic
1040428096 8:47309657-47309679 ATCAGAAAACAGAAGTATTTGGG - Intronic
1040601453 8:48888405-48888427 GTGAAAAAACAGAAGAACAGAGG - Intergenic
1040995047 8:53392656-53392678 GTAAGAAAACAGAAGCACTGAGG - Intergenic
1041150804 8:54931713-54931735 GGGAGAAATCAGAAGAAAGGAGG - Intergenic
1041752445 8:61275548-61275570 GTGAAACAACAAAAGTATGTTGG + Intronic
1042140717 8:65675692-65675714 GTGAGAAAACAGAAGCATAGAGG + Intronic
1042449351 8:68926311-68926333 ATGAGAAAAATGAAGTATAGAGG + Intergenic
1043080728 8:75761529-75761551 GAGAGAAAACTGAATCATGGAGG + Intergenic
1043680684 8:83021629-83021651 GTGAGATAACTGAATCATGGGGG - Intergenic
1045665951 8:104484741-104484763 GTGAGAAAACTGAATGATTGTGG + Intergenic
1046151157 8:110228163-110228185 TTGAGAAAACAGAAATGTGGGGG - Intergenic
1046365661 8:113227722-113227744 CTCAGAAAACATAATTATGGTGG - Intronic
1046396904 8:113651558-113651580 TTTAGAAAGCAGGAGTATGGGGG + Intergenic
1047713427 8:127574353-127574375 GTGAGAAAACTGAGGTTTAGAGG - Intergenic
1047805932 8:128359936-128359958 GTTAGAACACAGAGGTGTGGAGG + Intergenic
1048196336 8:132334884-132334906 GAGAGAAGTCAGAAGTGTGGGGG - Intronic
1048557629 8:135496138-135496160 ATGAGAAAGCAGAAGTAGGAAGG + Intronic
1048937160 8:139366980-139367002 GGGAGAGACCAGAAGTAAGGAGG + Intergenic
1049246061 8:141563221-141563243 GTGAGGAAACTGAGGTAGGGAGG - Intergenic
1050951006 9:11593160-11593182 GTGAGAAAACAGAGCTATATAGG + Intergenic
1051146906 9:14036550-14036572 GTGAAAAAACAGAGATGTGGAGG + Intergenic
1051450537 9:17193088-17193110 GTGAGATAACTGAATCATGGGGG - Intronic
1051698090 9:19789873-19789895 GGGAGAGAACAGAAGGATGGAGG - Intergenic
1052427619 9:28325522-28325544 GGGAGATAACTGAATTATGGGGG + Intronic
1053375386 9:37601634-37601656 GTGGGAAAAGAGAAGAATAGAGG + Intronic
1057006010 9:91560552-91560574 TTCAGAAAACAGAAGAATGCTGG - Intergenic
1058624143 9:106916671-106916693 GTGAGAAATAATAAGTATTGAGG - Intronic
1058755806 9:108082214-108082236 GGAAGGAAACAAAAGTATGGTGG - Intergenic
1059684763 9:116624491-116624513 ATGAGAATACAGAAGGAAGGGGG + Intronic
1061063059 9:128260402-128260424 GTGGGAAAACAAAGGTCTGGAGG + Intronic
1062178832 9:135179769-135179791 ATGAGAAAACAGAGGCTTGGAGG - Intergenic
1186607663 X:11108963-11108985 GTGAGAGAACAGAATGATGAGGG + Intergenic
1186668500 X:11744504-11744526 GTGAGAAAACAGGAGCTGGGAGG + Intergenic
1187009421 X:15264928-15264950 GTAAGAAACCAGAAGTATCCAGG + Intronic
1187995741 X:24924655-24924677 GTGAACAGACAGAATTATGGAGG + Intronic
1188220047 X:27530360-27530382 TATAGAAAACAGAAGAATGGCGG - Intergenic
1189173346 X:38930693-38930715 GTGAGAAAACTGAGGCATAGAGG - Intergenic
1189571207 X:42299741-42299763 GTGAGAAAACAGTATTATAGAGG + Intergenic
1190396912 X:49994314-49994336 GTGATTAGACAGATGTATGGTGG + Intronic
1190620958 X:52286570-52286592 GTGAGAATAAGGAAGTAGGGTGG - Intergenic
1191764453 X:64682111-64682133 GAGGGAAAACAGAACTAGGGAGG + Intergenic
1191832596 X:65431021-65431043 TTGATAAAACAGAGGAATGGGGG - Intronic
1192106258 X:68320544-68320566 GTGAGAATATAGAAAAATGGGGG - Intronic
1192456810 X:71283095-71283117 GTGTGAAAAAAGAAACATGGCGG + Intergenic
1193388542 X:80899502-80899524 GAAAGAAAACAGAAAAATGGAGG - Intergenic
1195046247 X:101057120-101057142 GTGAGAATACACAACTATTGGGG + Intergenic
1197147216 X:123184201-123184223 GTGTGAAGACAGAAGTGAGGTGG + Intronic
1198488482 X:137112657-137112679 GTGAGAAAAAAGAAGCAATGGGG - Intergenic
1199397745 X:147359391-147359413 GTAAGAAAGTAGAAGAATGGGGG - Intergenic
1201859575 Y:18581898-18581920 GGTAGAAAACAGAAATATGCTGG + Intronic
1201873746 Y:18738483-18738505 GGTAGAAAACAGAAATATGCTGG - Intronic