ID: 987251866

View in Genome Browser
Species Human (GRCh38)
Location 5:16108488-16108510
Sequence TGGTGGGTACAGAACTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987251866 Original CRISPR TGGTGGGTACAGAACTTGGA AGG Intronic
900866266 1:5270737-5270759 TGGTGGGGAGAGAACTGGGGTGG + Intergenic
900959896 1:5912205-5912227 CGGTGTGTGCAGAACTGGGAAGG + Intronic
901164637 1:7209481-7209503 TGGTGGTTCCAGAACTGGGAGGG + Intronic
901849041 1:12003760-12003782 TGGTGGGCACAAAACAGGGAGGG - Intronic
902787551 1:18742837-18742859 TGGTGGTTACAGAGCATGAAGGG - Intronic
903734858 1:25523634-25523656 TGGTGGATTCAGCACTTGCATGG + Intergenic
905262806 1:36731351-36731373 GGGTGGGCACAGGACCTGGAGGG - Intergenic
907921433 1:58917178-58917200 TGGTGGGAAGTGAACTAGGATGG + Intergenic
908733287 1:67248976-67248998 TAGTGGGTACAGCTCATGGAGGG - Intronic
909432058 1:75599830-75599852 TGGTGGGAAATGAACCTGGAAGG + Intronic
909679633 1:78277503-78277525 TGGTGGCCAGAGAACATGGAGGG - Intergenic
909753341 1:79191630-79191652 TGTTGTGTAAAGAAATTGGAAGG + Intergenic
910497237 1:87844405-87844427 TGGAGGGTAGAGCCCTTGGAAGG - Intergenic
910677557 1:89830466-89830488 TGCTTGGTACAGAACTTAGCAGG - Intronic
912548876 1:110471421-110471443 TGGTGGGGACAGAGCTGGAAGGG + Intergenic
913460592 1:119082319-119082341 TGGTAGGTACAGCACGTGTAAGG - Intronic
915888721 1:159750817-159750839 TGGTTGGTCCATAAGTTGGAGGG - Intergenic
916550146 1:165842261-165842283 TGGAGAATACAGAACATGGAGGG - Intronic
916938466 1:169656089-169656111 TGGTGGGTGCAGCTCATGGAGGG + Intergenic
917715504 1:177733004-177733026 TGGTGGTTACAGAGGCTGGAGGG + Intergenic
918173124 1:182017356-182017378 TGGTGGTTACAGAGTCTGGAGGG - Intergenic
918985401 1:191618635-191618657 TGGTGGATACAGTACAGGGATGG - Intergenic
919341466 1:196312970-196312992 TGGTGGGTAGAGAACCTAAAAGG + Intronic
919378017 1:196817923-196817945 CAGTGGGTACAGCACATGGAGGG - Intergenic
922788060 1:228293282-228293304 TGGAAGATACAGAACATGGATGG - Intronic
924312918 1:242764177-242764199 TGGTGGGTGCAGCACTGGGGTGG - Intergenic
1063556430 10:7084062-7084084 TGGTGGGAACAGAAGGAGGAGGG + Intergenic
1063917279 10:10896242-10896264 CGGTGGGTACAGCACATAGAAGG + Intergenic
1063971809 10:11386239-11386261 TGGTGGAGACAGAACTGGAAGGG - Intergenic
1064950404 10:20842875-20842897 TGGTGGTTACAGAGGCTGGAGGG - Intronic
1067183618 10:44008773-44008795 GGGTGGGTACAGAACTCCCAGGG - Intergenic
1067441407 10:46310984-46311006 TGGTGGGCACCGAGCTGGGAAGG + Intronic
1068727607 10:60320662-60320684 TGGTGGTTACAGAAATCTGAAGG + Intronic
1076249382 10:128973175-128973197 TGGGGGATAGAGAACATGGATGG + Intergenic
1078654523 11:13225974-13225996 TGGTGGGAACATAAATTGCAAGG - Intergenic
1079282901 11:19103914-19103936 TAATGGGTTCTGAACTTGGATGG + Intergenic
1080408043 11:31997373-31997395 TGGTGGGGAAAGAAATAGGAGGG - Intronic
1083682534 11:64358103-64358125 TGGGGGGTGCAGAGCTGGGAGGG + Intergenic
1085835388 11:79950481-79950503 GTATGGGTAGAGAACTTGGAAGG - Intergenic
1092242807 12:6845858-6845880 TGGGGGGTACAGAATGGGGAGGG - Intronic
1092969880 12:13683395-13683417 TGGTGGGTGCAGGATTTGAATGG - Intronic
1093591187 12:20904348-20904370 TGTTGGGTTCTGAACTTGCATGG - Intronic
1102633552 12:114302583-114302605 TGGGGGGTTCAGCACTTGGGAGG + Intergenic
1105436279 13:20380988-20381010 TGGTGGGCACTGAGCTTGGTAGG - Intergenic
1105590134 13:21785169-21785191 TGCTGGGCACAGGACTTGGCAGG + Intergenic
1112171957 13:96983043-96983065 TGGAGGGTACAAAATTTTGATGG + Intergenic
1112914063 13:104523849-104523871 TGGAAAGTACAGAACATGGAAGG + Intergenic
1113618806 13:111699358-111699380 TGGCAGGTACAGAACAGGGAAGG - Intergenic
1113624335 13:111784619-111784641 TGGCAGGTACAGAACAGGGAAGG - Intergenic
1113881375 13:113628651-113628673 TGGTGGGCAGAGACCCTGGAAGG - Intronic
1116069591 14:40026596-40026618 TGGTAAGTACAGAACAAGGAAGG - Intergenic
1117551301 14:56839478-56839500 AGGTGGTTACAGTACTTGCATGG - Intergenic
1118355842 14:65013004-65013026 TGGAGGGGACAGATGTTGGATGG + Intronic
1118600170 14:67466460-67466482 TGGTGGGCACAGAAATGGCATGG + Intronic
1119180008 14:72599220-72599242 TGGTGGGAACAGCACTGGGTGGG + Intergenic
1119424289 14:74525679-74525701 TGTTGGGTTCAGACATTGGAAGG - Intronic
1120257980 14:82143121-82143143 TGTTGGGTAAAGGACCTGGAAGG + Intergenic
1121518219 14:94568008-94568030 TTGTGGGGACAGAACTCAGATGG + Intronic
1121573377 14:94964218-94964240 TTGTGGGTACAGAAGCAGGAGGG - Intergenic
1122078121 14:99248442-99248464 GGGTGGGTCCAGATCTTGCAGGG + Intronic
1122313394 14:100811505-100811527 TGGTGGAGACAGAAGTGGGAAGG + Intergenic
1123008285 14:105334892-105334914 AGGTGGGAACAGAGCTGGGAGGG + Intronic
1123188572 14:106544473-106544495 TGGGGGGTAAAGAATTTGAAGGG + Intergenic
1127550186 15:60029908-60029930 TGGTGGGTTCAGATCCTGAAGGG - Intronic
1128012840 15:64314640-64314662 TGGTGGTTACAGAGCCTGGAGGG - Intronic
1129153851 15:73705320-73705342 GGGTGAGATCAGAACTTGGATGG - Intronic
1129190329 15:73933784-73933806 TGCTGGGCACAGCAATTGGAAGG - Intronic
1129695300 15:77737595-77737617 TGGTGGGGACAGAACTGGAGAGG - Intronic
1131690286 15:94820091-94820113 TGTTGGGCACAGAACTGGTAGGG - Intergenic
1132390382 15:101434332-101434354 TGGTGGGCACAGCAATTGGAAGG - Intronic
1134562097 16:15219611-15219633 TGGTGGATTCAGAAAATGGACGG - Intergenic
1134922635 16:18131235-18131257 TGGTGGATTCAGAAAATGGACGG - Intergenic
1135509517 16:23070116-23070138 TGTTGGGCACAGGACTTGTAAGG - Intronic
1135705911 16:24674838-24674860 TGGTGGGTGGAGAATTTGGATGG - Intergenic
1136180479 16:28548495-28548517 TGGTGGGTACCGGACTTCAAAGG + Intergenic
1136180517 16:28548687-28548709 TGGTGGGTGGAGACCTGGGACGG + Intergenic
1139047263 16:63076843-63076865 TGGTGGGTACCGAACATGACTGG - Intergenic
1143835794 17:9691673-9691695 TGGTGGGAACATAAAATGGATGG - Intronic
1144831972 17:18136839-18136861 TGGTGAGTAAAGAAAATGGAAGG - Intronic
1145714401 17:27006139-27006161 TGGTGGGTACAGGCATGGGAAGG - Intergenic
1146320553 17:31843286-31843308 TGGAGGGAAGAGAAGTTGGAGGG - Intergenic
1147357399 17:39908798-39908820 GGGTGGGTTCAGCACTAGGAAGG - Intronic
1147644676 17:42026719-42026741 GGGTGGGGACAGTCCTTGGAAGG + Intronic
1150410449 17:64937150-64937172 TCGGGGGTAGAAAACTTGGAAGG - Intergenic
1151676596 17:75601987-75602009 TGGTAGGCATAGAACTCGGAAGG - Intergenic
1152119748 17:78411230-78411252 TGGTGGGCACTGAGATTGGAGGG + Intronic
1155322308 18:24631796-24631818 TACTGGGTACAGAGCTGGGAGGG - Intergenic
1158701111 18:59747890-59747912 TGGTGGGCTCAGATCATGGATGG - Intergenic
1162182823 19:8882337-8882359 TGGTGGGTACAGAGCTCCGATGG + Exonic
1162187431 19:8916870-8916892 TGGTGGGCATAGAGCTTCGATGG + Exonic
931959830 2:67470055-67470077 TGGTGGTGACAGATATTGGATGG + Intergenic
934093693 2:88578161-88578183 TGGTAGGTACAGGAATTGGATGG - Intronic
936391559 2:112079279-112079301 TGGTGGGTACAGAGGCTGGGAGG - Intronic
936631514 2:114208026-114208048 TGGAGACTACAGAAGTTGGAAGG - Intergenic
937713030 2:124999357-124999379 TGGTGGGGACAGATGGTGGATGG + Intergenic
937909955 2:127070701-127070723 TGGTGGGTGCAGAGCTGGGGAGG - Intronic
939248830 2:139660819-139660841 TGGTTGGAACAGATTTTGGAAGG - Intergenic
939544185 2:143532436-143532458 TGGTGGGAAAAGAATTTGAATGG - Intronic
941172479 2:162156325-162156347 TGGTGGCAACAGAGCCTGGATGG + Intergenic
942447101 2:176085455-176085477 GGGTGGGCACAGTGCTTGGAGGG - Intergenic
942603248 2:177663058-177663080 TTGTGGGTAAAGAACTTGCCAGG + Intronic
943815247 2:192246400-192246422 TGGTGGGAACAAAATTTGCAAGG + Intergenic
944506889 2:200422032-200422054 TGGTGGGTACTTAACTTTCAAGG - Intronic
1169031753 20:2414918-2414940 TGATGGTTACAGAATTTGGGGGG + Intronic
1170030342 20:11937848-11937870 TCCTTGGTGCAGAACTTGGAGGG - Intergenic
1173102872 20:40103788-40103810 TGCTGGGTACAAAACTTTCAGGG + Intergenic
1175168302 20:57062058-57062080 GGTTGGGTACAGAATTTGCAGGG - Intergenic
1176424227 21:6538120-6538142 TGGTGGGGCAAGAACTTGGCTGG + Intergenic
1178021242 21:28410982-28411004 TGGTGGGGATAGAACATGCAGGG - Intergenic
1178821314 21:35977575-35977597 TGGTTGCTAGAGAACATGGAGGG - Intronic
1179699720 21:43146435-43146457 TGGTGGGGCAAGAACTTGGCTGG + Intergenic
1182987042 22:34729650-34729672 TGGTGGTTACAGAGGTTGGCAGG + Intergenic
1183675169 22:39295092-39295114 TGGGCGAGACAGAACTTGGAGGG - Intergenic
949558556 3:5181688-5181710 TGGTGGGTTCAGAACTGGAATGG + Intergenic
949596005 3:5547761-5547783 TGGTGGCTCCAGACCTTGGATGG + Intergenic
949717692 3:6952238-6952260 TAGTGGGTTGAGGACTTGGAAGG - Intronic
951653758 3:24981775-24981797 CAGTGGGTACAGCACATGGAAGG - Intergenic
957744089 3:84316242-84316264 TGGTGCGCACACAAATTGGAAGG + Intergenic
957820364 3:85365160-85365182 TGGTGGGTCAAGAATTGGGAGGG + Intronic
959661952 3:108878937-108878959 GGGTGGGTGCAGAATTTGTAGGG + Intergenic
960967704 3:123116601-123116623 TCGTGGGTCCAGAATTTTGAGGG + Intronic
963840951 3:150105902-150105924 TGGTGGTCACAGTGCTTGGAAGG - Intergenic
964072876 3:152656259-152656281 TGCTGGGAACAGAGTTTGGAGGG + Intergenic
965351482 3:167617008-167617030 ATGTGGGTACAGAAATTGGTAGG + Intronic
968792279 4:2674495-2674517 AGGTGGGTGCTGAACGTGGAGGG + Intronic
968885563 4:3329295-3329317 TGGTGTGTTTAGAACTTGGAGGG + Intronic
972345309 4:38188077-38188099 TGGTGGATTCAGAACATGGTTGG - Intergenic
980856201 4:138443342-138443364 TGGTGGGTCCAGATGTTTGAAGG - Intergenic
983478796 4:168247689-168247711 TGGTGGATACAGAAATTGCAAGG + Intronic
984622273 4:181967289-181967311 TGGGGGTTACAGAACTGGGTAGG - Intergenic
987251866 5:16108488-16108510 TGGTGGGTACAGAACTTGGAAGG + Intronic
987960595 5:24803576-24803598 TTGAGGGTAAGGAACTTGGAAGG + Intergenic
989259549 5:39403797-39403819 AGGTGGGTACAAAATTAGGATGG - Intronic
991200051 5:63980893-63980915 CAGTGGGTACAGACCATGGAGGG - Intergenic
993343926 5:86758963-86758985 TTATGGTTACAGAACTTGAAGGG - Intergenic
995342584 5:111075765-111075787 AGGTGGGTACAGAAACAGGAAGG + Intronic
998621460 5:143798933-143798955 TGGTGGCTTCAGCACATGGATGG + Intergenic
1002038424 5:176491807-176491829 TAGTGGCTACAGTACTTAGACGG + Intronic
1003735139 6:8869542-8869564 TGTTGGAGACAGGACTTGGAGGG + Intergenic
1004363805 6:14995277-14995299 TCTTGGGTAAAGATCTTGGAAGG - Intergenic
1007839070 6:44700959-44700981 TTGTGAGTTCAGAACTTGGTTGG - Intergenic
1008436907 6:51486399-51486421 AAGTGGGTACAGCACATGGAGGG - Intergenic
1016001287 6:139043987-139044009 TGGAGGGGGCAGAACTTGCATGG + Intergenic
1019164329 6:170088204-170088226 TGGTGGGAGCAGAGCTGGGAAGG + Intergenic
1019519453 7:1454176-1454198 GGGGGGGTGCAGGACTTGGAAGG + Intronic
1020059843 7:5143986-5144008 TGGTGGGCACTGAGCTAGGAGGG - Intergenic
1020168126 7:5823765-5823787 TGGTGGGCACTGAGCTAGGAGGG + Intergenic
1021267494 7:18543173-18543195 GTGTGGGTAGAGAATTTGGAAGG - Intronic
1021372072 7:19861534-19861556 TGCTGGGTAGAGAATTTGGCAGG - Intergenic
1023254518 7:38299749-38299771 TGGTGGGCACAGACCCTGGGAGG + Intergenic
1023890178 7:44386355-44386377 TGCTGGGGACAGAAGATGGAGGG - Intronic
1024970864 7:55068894-55068916 TGGTGGGCAGAGCAGTTGGAGGG + Intronic
1025709784 7:63898699-63898721 TGTTGGGTATAAAACTTGGGCGG - Intergenic
1025841042 7:65149695-65149717 TGTTGGGTACAAAAGTTTGATGG + Intergenic
1025882003 7:65546253-65546275 TGTTGGGTACAAAAGTTTGATGG - Intergenic
1025891438 7:65656379-65656401 TGTTGGGTACAAAAGTTTGATGG + Intergenic
1027758843 7:82251788-82251810 TAGTGGTTACATAGCTTGGAAGG + Intronic
1028167673 7:87556975-87556997 TGGTGGGAACAGAGATGGGATGG - Intronic
1028832178 7:95340313-95340335 AAGTGGGTGCAGAAATTGGATGG + Intergenic
1034062824 7:148108674-148108696 TGGTGGGTACAGAGGCTGGAAGG + Intronic
1034393421 7:150802528-150802550 TGGTGGGAACAGCACTGGGAAGG - Intronic
1034459574 7:151191094-151191116 TGGTGGGTACAGGAGTGGTAAGG + Intronic
1035100036 7:156389071-156389093 TGGTGGGGACAGCAGATGGACGG - Intergenic
1036784268 8:11675419-11675441 TGGTGGGAACAGAACTAGAGAGG - Intergenic
1037364120 8:18104249-18104271 TGCTGGGTATAGAACTTGCATGG + Intergenic
1038349423 8:26762743-26762765 TGGTGGGTGCAGAACTGATATGG - Intronic
1038453251 8:27653325-27653347 GGGAGGGTACAGACCTGGGAAGG + Intronic
1039144466 8:34430811-34430833 AGTTGGGTACATAAATTGGAAGG + Intergenic
1046048063 8:108986874-108986896 TAGTGGGTACAGCCCATGGAGGG - Intergenic
1051372093 9:16367307-16367329 TGGGTGGTACAGACCTTGGTGGG + Intergenic
1052051002 9:23849966-23849988 TGCTGGGCGCAGAACTGGGAAGG + Intergenic
1053474387 9:38371473-38371495 TGGTGGGGCCAGAGCGTGGAAGG + Intergenic
1055663574 9:78531438-78531460 TGAGGGGAACAGAACATGGAGGG + Intergenic
1058040400 9:100295819-100295841 TTGTGGGCACAGAACTTGGGGGG - Intronic
1058951940 9:109912141-109912163 GGGTGGGAGCAGAACATGGAGGG + Intronic
1059321640 9:113475046-113475068 TGCTGGGCACAGGACTTGAAGGG - Intronic
1061817020 9:133203687-133203709 TGGGGGGTGCTGAGCTTGGAAGG + Intergenic
1062393613 9:136343711-136343733 TGCTGGGAACAGAGCTTGGCAGG + Intronic
1062580805 9:137228490-137228512 TGGTGCGTGCAGACCTGGGAGGG - Intronic
1189213442 X:39303621-39303643 TGCTGGGTTTAGAACTTGCATGG + Intergenic
1193860821 X:86664798-86664820 TGGTGGGTGTAGAACATGAAAGG - Intronic
1195754934 X:108191135-108191157 GAATGGGTACAAAACTTGGAAGG + Intronic
1197922273 X:131608127-131608149 GGCTGGGTCCAGATCTTGGAAGG - Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic
1202071024 Y:20991654-20991676 TGGTGAGTACAGCATTTGCAAGG + Intergenic