ID: 987257251

View in Genome Browser
Species Human (GRCh38)
Location 5:16168700-16168722
Sequence TTGTGTGGGAATGAGTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 293}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987257251_987257258 28 Left 987257251 5:16168700-16168722 CCCACCTACTCATTCCCACACAA 0: 1
1: 0
2: 0
3: 45
4: 293
Right 987257258 5:16168751-16168773 AGGAAGAAAGAGATGGAAGAAGG 0: 1
1: 8
2: 70
3: 709
4: 5476
987257251_987257256 8 Left 987257251 5:16168700-16168722 CCCACCTACTCATTCCCACACAA 0: 1
1: 0
2: 0
3: 45
4: 293
Right 987257256 5:16168731-16168753 AGTCAGATGATGATAGAAAAAGG No data
987257251_987257257 21 Left 987257251 5:16168700-16168722 CCCACCTACTCATTCCCACACAA 0: 1
1: 0
2: 0
3: 45
4: 293
Right 987257257 5:16168744-16168766 TAGAAAAAGGAAGAAAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987257251 Original CRISPR TTGTGTGGGAATGAGTAGGT GGG (reversed) Intronic
902599341 1:17530544-17530566 TACTGTGGGATTGAGAAGGTGGG + Intergenic
902786787 1:18738152-18738174 GTGTGTGTGAATGTGTACGTGGG + Intronic
902976480 1:20092308-20092330 TGGTGTGGGATTGAGTTGGAAGG + Intergenic
903323247 1:22554958-22554980 TTGTGTGGGTGTGAGTGGGTGGG - Intergenic
904865459 1:33575340-33575362 TTCTGTGGGAAGTAGGAGGTGGG + Intronic
905318667 1:37099890-37099912 TTCTGTGGGACAGAGTTGGTGGG - Intergenic
905334299 1:37233629-37233651 TTCTGTGGGGATGGGAAGGTGGG - Intergenic
905965436 1:42090265-42090287 TAGTCTGGGAATGACTAGTTAGG - Intergenic
906245088 1:44267802-44267824 TTGTGTGGGTGTGGGCAGGTAGG - Intronic
906664531 1:47609929-47609951 TTGCTTGTGAATGAGTGGGTAGG + Intergenic
907195272 1:52681451-52681473 TACTGTGGGAAGCAGTAGGTTGG - Intergenic
912979709 1:114360395-114360417 TTCTGTGGGTATGAGTAAGTTGG + Intergenic
914291430 1:146277287-146277309 TTGAGGGGGAATGAGTAAGCTGG + Intergenic
914552474 1:148728070-148728092 TTGAGGGGGAATGAGTAAGCTGG + Intergenic
915460555 1:156068247-156068269 CTGGGTGGGAATGAGAAGGATGG - Intronic
915589784 1:156864275-156864297 TTGTGAGGGAGTAAGTGGGTGGG + Intronic
917506775 1:175634575-175634597 TTGTTTGGGACTTAGTATGTGGG + Intronic
920686545 1:208113289-208113311 ATGAGTAGGAATGAGTAGGTAGG - Intronic
920875817 1:209834542-209834564 ATGTGTTGGAATGGGTGGGTTGG + Intronic
921065589 1:211620294-211620316 TTGTGTGTGAATGTGTGTGTGGG - Intergenic
922375438 1:224959274-224959296 TTGTGGGGTAATGAGGAGGAGGG - Intronic
922874059 1:228926181-228926203 CTGTGTGTGAGTGAGAAGGTAGG + Intergenic
923479044 1:234365598-234365620 AGATGTGGGAATGAGTGGGTGGG + Intergenic
923678648 1:236101273-236101295 GTGTGTGTGAATGTGGAGGTGGG + Intergenic
1063690409 10:8281850-8281872 CTGTATTGGAAGGAGTAGGTAGG + Intergenic
1064042975 10:11984667-11984689 TTGTGGGGGACTCAGTAGATTGG - Intronic
1065901989 10:30216360-30216382 ATGAGTGGGAAGGAGTAGGATGG + Intergenic
1066054583 10:31668566-31668588 TTGTGGTGGTATTAGTAGGTGGG - Intergenic
1068591727 10:58859933-58859955 TTGTGTGGGAAAGAGAGGGAGGG - Intergenic
1068745346 10:60524067-60524089 TAGTGGTGGAATGAGTAAGTGGG - Intronic
1069542729 10:69307524-69307546 TTTTGTCGGAATGACAAGGTGGG + Intronic
1069881820 10:71597992-71598014 TGGTGTGGCAATGTGTAGGCAGG + Intronic
1070672533 10:78388216-78388238 TTGTGTGGGGAATAGCAGGTGGG + Intergenic
1071636011 10:87254836-87254858 TTGTGTGGGAGAGAGAAGATAGG - Intergenic
1071659229 10:87483108-87483130 TTGTGTGGGAGAGAGAAGATAGG + Intergenic
1072168567 10:92838174-92838196 ATGTGTGGGAATGAGTATGCGGG - Intronic
1074925261 10:118062503-118062525 TTGTGTAGGAAGGAGAGGGTGGG - Intergenic
1075383566 10:122038453-122038475 TGGGGAGGGAGTGAGTAGGTGGG + Intronic
1075665092 10:124224207-124224229 TTGTGTGTGCATGTGTATGTTGG - Intergenic
1076330862 10:129665207-129665229 GGGTGGGGGAGTGAGTAGGTGGG - Intronic
1076660183 10:132050673-132050695 TTGTATGGGAATGATCAGGGTGG - Intergenic
1076741074 10:132485693-132485715 ATGTGTGGGAATGAAGAGGCAGG - Intergenic
1077169599 11:1160315-1160337 GTGAGTGGGAATGAATAGATAGG + Intronic
1077927022 11:6691268-6691290 TTCTGTGGGTATGAGTAAGTTGG + Intergenic
1078086954 11:8239624-8239646 TTGTGTGTGAATGAGGGGATGGG + Intronic
1078887148 11:15512868-15512890 TTGTGTGGGTATTAAGAGGTGGG + Intergenic
1079489547 11:20972346-20972368 GTGTGTGTCAATGAGTAGTTAGG + Intronic
1079888299 11:26016943-26016965 TGGTGGGGGAATGGGCAGGTAGG - Intergenic
1080106635 11:28518063-28518085 TTGACTGGGAAGAAGTAGGTGGG + Intergenic
1080458571 11:32435423-32435445 GGGTGGGTGAATGAGTAGGTGGG + Exonic
1082858240 11:57828632-57828654 TTATGTGGCAATGAGTCTGTTGG - Intergenic
1083900006 11:65638936-65638958 TAGTGTGTGAAGGAGTAGGAGGG - Intronic
1084398798 11:68931855-68931877 TTGTGTAGGAGGGAGTAGGATGG + Intronic
1085723838 11:78936806-78936828 GTGTGTTAGAATGAGAAGGTGGG + Intronic
1086643379 11:89187542-89187564 TTATGTGGGAATGGGTAGCCAGG + Intronic
1088166857 11:106949621-106949643 TTGTGTGGGAAATATTAGGCTGG - Intronic
1088432038 11:109769184-109769206 TTGTGTGGGAGTGTGTAGGCTGG + Intergenic
1089409050 11:118223186-118223208 TTCTGTGGGTATAAGCAGGTTGG + Intronic
1089582501 11:119490074-119490096 CAGTGTGGTAATGAGTTGGTTGG - Intergenic
1091914982 12:4265190-4265212 TTCTATGGGAACGAGTTGGTTGG - Intergenic
1092281322 12:7099849-7099871 TTGGGTGGGAATGAGGTGGATGG + Intronic
1092944641 12:13441448-13441470 TAGTGGGGGAGTGGGTAGGTTGG + Intergenic
1096117897 12:49066427-49066449 TAGTGTGGGCATGAGGGGGTGGG - Intronic
1097518891 12:60643830-60643852 TTGTGTGGGAAACAGTGGCTAGG + Intergenic
1098564889 12:71922732-71922754 GTTTGTGGGAATGTGGAGGTGGG + Intronic
1098598976 12:72307043-72307065 ATGTGTGTGCATGTGTAGGTAGG + Intronic
1100272868 12:93043136-93043158 TTGTGTGGGCAGGAGTTGGGTGG + Intergenic
1100413803 12:94351180-94351202 TTGTGTGAGAAATGGTAGGTAGG + Intronic
1101863846 12:108504945-108504967 TTGTGTGGGGAAGAGCAGCTAGG - Intergenic
1104193681 12:126509384-126509406 TTGTGTGTGACTGTGTATGTTGG + Intergenic
1105205463 13:18219655-18219677 TCTTGTGGGAATGAGGATGTGGG + Intergenic
1105262748 13:18791902-18791924 TAGGGTGGGGAGGAGTAGGTTGG - Intergenic
1106912374 13:34476628-34476650 GTGTGTGGGAGGGTGTAGGTTGG - Intergenic
1107530861 13:41281058-41281080 TGGTCTGGGAAAGAGGAGGTGGG - Intergenic
1108551382 13:51549185-51549207 TTGTGAGGGCATGAGGAAGTAGG + Intergenic
1109231548 13:59763874-59763896 TTTTGTGTGAATAAGTAAGTTGG + Intronic
1109579436 13:64307705-64307727 TTGTGTGTGCATGAGTGTGTAGG - Intergenic
1109693524 13:65924097-65924119 TTGTGGGGGAAATATTAGGTTGG - Intergenic
1110366424 13:74691508-74691530 TTCTGAGGGAAGGAGTAGTTGGG - Intergenic
1110856328 13:80301198-80301220 TTGTCCGGGAATGAATATGTGGG - Intergenic
1111190736 13:84803420-84803442 GTGTGTGGGAATGCGGAGGCCGG + Intergenic
1114398333 14:22387119-22387141 TTGTGTGGAGATGCGCAGGTGGG + Intergenic
1116496498 14:45566852-45566874 TTGTGATGGTATTAGTAGGTGGG + Intergenic
1117376562 14:55123209-55123231 CAGTGTGGGAATCAGTGGGTGGG + Intergenic
1117557446 14:56900438-56900460 TTGTGTGGGAAGGAGGGTGTTGG - Intergenic
1117609992 14:57473363-57473385 TTGTGAGAGAAAGAGAAGGTAGG - Intronic
1119552515 14:75525278-75525300 TTGTGTGGGGATGTGTATGTGGG + Intronic
1119766520 14:77193262-77193284 TTGTGAGGGTATGAGTTGCTGGG + Intronic
1120576299 14:86185707-86185729 ATGAGTGGGAGTAAGTAGGTGGG + Intergenic
1122371683 14:101232521-101232543 ATGTGTGGGCATGTGTATGTGGG - Intergenic
1126879586 15:53080162-53080184 TTGTTTAGGAATGATTAGGAAGG - Intergenic
1127360006 15:58237050-58237072 GTGTGTGTGAATGGGTAAGTGGG + Intronic
1130774989 15:86969593-86969615 TTGCGTGGGAATGTGTATGTGGG + Intronic
1131143099 15:89993506-89993528 TAGGGTGGGAATGAGGAGGATGG - Intergenic
1131164106 15:90129813-90129835 GGGTGAGGGAATGAGTAGTTGGG + Intergenic
1131911887 15:97214609-97214631 TTGTGTTAGAATAAGTATGTTGG + Intergenic
1135633068 16:24051251-24051273 TTCTGTGAGAAGGAGCAGGTAGG + Intronic
1135924107 16:26677123-26677145 TTGAGTGGTAGTGAGTTGGTGGG - Intergenic
1138969732 16:62130313-62130335 AGGTGGGGGAATGAGTAGTTTGG - Intergenic
1140600757 16:76472152-76472174 TTGTATTGGAGTGAGTAGGGAGG + Intronic
1140621117 16:76734226-76734248 CTGTGTGGGAGTGAGTAGAAAGG - Intergenic
1141946041 16:87310782-87310804 TAGTGTGGGAAGGAGGAGGCAGG + Intronic
1143829306 17:9638259-9638281 TTGTGTGGGAGGCAGCAGGTTGG + Intronic
1146016963 17:29241465-29241487 TTGTGTGGGAATAAGCAGGATGG - Intergenic
1146516570 17:33494221-33494243 TTGTTTGGGGATCAGTAGGAAGG + Intronic
1147140891 17:38460129-38460151 TTGTGGGGGAATGAGGAAGGAGG - Intronic
1148620467 17:49030967-49030989 TTGTGTGTGTATGTGGAGGTGGG + Intronic
1150041679 17:61868815-61868837 TGTAGTGGGAATGAATAGGTAGG - Intronic
1151088485 17:71408163-71408185 TTGTCTGGGAATCAGTTGCTGGG - Intergenic
1151182506 17:72339463-72339485 GTGTATGGGACTGAGTAGGAAGG + Intergenic
1152881374 17:82817954-82817976 GTGTGTGTGAATGTGTAGCTGGG + Intronic
1153226327 18:2902820-2902842 TTGTGTGTGAAGGAGCAGGAGGG + Intronic
1153818294 18:8809866-8809888 CTGGGTGTGAATGAGGAGGTGGG + Intronic
1154430521 18:14304762-14304784 TAGTGTGGGGAGGAGTAGGCTGG + Intergenic
1155831334 18:30518123-30518145 TTGTGTAGGAATGAAAAGGTAGG + Intergenic
1156917355 18:42477379-42477401 GTGTGTGTGCATGTGTAGGTAGG + Intergenic
1157064172 18:44328054-44328076 TTGTGTGGGTGTGATTAGGGAGG - Intergenic
1157878761 18:51298672-51298694 ATTTGTGGGAATGAGTTGCTGGG + Intergenic
1159902450 18:74060309-74060331 GTGTGTGGAAAGGAGAAGGTAGG - Intergenic
1162683961 19:12366158-12366180 TGGTCTGAGAATGAGTAGATTGG - Intergenic
1164870858 19:31641496-31641518 ACGTGTGGGAGTGGGTAGGTAGG - Intergenic
1164977726 19:32586431-32586453 TTGTGTGGGAGAGAGCTGGTTGG + Intronic
1166288372 19:41846328-41846350 ATGTGAGGACATGAGTAGGTTGG + Intronic
1168143166 19:54403147-54403169 TTTTGCAGGAATGAGTGGGTGGG - Intergenic
1168692606 19:58386083-58386105 TTGCGTGGGATTGAGGATGTGGG - Intergenic
1168696489 19:58406771-58406793 CTGTGGGGGAATGAACAGGTTGG + Intronic
1202663903 1_KI270708v1_random:99041-99063 TTGTGTGTGTGTGTGTAGGTGGG - Intergenic
925507496 2:4584325-4584347 TGGTGGGGGAATGGGGAGGTGGG - Intergenic
925514267 2:4662863-4662885 TTCTGTTGGAATGAGAACGTGGG + Intergenic
926473706 2:13294436-13294458 TTGGGTGTGAATGTGTATGTAGG + Intergenic
928486152 2:31734341-31734363 TAGTGTGGGGAGGAATAGGTAGG + Intergenic
928739068 2:34328413-34328435 GGGTTTGGGATTGAGTAGGTGGG - Intergenic
929408654 2:41671796-41671818 TTGTGATGGTATGTGTAGGTGGG - Intergenic
929639240 2:43559607-43559629 TTGTGTGGGGATGAGTCTGCAGG - Intronic
930926996 2:56830095-56830117 TTTTGGGGGAATGAGGAGGGTGG + Intergenic
932081715 2:68721880-68721902 TGTCGTGGGAAGGAGTAGGTAGG - Intronic
932169383 2:69539709-69539731 GTGTGTGGGGATGAGAAGGTGGG - Intronic
932627012 2:73305595-73305617 TTGTGTGAGACTTAGAAGGTGGG + Intergenic
933096051 2:78182553-78182575 ATGTGTGGGAGTGAGTAGCTAGG - Intergenic
933921813 2:87055161-87055183 TTCTGTGTGAATGAGTGAGTGGG - Intergenic
934494372 2:94784491-94784513 TAGGGTGGGAATGAGTAGGCTGG - Intergenic
934768740 2:96894833-96894855 GTGTGGGGGGATGAGTGGGTGGG - Intronic
937085257 2:119167411-119167433 TTGTGTAGGCATGAGCAGGGAGG - Intergenic
937743432 2:125382762-125382784 TGAAGTGGGAGTGAGTAGGTAGG - Intergenic
939636068 2:144583992-144584014 GTGTGTGCGAATGTGTATGTAGG + Intergenic
940400564 2:153243729-153243751 TTCTGTGGGTATGAGCAAGTTGG + Intergenic
941197965 2:162473515-162473537 AGGTGAGGGAATGAGTAAGTGGG + Intronic
944463746 2:199979622-199979644 CTGTGTGGGTTTGAGTGGGTAGG - Intronic
944617367 2:201475478-201475500 TTGTGTGGGAAAGTGTTGTTTGG + Intronic
946120524 2:217509035-217509057 TTGTCTATGAATGAGGAGGTAGG + Intronic
948000756 2:234565264-234565286 TTGTGAGCAAATGTGTAGGTGGG - Intergenic
948026616 2:234783140-234783162 GTGTGTGTGAAATAGTAGGTGGG - Intergenic
948813767 2:240499432-240499454 GTATGTGGGAGTGACTAGGTGGG + Intronic
1169203876 20:3729477-3729499 TTGTGTGTGCATGAGTGTGTGGG + Intergenic
1171063572 20:21990770-21990792 CGGTGTTGGAATAAGTAGGTTGG + Intergenic
1171290505 20:23980321-23980343 TTGTGTGTGTATGAGTGTGTGGG - Intergenic
1171864840 20:30479145-30479167 TTTTGTTGGATTGAGCAGGTTGG - Intergenic
1173833970 20:46113071-46113093 CGGTGTGGGAATGGGCAGGTGGG + Intergenic
1175024765 20:55890143-55890165 CAGCGTGGGAATGAGTGGGTTGG + Intergenic
1178183505 21:30192095-30192117 TTATGTGGGAATATCTAGGTAGG - Intergenic
1178523316 21:33303957-33303979 TTGGGAGGAAATGAGTAGGATGG + Intergenic
1178897951 21:36576210-36576232 ATGTGTTGTAATGAGTAGATTGG - Intronic
1178938892 21:36888298-36888320 ATGTTTGGGACTGACTAGGTAGG + Intronic
1181856218 22:25783391-25783413 TAATGTGGGAAGGAGTAGGTAGG + Intronic
1183749088 22:39709153-39709175 GTGTGTGGGTCTGAGTAGGCTGG + Intergenic
1184478369 22:44733779-44733801 CTGTGTTACAATGAGTAGGTGGG - Intronic
1184815815 22:46868923-46868945 CTGTGTGGGTAGGAGTAGGTGGG + Intronic
949721652 3:6997579-6997601 TGTTGTGGGAAGGACTAGGTGGG - Intronic
949845428 3:8365541-8365563 TTTGGTGGGGATGGGTAGGTGGG - Intergenic
949894140 3:8756857-8756879 TTGTGTGGAAATGCGGAGGGAGG - Intronic
950122028 3:10488300-10488322 TTGTGAGTGAATGAATAGATAGG - Intronic
950650588 3:14404323-14404345 TGGGGTGGGCATGAGGAGGTGGG + Intronic
953361605 3:42301955-42301977 TGGTGTGCGTGTGAGTAGGTGGG + Intergenic
953463691 3:43101871-43101893 TTGTGTGGGAAGGAATGGGTTGG - Intronic
953716208 3:45319029-45319051 TTCTGTGGGAAAGATAAGGTGGG - Intergenic
954856225 3:53646130-53646152 ATGTGTGGGAGGGAGCAGGTTGG + Intronic
955760812 3:62280193-62280215 TTGTGTGTGAGTAAGTAGGTTGG - Intronic
956245143 3:67174564-67174586 ATATGTAGGAATCAGTAGGTGGG + Intergenic
956358034 3:68415478-68415500 TTGTGTTGGAGTGAGGAGGTTGG + Intronic
958802597 3:98773835-98773857 TTGTGTGGGAGGGAGTAAGGTGG + Intronic
958968356 3:100584269-100584291 TTCTGTGGGCATGAGCAAGTTGG - Intergenic
960610419 3:119550254-119550276 TTGGCTGGGAATGAATAGTTCGG - Intronic
961846947 3:129773316-129773338 TTGTGTGGGAAGGCGAAGGGGGG + Intronic
962912404 3:139864971-139864993 TTGTCTGGAGATGAGTAGGCAGG - Intergenic
964335116 3:155646480-155646502 GAGTGTGGGAATGAGGAGGCTGG - Intronic
964970140 3:162550147-162550169 TTTTGTGGGTATGAGCAAGTTGG - Intergenic
965441143 3:168716195-168716217 TTGTGTGGCAAGGAGAGGGTAGG + Intergenic
965467005 3:169042156-169042178 TTCTGTGGGACTTAGTAAGTGGG - Intergenic
967050398 3:185778146-185778168 TTGTATTGGAATAAGCAGGTTGG - Intronic
967289091 3:187901965-187901987 TTTTGTGGAAAGGAGAAGGTTGG + Intergenic
969632102 4:8344814-8344836 TTGTTTGGGGGTGAGCAGGTGGG + Intergenic
970338714 4:15082099-15082121 TTGTTTGGGCATGTGTAAGTGGG + Intergenic
971650213 4:29262144-29262166 TTGTGTGTGAAAGAGAAGTTGGG - Intergenic
972602056 4:40581599-40581621 TTGTGAGTGGATGAGAAGGTGGG + Intronic
973293048 4:48489590-48489612 TTTTGTAGGAATGATTTGGTTGG + Intergenic
973825997 4:54708259-54708281 TTGAGTGGGATTGTTTAGGTAGG + Intronic
978748970 4:112225647-112225669 TAATATGGGAATCAGTAGGTAGG - Intergenic
981780006 4:148418317-148418339 TTGTGTGGGTATGTGTGTGTGGG - Intronic
982102703 4:151983827-151983849 TTCTGTAGGAGTGAGGAGGTGGG - Intergenic
982245752 4:153348627-153348649 TCCTGTGGGAATGAGTTAGTGGG + Intronic
982350340 4:154408586-154408608 TTGTGTGGGAATGAGTGCTAAGG - Intronic
983167925 4:164499685-164499707 TTGTGTGGAAATGAGCTGGATGG - Intergenic
984378966 4:178965949-178965971 TTGTGTTGGTATGTGGAGGTGGG + Intergenic
985095180 4:186406245-186406267 TTGTGTGGGTGTGAGTGTGTGGG - Intergenic
985637165 5:1042004-1042026 TAGTGCGTGAATGAGTGGGTGGG + Intergenic
985637225 5:1042566-1042588 TAGTGTGTGAATGAGTGGGTGGG + Intergenic
985637231 5:1042614-1042636 TAGTGTGTGAATGAGTGGGTGGG + Intergenic
985637334 5:1043626-1043648 TAGTTTGTGAATGAGTGGGTGGG + Intergenic
985637342 5:1043704-1043726 TAGTGTGTGAATAAGTGGGTGGG + Intergenic
985637436 5:1044597-1044619 TAGTGTGTGAATGAGTCAGTGGG + Intergenic
985637515 5:1045354-1045376 TAGTGTGTGAATGACTGGGTGGG + Intergenic
985637612 5:1046291-1046313 TAGTGTGTGAATGAGTCAGTGGG + Intergenic
985637636 5:1046519-1046541 TAGTGTGTGAATGAGTGGGTGGG + Intergenic
985637659 5:1046747-1046769 TAGTGTGTGAATGAGTCGGTGGG + Intergenic
985637706 5:1047258-1047280 TAGTGTGTGAATGAGTGGGTGGG + Intergenic
985637712 5:1047322-1047344 TAGTGTGTGAATGAGTCGGTGGG + Intergenic
985637716 5:1047346-1047368 TAGTGTGTGAATGAGTGGGTGGG + Intergenic
985637763 5:1047812-1047834 TAGTGTGTGAATGAGTGGGTGGG + Intergenic
985637823 5:1048301-1048323 TAGTGCGTGAATGAGTGGGTGGG + Intergenic
985637867 5:1048676-1048698 TAGTGTGTGAATGAGTGGGTGGG + Intergenic
986731216 5:10636263-10636285 TTGAGTTGGAATGAATAAGTGGG + Intronic
987257251 5:16168700-16168722 TTGTGTGGGAATGAGTAGGTGGG - Intronic
987475801 5:18391566-18391588 TTGAGTGGGAATGTGTGGGCAGG - Intergenic
988660024 5:33255769-33255791 TTGTGAGGGAGTGAGGAAGTAGG - Intergenic
988997119 5:36725171-36725193 GTGTGTGGGAGGGAGTAGGAAGG + Intergenic
989328654 5:40229259-40229281 TGGTTGGGGAATGAGTAGGGAGG - Intergenic
989777636 5:45227945-45227967 ATGTGAGGGTATGAGTAGGTGGG + Intergenic
989792738 5:45425993-45426015 TTCTGTGGGAATGAGAAGATAGG + Intronic
993354755 5:86892235-86892257 TTGTGTGAGAAGGAGAAGGAAGG - Intergenic
993704461 5:91153854-91153876 TTGAGTGGGACTGAGTAAATAGG - Intronic
993885154 5:93407532-93407554 TGGTGTGTGAGTGTGTAGGTTGG - Intergenic
996105529 5:119497499-119497521 TTGTGTGGGAATTTGTATTTGGG + Intronic
996131067 5:119781091-119781113 TTGTGTGGCAACCAGTAGTTAGG + Intergenic
997971654 5:138407773-138407795 TTGTGTGGGGAACAGCAGGTAGG - Intronic
998150014 5:139751438-139751460 CTGTGTGAGTATGTGTAGGTGGG - Intergenic
998252073 5:140560283-140560305 ATGGGTGGGAATGGGTTGGTGGG - Intronic
998433834 5:142089749-142089771 TAGGGTGGGAGTGAGTGGGTGGG + Intergenic
998793645 5:145793740-145793762 TCGTGTGGGAATGAGTAGAAAGG - Intronic
1000577211 5:162989032-162989054 TTGTGTTGGTATTGGTAGGTAGG - Intergenic
1001567308 5:172707839-172707861 GTGTGTGTGAATGTGTGGGTGGG + Intergenic
1002109393 5:176898103-176898125 GTGTGTGGGAATGGGGAGGAGGG - Intronic
1006631060 6:35430137-35430159 TAGTGTGGGAAAGAATAGGGAGG - Intergenic
1007536808 6:42598569-42598591 GGGTGTGGGAGTGAGTAGGGAGG + Intronic
1008178826 6:48302409-48302431 TTTTCTGGGAATGAATAGCTTGG + Intergenic
1008879226 6:56363780-56363802 TTGTTTGGGAATGTGTCGGGGGG - Intronic
1010762207 6:79736344-79736366 TTGTGTGGGATTCTGTTGGTGGG - Intergenic
1011560253 6:88606889-88606911 TTAGGTGAGAATGAGTAGGTAGG + Intergenic
1011563708 6:88650366-88650388 AAGTTTCGGAATGAGTAGGTTGG - Intronic
1014297779 6:119641530-119641552 TTGTGTGTGTATGTTTAGGTGGG + Intergenic
1014926452 6:127276661-127276683 AGGTGTGGGAATGAGTAGGCTGG + Intronic
1016282023 6:142429372-142429394 TTGTGAGGGACTGAATTGGTGGG - Intronic
1017717897 6:157224783-157224805 TTGTGTGGGGATGAGCTGTTAGG + Intergenic
1018005829 6:159620661-159620683 TTTTGGGGGGATGAGTTGGTTGG + Intergenic
1018164562 6:161081071-161081093 TGGTGTGAGAGTGAGAAGGTGGG - Intronic
1018746516 6:166766526-166766548 TTCTGTGGGAGTTAGGAGGTGGG + Intronic
1019333603 7:472228-472250 TTCTGTGGGAAAGAGTCTGTCGG + Intergenic
1019703698 7:2487596-2487618 TGGTGTGGGAAGGAGCTGGTCGG + Intergenic
1020039027 7:4987362-4987384 CTGGGTGGCAATGAGAAGGTGGG - Intronic
1023587110 7:41742402-41742424 ATGTGTGGGTGTGTGTAGGTGGG - Intergenic
1024123360 7:46267296-46267318 ATGTGTGGGACTGTGGAGGTGGG + Intergenic
1024733101 7:52274270-52274292 TTGTGTGTGAAGGAGAAGGCAGG - Intergenic
1026574554 7:71561335-71561357 TTCTTTGGCAATCAGTAGGTTGG - Intronic
1027371677 7:77512755-77512777 TTGTGATGGTATGAGGAGGTGGG + Intergenic
1027891245 7:83978383-83978405 TTGCCTGGGAAGGAGGAGGTAGG + Intronic
1029321846 7:99769389-99769411 TTGGTTGGCAGTGAGTAGGTTGG - Intronic
1029580600 7:101434598-101434620 TTGTGTGTGAGTGAGTGTGTTGG + Intronic
1029804944 7:102986287-102986309 GTGTGTGGGGATGGGGAGGTTGG + Intronic
1032086735 7:128887854-128887876 TTGTGTGGCTGTGTGTAGGTGGG - Intronic
1033978363 7:147130741-147130763 TAATGAGGGAATGAGTATGTGGG - Intronic
1034160404 7:148990283-148990305 TTGTGGGGGAAAGGGTAGGAAGG + Intergenic
1034535246 7:151721966-151721988 TTGTGTGGGAAGGAGTAGTCAGG - Intronic
1034937188 7:155207891-155207913 GTGTGTGGGAATGTGTGTGTGGG + Intergenic
1034937194 7:155207923-155207945 GTGTGTGGGAATGGGTATGTGGG + Intergenic
1034937319 7:155208555-155208577 GTGTGTGGGAATGGGTGTGTGGG + Intergenic
1034937340 7:155208656-155208678 GTGTGTGGGAATGTGTGTGTGGG + Intergenic
1034937351 7:155208706-155208728 GTGTGTGGGAATGTGTGTGTGGG + Intergenic
1034937369 7:155208786-155208808 GTGTGTGGGAATGTGTGTGTGGG + Intergenic
1037011452 8:13848139-13848161 TTATTTGGGAAAGAGTATGTTGG + Intergenic
1037931287 8:22881816-22881838 TTGTGTGGCCGTGAGCAGGTGGG + Intronic
1040950803 8:52937712-52937734 TTCTGTGGGAAGGAGTAAGATGG - Intergenic
1041088350 8:54278604-54278626 GGGTGTGGGAATGAGTGTGTGGG - Intergenic
1041182383 8:55262429-55262451 TTGTGATGGAATTAGGAGGTGGG + Intronic
1042844589 8:73157663-73157685 AGGTGTTGGAATGAGTAGATAGG + Intergenic
1044647173 8:94456192-94456214 TTGTGTGAGAATGAAGATGTAGG - Intronic
1044896394 8:96896993-96897015 TGGTGTGGGAATCAGAAGATGGG - Intronic
1045253853 8:100503003-100503025 TGGGGTGGGAATGAGGTGGTAGG + Intergenic
1045956310 8:107911915-107911937 TTGTGTGGGATTGAGCAGGAAGG - Intronic
1045956716 8:107916696-107916718 TTCTGTGGGTATGAGCAAGTTGG + Intronic
1046490484 8:114946019-114946041 TTCTGTGGGTATGAGTAAGTTGG + Intergenic
1047370247 8:124250271-124250293 GTGTGGGTGGATGAGTAGGTGGG - Intergenic
1047455345 8:125003872-125003894 TTGTGTGGGGATGGGGTGGTGGG + Intronic
1048880772 8:138870931-138870953 GTGTGTGGGTGTGTGTAGGTGGG + Intronic
1049717784 8:144101169-144101191 TGGTGTGGGAATGAGAATGGTGG - Intronic
1050050889 9:1600337-1600359 ATCTGTAGGAATGAGGAGGTAGG - Intergenic
1050056433 9:1660269-1660291 TTGTGTGCCTATGAGCAGGTAGG - Intergenic
1051140451 9:13973365-13973387 TTTTGTGGGAATGAAGATGTTGG - Intergenic
1051281576 9:15446702-15446724 TTCTGTGGGAAAGACAAGGTAGG + Intronic
1052010962 9:23408871-23408893 TGGTGTGTGAATCAGTAGGTTGG + Intergenic
1052311109 9:27070215-27070237 CTGGGTGGGAAGGAGTAGGATGG + Intergenic
1052879305 9:33591036-33591058 TAGGGTGGGGAGGAGTAGGTTGG + Intergenic
1053496673 9:38553182-38553204 TAGGGTGGGGAGGAGTAGGTTGG - Intronic
1053662754 9:40295877-40295899 TAGGGTGGGAATGAGTAGGCTGG + Intronic
1053663647 9:40301978-40302000 TTAGGTGGGGAGGAGTAGGTTGG + Intronic
1053913200 9:42926052-42926074 TAGGGTGGGAATGAGTAGGCTGG + Intergenic
1053914161 9:42932520-42932542 TTAGGTGGGGAGGAGTAGGTTGG + Intergenic
1054335190 9:63800518-63800540 TTGTGTGGTGATGAGAATGTAGG + Intergenic
1054374883 9:64442101-64442123 TAGGGTGGGAATGAGTAGGCTGG + Intergenic
1054375771 9:64448211-64448233 TTAGGTGGGGAGGAGTAGGTTGG + Intergenic
1054520968 9:66074307-66074329 TTAGGTGGGGAGGAGTAGGTTGG - Intergenic
1054521859 9:66080407-66080429 TAGGGTGGGAATGAGTAGGCTGG - Intergenic
1055216888 9:73874806-73874828 TAGTGTTTGAAGGAGTAGGTAGG + Intergenic
1055453604 9:76453276-76453298 GTGTGTAGGAATGGGTAGATGGG + Intronic
1056753432 9:89367881-89367903 TGGGGTGGGAGTGAGCAGGTGGG - Intronic
1057676585 9:97140742-97140764 TAGGGTGGGGAGGAGTAGGTTGG - Intergenic
1057754345 9:97819925-97819947 TTGTGTGTGTGTGTGTAGGTGGG + Intergenic
1059058172 9:111006303-111006325 ATGTGTGGGATTGACTAGGAAGG - Intronic
1059661392 9:116405430-116405452 TTGTGGAAGTATGAGTAGGTAGG + Intergenic
1060306647 9:122419605-122419627 TTCTGTGGGTATGAGCAAGTTGG - Intergenic
1060896100 9:127218623-127218645 GAGTCTGGGAATGAGCAGGTTGG - Intronic
1061071065 9:128311057-128311079 ATGTGGGGGAAAGGGTAGGTGGG - Intronic
1061830450 9:133289841-133289863 TTCTGTGGGTATGAGCAAGTTGG - Intergenic
1185708829 X:2285936-2285958 TTGTGTGCAAATGAGAAGGCTGG - Intronic
1186225942 X:7399135-7399157 TTCTGTGGGAATGAGAGGCTTGG + Intergenic
1186428096 X:9480437-9480459 TTCTGTGGGTATGAGCAAGTTGG + Intronic
1186568077 X:10685865-10685887 GTGTGTGTGTATGAGTATGTGGG - Intronic
1187963215 X:24585853-24585875 TTGTGTGGGAAGGAGCAACTGGG - Intronic
1188159074 X:26778244-26778266 TTGTGTGGGGAAGAGCAGCTGGG + Intergenic
1188571071 X:31585512-31585534 GGGAGTGGGAATGAGTAGGGAGG - Intronic
1189363126 X:40368695-40368717 GTGTGTGGGAGTGAGGAGGTTGG + Intergenic
1189489719 X:41460779-41460801 TTGCCTGGGGATGAGTAGGGAGG - Intronic
1189768807 X:44401218-44401240 TTGTGAGGGTATGAGGAGGTGGG + Intergenic
1190385900 X:49881915-49881937 TTGTGTGGGAAAGTGTGGGGGGG + Exonic
1195538975 X:106040781-106040803 TTGTGTGGGAATAATTATGAGGG - Intergenic
1196262952 X:113607075-113607097 TTCTGTGGGAATGAATGTGTAGG - Intergenic
1196707626 X:118729218-118729240 GTGTGTGGGAGTGAGTCTGTAGG - Intronic
1197413202 X:126143212-126143234 TGTTGTGGGAGGGAGTAGGTTGG - Intergenic
1197635809 X:128913840-128913862 TTGTGTGTGGATGAGTAGGGAGG - Intergenic
1199757174 X:150875512-150875534 GTGTGGGGGAAAGAGGAGGTGGG - Intronic
1201535122 Y:15038805-15038827 GTGTGTGGGAGTGAGTGGGTTGG - Intergenic