ID: 987260172 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:16195242-16195264 |
| Sequence | ACTGATGTTGCTTGGCCCCC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 987260172_987260175 | 4 | Left | 987260172 | 5:16195242-16195264 | CCAGGGGGCCAAGCAACATCAGT | No data | ||
| Right | 987260175 | 5:16195269-16195291 | GGATCAGCAGCATCAGTCTGTGG | No data | ||||
| 987260172_987260176 | 5 | Left | 987260172 | 5:16195242-16195264 | CCAGGGGGCCAAGCAACATCAGT | No data | ||
| Right | 987260176 | 5:16195270-16195292 | GATCAGCAGCATCAGTCTGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 987260172 | Original CRISPR | ACTGATGTTGCTTGGCCCCC TGG (reversed) | Intergenic | ||