ID: 987260176

View in Genome Browser
Species Human (GRCh38)
Location 5:16195270-16195292
Sequence GATCAGCAGCATCAGTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987260172_987260176 5 Left 987260172 5:16195242-16195264 CCAGGGGGCCAAGCAACATCAGT No data
Right 987260176 5:16195270-16195292 GATCAGCAGCATCAGTCTGTGGG No data
987260166_987260176 26 Left 987260166 5:16195221-16195243 CCCTTAGGAAGGGGGCTAAATCC No data
Right 987260176 5:16195270-16195292 GATCAGCAGCATCAGTCTGTGGG No data
987260174_987260176 -3 Left 987260174 5:16195250-16195272 CCAAGCAACATCAGTCTGTGGAT No data
Right 987260176 5:16195270-16195292 GATCAGCAGCATCAGTCTGTGGG No data
987260167_987260176 25 Left 987260167 5:16195222-16195244 CCTTAGGAAGGGGGCTAAATCCA No data
Right 987260176 5:16195270-16195292 GATCAGCAGCATCAGTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987260176 Original CRISPR GATCAGCAGCATCAGTCTGT GGG Intergenic
No off target data available for this crispr