ID: 987261679

View in Genome Browser
Species Human (GRCh38)
Location 5:16210773-16210795
Sequence TAAGGGTCCAAGGATTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987261675_987261679 9 Left 987261675 5:16210741-16210763 CCTATCAATAAACTCTTTTTTAA No data
Right 987261679 5:16210773-16210795 TAAGGGTCCAAGGATTCTCTTGG No data
987261674_987261679 10 Left 987261674 5:16210740-16210762 CCCTATCAATAAACTCTTTTTTA No data
Right 987261679 5:16210773-16210795 TAAGGGTCCAAGGATTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987261679 Original CRISPR TAAGGGTCCAAGGATTCTCT TGG Intergenic
No off target data available for this crispr