ID: 987269378

View in Genome Browser
Species Human (GRCh38)
Location 5:16290386-16290408
Sequence CATTGTGGCAGGAGCAGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987269366_987269378 24 Left 987269366 5:16290339-16290361 CCTAATGAAGGAGCACGCCTAGG No data
Right 987269378 5:16290386-16290408 CATTGTGGCAGGAGCAGAGGGGG No data
987269364_987269378 26 Left 987269364 5:16290337-16290359 CCCCTAATGAAGGAGCACGCCTA No data
Right 987269378 5:16290386-16290408 CATTGTGGCAGGAGCAGAGGGGG No data
987269363_987269378 27 Left 987269363 5:16290336-16290358 CCCCCTAATGAAGGAGCACGCCT No data
Right 987269378 5:16290386-16290408 CATTGTGGCAGGAGCAGAGGGGG No data
987269371_987269378 -4 Left 987269371 5:16290367-16290389 CCACGGAGAGCAAAGGAACCATT No data
Right 987269378 5:16290386-16290408 CATTGTGGCAGGAGCAGAGGGGG No data
987269369_987269378 7 Left 987269369 5:16290356-16290378 CCTAGGATGTTCCACGGAGAGCA No data
Right 987269378 5:16290386-16290408 CATTGTGGCAGGAGCAGAGGGGG No data
987269365_987269378 25 Left 987269365 5:16290338-16290360 CCCTAATGAAGGAGCACGCCTAG No data
Right 987269378 5:16290386-16290408 CATTGTGGCAGGAGCAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987269378 Original CRISPR CATTGTGGCAGGAGCAGAGG GGG Intergenic
No off target data available for this crispr