ID: 987269483

View in Genome Browser
Species Human (GRCh38)
Location 5:16291529-16291551
Sequence TTTGCTTCAGGATCCACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987269479_987269483 -1 Left 987269479 5:16291507-16291529 CCTACATTACTAATTTTTTCCTT No data
Right 987269483 5:16291529-16291551 TTTGCTTCAGGATCCACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987269483 Original CRISPR TTTGCTTCAGGATCCACTGT GGG Intergenic