ID: 987270656

View in Genome Browser
Species Human (GRCh38)
Location 5:16305011-16305033
Sequence GGCCAGACCCACTTTGTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987270653_987270656 2 Left 987270653 5:16304986-16305008 CCTCACTGCACATCGTCGGTAGA No data
Right 987270656 5:16305011-16305033 GGCCAGACCCACTTTGTGGTCGG No data
987270652_987270656 3 Left 987270652 5:16304985-16305007 CCCTCACTGCACATCGTCGGTAG No data
Right 987270656 5:16305011-16305033 GGCCAGACCCACTTTGTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987270656 Original CRISPR GGCCAGACCCACTTTGTGGT CGG Intergenic
No off target data available for this crispr