ID: 987283376

View in Genome Browser
Species Human (GRCh38)
Location 5:16433589-16433611
Sequence AATAGGATAATGAACCTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987283376_987283378 0 Left 987283376 5:16433589-16433611 CCATGAAGGTTCATTATCCTATT No data
Right 987283378 5:16433612-16433634 CTCTCTACTTTCTGTATGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987283376 Original CRISPR AATAGGATAATGAACCTTCA TGG (reversed) Intergenic
No off target data available for this crispr