ID: 987284438

View in Genome Browser
Species Human (GRCh38)
Location 5:16441572-16441594
Sequence GGCCCTACCCCTTCTGCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987284438_987284447 11 Left 987284438 5:16441572-16441594 CCAACTGCAGAAGGGGTAGGGCC No data
Right 987284447 5:16441606-16441628 AGCTCTCTTCTGCTAAGGGAGGG No data
987284438_987284444 6 Left 987284438 5:16441572-16441594 CCAACTGCAGAAGGGGTAGGGCC No data
Right 987284444 5:16441601-16441623 AGGGCAGCTCTCTTCTGCTAAGG No data
987284438_987284445 7 Left 987284438 5:16441572-16441594 CCAACTGCAGAAGGGGTAGGGCC No data
Right 987284445 5:16441602-16441624 GGGCAGCTCTCTTCTGCTAAGGG No data
987284438_987284446 10 Left 987284438 5:16441572-16441594 CCAACTGCAGAAGGGGTAGGGCC No data
Right 987284446 5:16441605-16441627 CAGCTCTCTTCTGCTAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987284438 Original CRISPR GGCCCTACCCCTTCTGCAGT TGG (reversed) Intergenic
No off target data available for this crispr