ID: 987286514

View in Genome Browser
Species Human (GRCh38)
Location 5:16463317-16463339
Sequence ACAAATAGTGAGATTTAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987286514 Original CRISPR ACAAATAGTGAGATTTAATC TGG (reversed) Intronic
901547244 1:9967544-9967566 ACAAATAGAGATTTTTCATCTGG + Intronic
907998680 1:59658745-59658767 AGAAACAGTGAGATTTGCTCAGG + Intronic
909564270 1:77037626-77037648 GCAAATAGTAAGATCTAAGCAGG + Intronic
910306440 1:85769645-85769667 ACAAGGAGAGAGATGTAATCAGG + Intronic
912686493 1:111771353-111771375 GCAAATAATGAGATTTCATTAGG + Intronic
912958495 1:114173846-114173868 GCAGAGAGTTAGATTTAATCAGG + Intergenic
914713946 1:150238750-150238772 AAAAAGAGTGAAATTTAGTCAGG + Intergenic
916950633 1:169776826-169776848 GCAGATAGTGGGATTTAAACAGG - Intronic
918704580 1:187644503-187644525 ACTAATATTGAGATATAATATGG - Intergenic
918813693 1:189154498-189154520 ACAGATAGTGACATATAATATGG - Intergenic
921832040 1:219738528-219738550 ACAAATAGAGAAATTTAAATAGG - Intronic
922403327 1:225284470-225284492 ACAAATAAGGAGATTTAATTAGG + Intronic
1063899302 10:10715818-10715840 AGAAATAGTGATATTTAAACTGG + Intergenic
1064469631 10:15622675-15622697 AAAAATATTAACATTTAATCAGG - Intronic
1064830365 10:19458027-19458049 AAAAATAGTCATATATAATCAGG - Intronic
1067050251 10:43011975-43011997 ACAAATAGTGATAATTCCTCTGG - Intergenic
1067950550 10:50733081-50733103 ACAAATTGTGAAATGTATTCTGG + Intergenic
1070089881 10:73274048-73274070 ACAAAGGGTTATATTTAATCTGG - Intronic
1070176608 10:73976051-73976073 ACAATGGGTGAGATTTAAACTGG - Intergenic
1070416390 10:76193980-76194002 ACAAATAATGGCATTTATTCAGG + Intronic
1070885892 10:79898317-79898339 ACAAATTGTGAAATGTATTCTGG + Intergenic
1071154578 10:82674149-82674171 GCAAGTAGTTAGATTTATTCAGG + Intronic
1073551015 10:104401274-104401296 ATCAATATTGAAATTTAATCTGG + Intronic
1074735172 10:116423644-116423666 ACAAATATTTACCTTTAATCAGG - Intergenic
1075020805 10:118950783-118950805 AAAAATATTCAAATTTAATCGGG + Intergenic
1075341753 10:121652012-121652034 TAAAATAGTGAGATTCAATGTGG - Intergenic
1080835509 11:35936955-35936977 ACAAATGGTCAGTTTTAAGCAGG - Intergenic
1084865304 11:72051391-72051413 AGAATTAATGAAATTTAATCAGG + Intronic
1085228150 11:74941372-74941394 ACAAATAATGAGACTTGAACTGG + Intronic
1092195199 12:6545392-6545414 AGAGAGAGTGAGATTTTATCAGG - Intronic
1093012402 12:14122593-14122615 ACAAGGAGTGAGATTTAAGTTGG - Intergenic
1094104217 12:26792742-26792764 ACAAAGAGGGAGAGTTAATTGGG - Intronic
1095543926 12:43343377-43343399 ACAAAGAGGAAGAATTAATCTGG - Intergenic
1095811544 12:46377096-46377118 ACAAGTTGTGATATTTAAGCTGG - Intergenic
1096565457 12:52473905-52473927 ACAAATAGTGAGATCACACCTGG + Intergenic
1097651714 12:62306794-62306816 AAAAAAAGTGTGATCTAATCTGG + Intronic
1098042943 12:66370468-66370490 ACAAATAGCTAGGTTTAATAAGG + Intronic
1098175064 12:67781650-67781672 GCAGATAGTCAGATTTAACCAGG + Intergenic
1098437763 12:70486155-70486177 CCAACTACTGAGATTTTATCAGG - Intergenic
1098484947 12:71009926-71009948 GCACAGATTGAGATTTAATCAGG - Intergenic
1098660360 12:73086413-73086435 ACTAATAAGGTGATTTAATCAGG + Intergenic
1098893673 12:76033444-76033466 AAAAAAAATGAGATGTAATCTGG + Exonic
1104098202 12:125580577-125580599 AGAAAGTGTGAGATTTAAGCAGG + Intronic
1105342491 13:19540267-19540289 AATAATAATGAGATTTAATTGGG - Intergenic
1105427724 13:20309250-20309272 AAAGATAGTGACATTTCATCAGG + Intergenic
1106008810 13:25797939-25797961 TTAAATAGTCAGATTTAATCAGG - Intronic
1107198240 13:37681475-37681497 ATAAAAAGTGATATTCAATCTGG - Intronic
1107202827 13:37742326-37742348 CCAAATAGTGCAATTTATTCAGG + Intronic
1108312143 13:49204488-49204510 CCAAAGAGTCAGATTAAATCTGG + Intronic
1108632368 13:52298793-52298815 AGAAGTAATGAGATTGAATCAGG - Intergenic
1108654334 13:52513800-52513822 AGAAGTAATGAGATTGAATCAGG + Intergenic
1109815674 13:67580753-67580775 ACAAATAATGAGACTAAATTAGG - Intergenic
1112069981 13:95839076-95839098 ACAGAGATTGAGATTTAATCAGG - Intronic
1112186011 13:97128324-97128346 AAAAATAGTTACAATTAATCAGG + Intergenic
1113029864 13:105981506-105981528 ACAAATTGTGCTATTAAATCCGG + Intergenic
1115439531 14:33416347-33416369 AGATATACTGAGATTTTATCTGG + Intronic
1116234497 14:42260984-42261006 AGAAATATTGAGATTTTTTCAGG + Intergenic
1116484118 14:45426381-45426403 ACGAATAGCGAGATTTAATCAGG - Intergenic
1116606080 14:46997179-46997201 ACAAATAACTAGATTTAATTGGG + Intronic
1120860568 14:89251537-89251559 ACATATAATGATATTTAATGTGG + Intronic
1121871450 14:97411825-97411847 ACAAAATGTGACATTTAAGCAGG + Intergenic
1124098047 15:26667534-26667556 ACAAAAGGTGTGGTTTAATCAGG + Intronic
1125212530 15:37234020-37234042 ACAAATAGTGAAATATATGCAGG + Intergenic
1125351483 15:38771955-38771977 ATAAATGGTGAGAGTTAATAAGG + Intergenic
1128209231 15:65882205-65882227 ACCAACAGTGAGATTTATGCAGG - Intronic
1128840822 15:70850189-70850211 ACAAGTAAGGAGATTGAATCAGG + Intronic
1130788013 15:87121945-87121967 AGAGATAGTGAGATATAATGGGG + Intergenic
1132578342 16:674098-674120 ACACACAGTGAAGTTTAATCAGG - Exonic
1137961678 16:52887602-52887624 AAAAACAGTGACATTTAAGCAGG + Intergenic
1140286841 16:73611068-73611090 ACAAACAGAAAGGTTTAATCTGG - Intergenic
1140318473 16:73922989-73923011 ACAAATGGTGAGATTTTATATGG + Intergenic
1143643217 17:8211720-8211742 AAAAAAAGTGAGATTTAAATAGG - Intergenic
1146733984 17:35221354-35221376 ACAAATTCTTAGATTAAATCTGG - Intergenic
1147163433 17:38580576-38580598 ATAAATATTGAGATCAAATCAGG - Intronic
1153523277 18:5971973-5971995 TCAAATAGTTTGATTTAATAGGG - Intronic
1153570257 18:6464622-6464644 GCAAATAGTGAAAATTAATGAGG - Intergenic
1155112711 18:22732154-22732176 TCATGTAGTGAAATTTAATCTGG + Intergenic
1156365349 18:36420989-36421011 ACAAATGGTGAGGTTAAATTTGG + Intronic
1158096586 18:53779114-53779136 TCAAAAAGTCAGATCTAATCAGG - Intergenic
1164247388 19:23443718-23443740 ATAAATGGTTAGATTTAATTTGG + Intergenic
1167962684 19:53119873-53119895 ACCAATAATGAAATTTAATCAGG + Intronic
926990361 2:18673097-18673119 ACAAGCAGTGAGATTGACTCAGG - Intergenic
929421028 2:41789693-41789715 ACAAATATCAAGATTGAATCTGG - Intergenic
929634794 2:43507730-43507752 ATATATAGTAAGATTAAATCCGG - Intronic
930498743 2:52183451-52183473 ACAAAGACTGTGATTTATTCTGG - Intergenic
936734942 2:115428982-115429004 ACAAATATTCAGATTATATCAGG + Intronic
939070665 2:137537439-137537461 TGAAATAGTGATAGTTAATCTGG + Intronic
939112757 2:138028075-138028097 ACAAAGAGTTAGATTTAAGTAGG - Intergenic
939909828 2:147966684-147966706 ACAAATAATGAGGTAGAATCAGG + Intronic
940332845 2:152493864-152493886 ACAAATAGTCACCTTTAATTTGG + Intronic
940392286 2:153146353-153146375 AGAAATAGTTAGATTAAAGCTGG - Intergenic
941320069 2:164042983-164043005 ACATGTATTGATATTTAATCAGG - Intergenic
941613964 2:167697636-167697658 ACAGATAGTGAGAATTAACCAGG + Intergenic
942573258 2:177335273-177335295 ACAAAGTATGAGATTTAATTTGG + Intronic
943083928 2:183289385-183289407 ACAAATAATTAAATTTAATGAGG + Intergenic
943345861 2:186735680-186735702 ACAGTTAGTGAGATCTGATCTGG - Intronic
943651049 2:190457875-190457897 ACAAACAGTGCTAATTAATCTGG - Intronic
943914966 2:193620054-193620076 AGAAATAGTGACATTTTATATGG + Intergenic
944177447 2:196848954-196848976 ACAAATAATAAGTTTTAATGAGG - Intronic
944295047 2:198052345-198052367 AAAAATAGTGAGATTTGGGCTGG - Intronic
945494791 2:210497113-210497135 CCAAATAGTAAGATGAAATCTGG - Intronic
946815275 2:223570861-223570883 ATATATAGTGAGATTTAAAGGGG + Intergenic
946976076 2:225152946-225152968 AAAAATAGTGATTTTTAATGTGG + Intergenic
947291572 2:228581861-228581883 AAGAAGAGTGAGACTTAATCAGG - Intergenic
947882714 2:233533309-233533331 ACAAATTGTTAGATTTCATTTGG + Intronic
948751117 2:240133887-240133909 AGAAATATTCAGATTAAATCTGG + Intronic
1170822547 20:19766622-19766644 ACAAAGAGTGAGAAATAAGCTGG + Intergenic
1173884874 20:46448419-46448441 ACAAATAATAACATTTAATATGG - Intergenic
1174558157 20:51411361-51411383 AGAAATAATTAGGTTTAATCAGG - Intronic
1178872466 21:36387792-36387814 TCAGATAGTGAGATTTGAGCTGG + Intronic
1179936575 21:44609738-44609760 ACAGATAAGGAAATTTAATCTGG + Intronic
1183120094 22:35723621-35723643 AGAAATAGTGAGATCTACTCTGG - Intronic
951134984 3:19095066-19095088 AAAAATAGTAAGAATTACTCAGG + Intergenic
953593028 3:44278500-44278522 ACAAGTAATGAGATTGCATCAGG - Intronic
957242119 3:77672923-77672945 AAAAATAGTGAGATAGAAGCAGG + Intergenic
957898777 3:86460425-86460447 ACAAAAAGTGGCATTTAATATGG - Intergenic
958579667 3:96001609-96001631 ACTAATAGTGATATTGAAACAGG - Intergenic
959782592 3:110254321-110254343 AAAAATATTAAGATTTAATAAGG - Intergenic
960619938 3:119627843-119627865 AAAAATCGTGAGATTCAATGAGG - Intronic
963184238 3:142395236-142395258 ACAAAAAGTGAGATGGTATCAGG + Intronic
964042739 3:152282613-152282635 AGAAATAGTGACATTTTATTAGG + Intronic
965891596 3:173520667-173520689 ACAGGTAGTGACATATAATCTGG + Intronic
968257958 3:197296497-197296519 GTAAATAGAGAGTTTTAATCAGG - Intronic
972015665 4:34241914-34241936 GCAAATAGTGAGTGATAATCAGG - Intergenic
972251387 4:37306005-37306027 ACAAATGATGAGGTTGAATCAGG - Intronic
976049949 4:80999536-80999558 ACAAAGAGTGAGACTTTATCAGG - Intergenic
977619855 4:99124320-99124342 ACAAATATTTACATTTAATATGG - Exonic
979107870 4:116710524-116710546 ACAAAAAAGAAGATTTAATCAGG + Intergenic
979210678 4:118097961-118097983 ACAAAATGTGAGATTAAAGCTGG - Intronic
981903972 4:149898187-149898209 AATAACTGTGAGATTTAATCTGG - Intergenic
982219411 4:153112006-153112028 ATAAATCCTGAGATATAATCTGG + Intergenic
984418583 4:179491287-179491309 ACAAATAATAAAATTTAAACAGG + Intergenic
987286514 5:16463317-16463339 ACAAATAGTGAGATTTAATCTGG - Intronic
987925221 5:24332189-24332211 TCAAATAGTGAGAATTAATTAGG - Intergenic
988852169 5:35190921-35190943 ACACACAGTGAGCTTTTATCAGG + Intronic
993354951 5:86894468-86894490 AAATATATTGAGATTGAATCAGG + Intergenic
994993279 5:107026182-107026204 ATAATTAGTTTGATTTAATCTGG - Intergenic
995524698 5:113041160-113041182 ACAAAAAGTGACAATAAATCAGG + Intronic
996886462 5:128360947-128360969 CCACACAGTGAGATTTAAACAGG + Intronic
1000779489 5:165463973-165463995 AGTAAAACTGAGATTTAATCTGG + Intergenic
1000857256 5:166414335-166414357 ACAAGCAGTGAAATTGAATCAGG + Intergenic
1001315785 5:170640388-170640410 CAAACTTGTGAGATTTAATCAGG - Intronic
1001349011 5:170938089-170938111 TCAAAAAGTGAACTTTAATCGGG + Intronic
1002858696 6:1060487-1060509 ATAAATAGTGAAATTTAAATGGG - Intergenic
1004110014 6:12708563-12708585 AGAAATAGAAAGCTTTAATCAGG + Intergenic
1004495305 6:16157243-16157265 GCAAGTAGTGAGATTTAAGCTGG - Intergenic
1005001464 6:21246086-21246108 ACAACTTCTGAGATCTAATCTGG + Intergenic
1005434470 6:25793545-25793567 ACAAATAGCTATATTTAAACAGG - Intronic
1007867438 6:44988083-44988105 GCAAAGAGTGAGATCTAACCAGG + Intronic
1009564405 6:65293807-65293829 ACAGAGACTGACATTTAATCTGG + Intronic
1009675681 6:66816774-66816796 ACAAATATTCAGAATTAATGAGG - Intergenic
1009768723 6:68117786-68117808 GCAGATAGTGAGATAAAATCTGG + Intergenic
1009891884 6:69694936-69694958 ACATATACTGAGAATTAAGCGGG - Intronic
1012637326 6:101560771-101560793 ACAAATAGTGAGATTTCATGAGG - Intronic
1017395880 6:153999585-153999607 AGAAATAGTGAGATTTTTACAGG + Intergenic
1018140520 6:160829477-160829499 ACAGAGACTGACATTTAATCTGG + Intergenic
1020494586 7:8833357-8833379 AGAAATAGTAAGAGTTAACCAGG - Intergenic
1020704043 7:11520153-11520175 ACAACTACTGAGATGTAATATGG + Intronic
1024362529 7:48483256-48483278 ACAAATGATTGGATTTAATCTGG - Intronic
1028054714 7:86227071-86227093 ACAAATCATGAGATATAAGCTGG - Intergenic
1028282425 7:88947722-88947744 ATACATAGTGAGATTTATTGGGG - Intronic
1031456286 7:121984346-121984368 AGAAAAACTGAGATTTAATAAGG + Intronic
1032105208 7:129022573-129022595 ACCAATACTGAGACATAATCTGG + Intronic
1033773718 7:144582758-144582780 AGGAATAGTGACATTTAATGTGG - Intronic
1035931774 8:3787900-3787922 ACAACTACAGAGATTTAATCTGG - Intronic
1040931610 8:52740991-52741013 ACAAATAATCAGATGCAATCTGG - Intronic
1041174695 8:55182889-55182911 ACAATTAGGGAGATATAATTAGG - Intronic
1041927887 8:63255032-63255054 ACAATTACTGAGATTTATTAAGG + Intergenic
1042438499 8:68796451-68796473 CCAAAGAGGCAGATTTAATCTGG - Intronic
1043277932 8:78424088-78424110 ACCAATAAGGAGATTTAATTAGG - Intergenic
1045903667 8:107315998-107316020 AAAAATAGTGAGTTTTAGTTTGG - Intronic
1046543083 8:115611879-115611901 AAGAATAGTGAGATTTAATCTGG + Intronic
1046691599 8:117291777-117291799 AAAAATACTTAAATTTAATCAGG + Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1051015565 9:12471271-12471293 ACAAATAAGGATATTTAATAAGG + Intergenic
1052120312 9:24706914-24706936 ACAAAGAATGAGATTCAATGAGG + Intergenic
1052595626 9:30554276-30554298 ACAAATAGTGGGAATCATTCTGG + Intergenic
1058070606 9:100597585-100597607 ACACTTAGTGAGGTTTAAACCGG - Intergenic
1058196151 9:101978882-101978904 CCAAATAGTAAGACTAAATCAGG + Intergenic
1058873266 9:109220636-109220658 ACAAATAGTGCCATTTCTTCTGG - Intronic
1059937376 9:119324551-119324573 ATCAAAAGTGAGATTTAATCAGG + Intronic
1185579240 X:1197838-1197860 AAAAATAAAAAGATTTAATCAGG + Intronic
1186983784 X:14988011-14988033 AAAAACACTGAGATTTATTCAGG + Intergenic
1187014486 X:15312461-15312483 ACAAAGAATGATATTTAATGAGG + Intronic
1188363826 X:29289678-29289700 ACAGATAGTGAGACTCAATATGG - Intronic
1192953645 X:76044571-76044593 CCAAATAATGAGCCTTAATCAGG + Intergenic
1194653474 X:96543538-96543560 ACAAAGAGTGTGACTTAATTTGG - Intergenic
1194735547 X:97508854-97508876 AGAAATAGTTAGATTCAAGCTGG - Intronic
1195352546 X:104008821-104008843 AAAAGTATTTAGATTTAATCTGG + Intergenic
1196060422 X:111402459-111402481 AGAAACAGTGTGATTTAATCAGG + Intronic
1196739314 X:119010608-119010630 ACAAATACTGAGATGTATTAGGG + Intronic
1197394851 X:125914445-125914467 ACAAATACTGAAATATATTCTGG - Intergenic
1197997380 X:132392589-132392611 ACTAGCAGTGAGATTTAATTTGG - Intronic
1200558656 Y:4670593-4670615 ACAATTCCTGAGATTTTATCAGG - Intergenic