ID: 987286720

View in Genome Browser
Species Human (GRCh38)
Location 5:16465111-16465133
Sequence CTGTTCAAACCACTGGAGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 174}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987286710_987286720 26 Left 987286710 5:16465062-16465084 CCTCCTCCTCGCTGTCCTCCTCC 0: 1
1: 3
2: 109
3: 1029
4: 6557
Right 987286720 5:16465111-16465133 CTGTTCAAACCACTGGAGCCGGG 0: 1
1: 0
2: 1
3: 5
4: 174
987286715_987286720 5 Left 987286715 5:16465083-16465105 CCTGCTGCTTTGCCAACTTCTTC 0: 1
1: 0
2: 0
3: 18
4: 307
Right 987286720 5:16465111-16465133 CTGTTCAAACCACTGGAGCCGGG 0: 1
1: 0
2: 1
3: 5
4: 174
987286716_987286720 -7 Left 987286716 5:16465095-16465117 CCAACTTCTTCGCCTGCTGTTCA 0: 1
1: 0
2: 1
3: 12
4: 194
Right 987286720 5:16465111-16465133 CTGTTCAAACCACTGGAGCCGGG 0: 1
1: 0
2: 1
3: 5
4: 174
987286714_987286720 8 Left 987286714 5:16465080-16465102 CCTCCTGCTGCTTTGCCAACTTC 0: 1
1: 0
2: 6
3: 40
4: 381
Right 987286720 5:16465111-16465133 CTGTTCAAACCACTGGAGCCGGG 0: 1
1: 0
2: 1
3: 5
4: 174
987286711_987286720 23 Left 987286711 5:16465065-16465087 CCTCCTCGCTGTCCTCCTCCTGC 0: 1
1: 1
2: 13
3: 322
4: 2450
Right 987286720 5:16465111-16465133 CTGTTCAAACCACTGGAGCCGGG 0: 1
1: 0
2: 1
3: 5
4: 174
987286713_987286720 11 Left 987286713 5:16465077-16465099 CCTCCTCCTGCTGCTTTGCCAAC 0: 1
1: 0
2: 5
3: 47
4: 450
Right 987286720 5:16465111-16465133 CTGTTCAAACCACTGGAGCCGGG 0: 1
1: 0
2: 1
3: 5
4: 174
987286712_987286720 20 Left 987286712 5:16465068-16465090 CCTCGCTGTCCTCCTCCTGCTGC 0: 1
1: 0
2: 5
3: 111
4: 908
Right 987286720 5:16465111-16465133 CTGTTCAAACCACTGGAGCCGGG 0: 1
1: 0
2: 1
3: 5
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987286720 Original CRISPR CTGTTCAAACCACTGGAGCC GGG Exonic
900158235 1:1211991-1212013 CTGTCCAGCCCACTGAAGCCTGG - Exonic
901754472 1:11433042-11433064 CTGTTCAGCCCACTACAGCCTGG + Intergenic
902284758 1:15400275-15400297 CTATTTAAACCACTGTAGTCAGG + Intronic
904891167 1:33780688-33780710 CTGTTCTAGCCCCTGGAGGCTGG - Intronic
904951807 1:34247637-34247659 ATGATCACACCACTGCAGCCTGG - Intergenic
904998669 1:34650995-34651017 CTATCCAAACAACTGTAGCCAGG - Intergenic
905091670 1:35435243-35435265 CTGTTCCAACCAGTTGGGCCCGG - Intronic
905952310 1:41962333-41962355 ATTTTCAAACCACTGGTTCCAGG - Intronic
908557645 1:65272833-65272855 CTATTAAAACAACTGAAGCCAGG - Intronic
910255743 1:85245601-85245623 TTGTTCAAGGCACTGGAGCTGGG - Intergenic
913554157 1:119948443-119948465 CAGTCCATACCACTGAAGCCTGG + Exonic
914195928 1:145448171-145448193 CTCTTCAACCCACAGGAGGCCGG + Intergenic
915830896 1:159128953-159128975 CTGTTCAATCCACTGCAGTTAGG - Intronic
916861014 1:168805654-168805676 ATGATCATACCACTGCAGCCTGG - Intergenic
920016473 1:202914222-202914244 CTGTTCTACCCACAGTAGCCAGG - Intronic
923168765 1:231393655-231393677 CTGTTTATACCACTGGAAACAGG - Intronic
1063257565 10:4345156-4345178 CCTTTCAAACCACTGGAGAGAGG + Intergenic
1063304363 10:4883365-4883387 CTTATCAAATCACTGGAGTCAGG - Intergenic
1063442455 10:6084004-6084026 CTGTTCAAAGCGTTGGAGCAAGG + Intergenic
1064327215 10:14362707-14362729 GTGATTAAACCACTTGAGCCTGG - Intronic
1068789655 10:61013549-61013571 ATGGTCAAACCACTAGATCCTGG + Intergenic
1070105504 10:73427160-73427182 CTGTTCTAATCTCTGTAGCCTGG + Intronic
1070462353 10:76682643-76682665 TTGTTCAAGCCACTGGAGTATGG + Intergenic
1070629141 10:78072081-78072103 CTGTTCCACCCACTGCAGCTAGG + Intergenic
1071367038 10:84909875-84909897 CAGTTCCAATCACTGGAGTCTGG + Intergenic
1073076850 10:100829694-100829716 CCGTTCGGGCCACTGGAGCCTGG - Exonic
1073175749 10:101556278-101556300 CTGTTCAGACCAATGGTACCAGG - Exonic
1075183567 10:120234118-120234140 CTGCTCAAATCACTTGAACCCGG + Intergenic
1076984083 11:223003-223025 ATGTCCAAAGCACTGGAGCAGGG + Intronic
1078694735 11:13620024-13620046 GTGTTCCAACCACAGGGGCCTGG + Intergenic
1079937736 11:26638488-26638510 CTGTTCAGACCAGAGGAGACTGG + Intronic
1086075196 11:82843240-82843262 GTGATCATAGCACTGGAGCCTGG - Intronic
1087966322 11:104421076-104421098 CTGTTCACACCACTGCACTCTGG - Intergenic
1090830168 11:130415766-130415788 TGGTTCAAAGGACTGGAGCCAGG - Intronic
1090865080 11:130692769-130692791 TTCTTCAAACCACTGCAGCTTGG + Intronic
1093412412 12:18882507-18882529 CTCTGCAAAACACTGGACCCTGG + Intergenic
1096201496 12:49686833-49686855 CAGTTCTGACAACTGGAGCCAGG + Intronic
1098111026 12:67122059-67122081 TTGTTCAAACCAATTGAGTCTGG + Intergenic
1103018304 12:117513383-117513405 GTGATCAAGCAACTGGAGCCAGG + Intronic
1106396402 13:29385100-29385122 TTGTACCAACAACTGGAGCCTGG - Intronic
1106674842 13:31947664-31947686 CTTTCCAAACAACTGGATCCAGG + Intergenic
1108250046 13:48556192-48556214 CAGTTCAAACAACTGGATGCTGG - Intergenic
1111721951 13:91956590-91956612 CTGTTTCCACCACTGGGGCCTGG + Intronic
1114589402 14:23846435-23846457 CTATTCAAATAACTGGTGCCAGG - Intergenic
1114851679 14:26389927-26389949 CTGTTGAACCAACTGGAGTCAGG + Intergenic
1119591657 14:75894187-75894209 GTGTTCAAACCAATAGAGCAGGG + Intronic
1124514174 15:30352346-30352368 CTCTTCAAAGCGCTGCAGCCAGG + Intergenic
1124728746 15:32178418-32178440 CTCTTCAAAGCGCTGCAGCCAGG - Intergenic
1125540770 15:40468780-40468802 GTGATCATACCACTGCAGCCTGG + Intergenic
1125842270 15:42814229-42814251 CTTTTAAAAACACTTGAGCCTGG - Intronic
1126672162 15:51126329-51126351 CTGTTTAAACCACTGTAGGTGGG + Intergenic
1126854380 15:52823758-52823780 CAGTTCAAACCAATTGAGACAGG + Intergenic
1128367343 15:67013749-67013771 CTGATCAGACCCCTGCAGCCTGG + Intergenic
1128673593 15:69593159-69593181 CTGTTCCAACAGCTGCAGCCAGG + Intergenic
1130921606 15:88350564-88350586 CTGTTAATATCACTAGAGCCAGG + Intergenic
1136604137 16:31321266-31321288 CTGACCAAAATACTGGAGCCTGG - Exonic
1138416800 16:56876345-56876367 CTATTCAATCCACTAGAGGCAGG + Intronic
1139599393 16:67977445-67977467 CTCTTCCAACCCCTGAAGCCAGG - Intronic
1139917943 16:70439463-70439485 CTGCTCCAGCCGCTGGAGCCCGG - Intergenic
1141281256 16:82631629-82631651 CTGTTCATACCTGAGGAGCCAGG - Intronic
1141824090 16:86467092-86467114 CTCTTCAAACCACTGAGGCCTGG - Intergenic
1142416452 16:89945885-89945907 CTGGTAGAACCACTTGAGCCTGG + Intergenic
1144386791 17:14755598-14755620 CTGTTCACACCACTTCATCCAGG + Intergenic
1147377918 17:40033758-40033780 CTGTTCCAGCCACTGGATTCTGG - Intronic
1147556800 17:41484773-41484795 CTGTTCAACACTCTGAAGCCAGG + Intergenic
1148229873 17:45925234-45925256 CTGAAGAAACCACTGCAGCCCGG - Intronic
1148520995 17:48274835-48274857 ATATTAAAATCACTGGAGCCAGG - Intronic
1149012805 17:51875020-51875042 ATGATCAAACCACTCCAGCCTGG - Intronic
1151139558 17:71978451-71978473 CTGTTAAAAACAATGGAGGCAGG - Intergenic
1151886115 17:76924240-76924262 CTGTCCATACCCCTGGAGCTGGG + Intronic
1152554554 17:81046442-81046464 CTGTCCACACCACTCCAGCCAGG + Intronic
1152679461 17:81658472-81658494 ATGGTCAAACCACTCCAGCCTGG + Intronic
1160371578 18:78376591-78376613 CTGCTGAAAGCGCTGGAGCCAGG - Intergenic
1161617982 19:5282878-5282900 ATTTTCAAGGCACTGGAGCCAGG - Intronic
1164136704 19:22423003-22423025 CTGTTCAAAGGACCAGAGCCAGG - Intronic
1164187195 19:22880669-22880691 CAGTTTGAGCCACTGGAGCCAGG - Intergenic
1165467161 19:35981752-35981774 CTGTACACATCACTGGATCCTGG + Intergenic
1166549438 19:43655498-43655520 TTGTGGAAACCATTGGAGCCCGG + Exonic
1167924279 19:52810622-52810644 CTGTTAAAACCACTGTAGAATGG - Intronic
925281097 2:2685534-2685556 CTGTTCAAACCACAGCAGCAGGG + Intergenic
925333141 2:3074325-3074347 GTGTTCAAATAACAGGAGCCGGG + Intergenic
926756669 2:16241936-16241958 CTGCTCAGAGCACTGGTGCCGGG + Intergenic
930685140 2:54299797-54299819 GGGTCCAAACCACTGGGGCCTGG - Intronic
930841180 2:55847215-55847237 CTCTGCAGACCACTGCAGCCTGG + Intergenic
931698018 2:64886523-64886545 CTGTTCTCACCACTGGGCCCTGG + Intergenic
935343515 2:102081564-102081586 CTTTTCAAACCACTGACCCCAGG - Intronic
935760469 2:106315930-106315952 TTGTACAAGCCACAGGAGCCAGG + Intergenic
937280256 2:120712793-120712815 CTGTGCCAACACCTGGAGCCAGG + Intergenic
943147390 2:184063053-184063075 CTGTTCAAAACACTTGTTCCTGG + Intergenic
945063312 2:205926924-205926946 TTGCTAAAAGCACTGGAGCCTGG - Intergenic
1169080921 20:2797370-2797392 CTGCTCAAACCCCAGAAGCCTGG + Intronic
1170681098 20:18526377-18526399 CTTTTCCAAACACAGGAGCCAGG + Exonic
1171953943 20:31445168-31445190 CTGATCAAACCTCTGGATACAGG - Intronic
1172922657 20:38498747-38498769 CTGTTCTAAGCCCTGGAACCAGG - Intronic
1174730199 20:52908629-52908651 CTGTTCACAGCCCTGGAGCAGGG - Intergenic
1181688974 22:24547829-24547851 CTCTTCCAACTACTGGAACCAGG + Intronic
1183716501 22:39536198-39536220 CCCTTCATACCACAGGAGCCAGG - Intergenic
951041644 3:17994534-17994556 CTGTTCAAAGCACAGAAGGCTGG - Intronic
951640772 3:24832425-24832447 CTGTTCATTACAGTGGAGCCTGG + Intergenic
952166627 3:30756873-30756895 GTGTTTAAACCACTGGAGTTTGG + Intronic
952275568 3:31872372-31872394 GTGTACAAACCAATGGAGGCTGG + Intronic
954438013 3:50506109-50506131 CTGTGCAAACCCCGGGAGCTGGG - Intergenic
956694595 3:71907600-71907622 CTGCTCAAACTATTGCAGCCTGG - Intergenic
957462193 3:80535526-80535548 TTCTACAAAACACTGGAGCCTGG - Intergenic
959434685 3:106299932-106299954 CAGTACAAACCACTAGAGGCAGG + Intergenic
959675421 3:109029688-109029710 TTTTTCAAACCACTGGAGCCTGG - Intronic
960229617 3:115209697-115209719 CTTTTCAGATCAATGGAGCCTGG + Intergenic
962545776 3:136433078-136433100 CTCTTCAAACCAACAGAGCCAGG + Intronic
962862813 3:139420116-139420138 TGGTACAAATCACTGGAGCCCGG + Intergenic
967440195 3:189498656-189498678 GTGTGCAAAGCACTGGATCCGGG + Intergenic
968653604 4:1769487-1769509 CTGAAGAAACCACAGGAGCCTGG + Intergenic
970462430 4:16288450-16288472 CTGTGAAAACCACTAGTGCCAGG + Intergenic
971445444 4:26741510-26741532 CTGTGCAGAGCACTGAAGCCTGG + Intronic
974391446 4:61275148-61275170 CTGTTCATACAACTGGAACAAGG + Intronic
982616276 4:157639975-157639997 GGGTTAAAAGCACTGGAGCCTGG - Intergenic
985890560 5:2712141-2712163 CTGTTCAACCCACTCCAGGCAGG + Intergenic
986097775 5:4576982-4577004 CTCTTCAAGCCACTGGAACAAGG + Intergenic
987286720 5:16465111-16465133 CTGTTCAAACCACTGGAGCCGGG + Exonic
988069628 5:26270928-26270950 CTATTCAAATCGCTTGAGCCTGG - Intergenic
990178931 5:53138858-53138880 GTGTACAAAACACTGGAGCATGG - Intergenic
990182276 5:53174408-53174430 GTGTTCACACCACTGCATCCTGG + Intergenic
992013917 5:72557171-72557193 CTGCTCAAATCTCTGGATCCTGG - Intergenic
992736890 5:79730757-79730779 CTGTTGAAAACAGTGGAGACTGG - Exonic
994412741 5:99429783-99429805 CTTTCCATGCCACTGGAGCCAGG - Intergenic
994481100 5:100335940-100335962 CTTTCCATGCCACTGGAGCCAGG + Intergenic
996776777 5:127141228-127141250 TTGTTCACACCACTCCAGCCTGG - Intergenic
996781026 5:127186733-127186755 CTGGAAAAACCACTGTAGCCCGG + Intergenic
998233370 5:140376280-140376302 CTGGTGAAGCCACTGGGGCCTGG + Intergenic
998391929 5:141792751-141792773 CTGGTCAAACAACTTGACCCAGG + Intergenic
999855518 5:155588945-155588967 CTGTTCTCACCAAGGGAGCCGGG - Intergenic
1001087282 5:168709396-168709418 CTTTTAAAAGCACTGCAGCCAGG - Intronic
1002322794 5:178385493-178385515 CTGTTGGAGCCCCTGGAGCCTGG + Intronic
1005220170 6:23577535-23577557 CTCTTCAAATCACTGCATCCTGG - Intergenic
1005486008 6:26300117-26300139 CTGTGCTAGCCACTGGGGCCTGG - Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006409982 6:33867627-33867649 CTGTGCAAACCACAGGGACCAGG - Intergenic
1006831876 6:36973041-36973063 GTTTTCAAACCACAGAAGCCAGG + Intronic
1013506815 6:110808909-110808931 CTGTTCAAAGAAATGGGGCCAGG + Intronic
1015402612 6:132802901-132802923 CTGCCAATACCACTGGAGCCAGG + Intergenic
1016873347 6:148840263-148840285 ATGCTGGAACCACTGGAGCCAGG + Intronic
1017551043 6:155507764-155507786 GTGTTGAAATCACTGGTGCCAGG + Intergenic
1018133682 6:160757357-160757379 CATTTCAAACCACTGGAGAAAGG - Intergenic
1018397502 6:163389916-163389938 CTTTAGAAACCACTGGAACCAGG - Intergenic
1018429998 6:163714630-163714652 CTGCCCAAACCAATGAAGCCAGG + Intergenic
1019110566 6:169707981-169708003 CTGTGCAATCCACTTGAGACTGG - Intronic
1019781629 7:2943706-2943728 ATGATCACACCACTGCAGCCTGG + Intronic
1021408230 7:20298832-20298854 CTGTTCATTCCCCTGAAGCCTGG + Intergenic
1026732326 7:72923028-72923050 CTGTTCAACCCAGGGCAGCCTGG + Intronic
1026848292 7:73709707-73709729 GAATTAAAACCACTGGAGCCAGG - Intronic
1026948911 7:74334347-74334369 CTGTTGAAACAACTGGTCCCTGG + Intronic
1027111652 7:75444333-75444355 CTGTTCAACCCAGGGCAGCCTGG - Intronic
1027283881 7:76628864-76628886 CTGTTCAACCCAGGGCAGCCTGG - Intergenic
1030835318 7:114276731-114276753 CAGTGCAAACCACTGGCCCCAGG - Intronic
1035829244 8:2676610-2676632 CTGTTCACACCACTGCACTCTGG - Intergenic
1039902448 8:41762887-41762909 CTGCTCAAAGCACTGAATCCAGG + Intronic
1042031021 8:64475457-64475479 CTCTTCAAACCACTGCAGCAGGG - Intergenic
1042414232 8:68500886-68500908 CTGCACAAACCACTGCAGACAGG + Intronic
1043733408 8:83714186-83714208 CTGTACAAACAACCTGAGCCCGG - Intergenic
1044992073 8:97805018-97805040 CTTTTTCAACCACTGGCGCCAGG + Intronic
1045730389 8:105232115-105232137 CTGTTTAACCCACTGCAGTCTGG - Intronic
1047448259 8:124938954-124938976 CTTGTCAAAGCCCTGGAGCCAGG + Intergenic
1049769049 8:144371100-144371122 CTGTCCTAACCCCTAGAGCCTGG - Intergenic
1055502928 9:76919730-76919752 CTGTTCAATCCACTGTAGCATGG - Intergenic
1060893876 9:127205138-127205160 CTGTCCAGAGCACTGAAGCCAGG - Intronic
1061229976 9:129309883-129309905 TGGTTCAAACCACTCGAGTCAGG + Intergenic
1061425884 9:130498118-130498140 CTGAACAAATCACTGGGGCCAGG + Intronic
1062698803 9:137888651-137888673 CTCTTCAACCCACAGGAGGCCGG - Intronic
1203744757 Un_GL000218v1:35602-35624 CTGTGGAATCCAGTGGAGCCTGG - Intergenic
1186499997 X:10043582-10043604 CTGTTCTTGACACTGGAGCCGGG + Intronic
1188718609 X:33495553-33495575 CTGTACCAACCACTGGTCCCAGG - Intergenic
1191688738 X:63918851-63918873 CTACTCAAACCACTTGAGACTGG - Intergenic
1192168849 X:68842257-68842279 GTGCTCAAACCACTGGTGACTGG + Intergenic
1193560652 X:83012622-83012644 CAGTTTGAACCACTGGAGCTGGG + Intergenic
1193812589 X:86068974-86068996 CTGTTCAAGCCAATGGAAACTGG + Intergenic
1195100592 X:101551280-101551302 CCTTTCAAACCACTGGAAGCGGG - Intronic
1195589179 X:106604007-106604029 CCAGTGAAACCACTGGAGCCTGG - Intergenic
1196009384 X:110870898-110870920 CTGCAGAAACCACTGGAACCAGG - Intergenic
1196394056 X:115240449-115240471 CTGTTAAAACCACAAGAGACGGG - Intergenic
1197355916 X:125437384-125437406 CAGTTTAAGCCACTGGAGCCAGG + Intergenic
1199320648 X:146434245-146434267 AGGTTCAAACCACTGAATCCTGG - Intergenic
1199870543 X:151894464-151894486 CTGTGCAAAGCACTGGGGTCTGG - Intergenic