ID: 987288095

View in Genome Browser
Species Human (GRCh38)
Location 5:16479895-16479917
Sequence GGCACTGCTACCTTTCGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987288095_987288101 29 Left 987288095 5:16479895-16479917 CCCCATCGAAAGGTAGCAGTGCC 0: 1
1: 0
2: 0
3: 15
4: 67
Right 987288101 5:16479947-16479969 ATACTTTTTAATAACATTTTTGG 0: 1
1: 0
2: 11
3: 101
4: 991
987288095_987288098 -6 Left 987288095 5:16479895-16479917 CCCCATCGAAAGGTAGCAGTGCC 0: 1
1: 0
2: 0
3: 15
4: 67
Right 987288098 5:16479912-16479934 AGTGCCAGATCATAGTTTTCAGG 0: 1
1: 0
2: 0
3: 8
4: 112
987288095_987288102 30 Left 987288095 5:16479895-16479917 CCCCATCGAAAGGTAGCAGTGCC 0: 1
1: 0
2: 0
3: 15
4: 67
Right 987288102 5:16479948-16479970 TACTTTTTAATAACATTTTTGGG 0: 1
1: 1
2: 9
3: 171
4: 1329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987288095 Original CRISPR GGCACTGCTACCTTTCGATG GGG (reversed) Intronic
907340690 1:53733893-53733915 GTCACTCATACCTTTCTATGAGG + Exonic
911270693 1:95797699-95797721 GGGACTGCTGCCTTTCTTTGAGG - Intergenic
911690575 1:100829402-100829424 GCCTCTGCTATCTTTCAATGTGG - Intergenic
915470110 1:156120905-156120927 GGCACAGCTTCCTTTCAATCCGG - Intronic
915952540 1:160199071-160199093 GGCACTGCTATCTTAAGGTGGGG + Intronic
922233045 1:223702719-223702741 AGCACTGCTACATTTCCAAGTGG + Intronic
1077160470 11:1110256-1110278 GGCACTGGCAGCTCTCGATGTGG - Intergenic
1082993235 11:59227220-59227242 GGAACTGCTCCCTTTCTATCAGG - Intergenic
1086762937 11:90656346-90656368 GGCACTGCTAGCTTTGAATGCGG - Intergenic
1089923232 11:122230227-122230249 GGAGCAGCTACCTTTCGATTGGG - Intergenic
1095042463 12:37457386-37457408 GGCACTACTTTCCTTCGATGAGG + Intergenic
1096497216 12:52045513-52045535 GGCAGTGCTACATTTGGATGTGG + Intronic
1100941747 12:99730605-99730627 GCCACAGCTACCTATTGATGAGG - Intronic
1101327445 12:103728476-103728498 GGCACTGATACCTCTCCAAGAGG + Intronic
1104067187 12:125315778-125315800 GCAACTGCTATCTTTAGATGGGG - Intronic
1109070248 13:57756676-57756698 GACAAAGTTACCTTTCGATGTGG - Intergenic
1113764072 13:112869979-112870001 GGGTCTGCTAGCTTTGGATGGGG - Intronic
1113803845 13:113102010-113102032 GGGACAGCTGCCTTTCCATGTGG + Intergenic
1116688773 14:48078140-48078162 TGCCCTTCTACCTTTCCATGTGG + Intergenic
1129313018 15:74725543-74725565 GGCACTGCCACCTTTATAGGCGG + Exonic
1133305591 16:4806225-4806247 GGCACTGCTGCCATTCTGTGTGG - Intronic
1138247239 16:55477075-55477097 GTGACTGCTCCCTTTAGATGAGG - Intronic
1138546654 16:57723432-57723454 GGCACTGCCTCCTTTAAATGTGG - Intronic
1139799949 16:69514450-69514472 GGCACTCCAACATTTAGATGAGG - Intergenic
1141017905 16:80467502-80467524 GGAACTGCTTCTTTTGGATGAGG + Intergenic
1155885819 18:31206966-31206988 GGCACTGCTTCCTTTTTGTGTGG - Intergenic
1161538675 19:4836138-4836160 GGCATTGCTACCTTAAAATGTGG + Intergenic
1163708537 19:18832042-18832064 GGCACTGTTACCTCTCGGTCCGG + Exonic
1164246524 19:23435175-23435197 GGAACTGCTTCCTTTGGAGGAGG + Intergenic
930539328 2:52685263-52685285 GGCACTTCTACTTTTCGTTTTGG - Intergenic
936620649 2:114093831-114093853 AGCACTGCTACCTTTAGGAGGGG + Intergenic
938539143 2:132272316-132272338 GGCCCTGCCACCTTTCCCTGTGG - Intergenic
940170853 2:150828515-150828537 GGCATTCCTACCTTTGGATTAGG + Intergenic
941755383 2:169179859-169179881 GGCATTGCTACCTCTCCAAGAGG + Intronic
944510229 2:200457164-200457186 GGCACTGCTACCTTACTTTAGGG - Intronic
945797352 2:214381350-214381372 AGCAATGATACCTTTCCATGTGG + Intronic
948213454 2:236211792-236211814 GGCACTGCTGCCTTTGCTTGTGG + Intronic
1169448978 20:5695349-5695371 AGCACTGCTCCCATTCCATGTGG - Intergenic
1171868085 20:30505168-30505190 GGCCCTGCCACCTTTCGTTGTGG - Intergenic
1175751224 20:61499342-61499364 GGCACTGCTATCCTTCTAGGTGG - Intronic
1175911201 20:62406361-62406383 GGCACTGGTACCAGTGGATGGGG + Intronic
1176551983 21:8227438-8227460 GGCCCTGCCACCTTTCGCTGTGG + Intergenic
1176552376 21:8231902-8231924 GGCCCTGCCACCTTTCGCTGCGG + Intergenic
1176570892 21:8410437-8410459 GGCCCTGCCACCTTTCGCTGTGG + Intergenic
1176571281 21:8414494-8414516 GGCCCTGCCACCTTTCGCTGCGG + Intergenic
1176578800 21:8454584-8454606 GGCCCTGCCACCTTTCGCTGTGG + Intergenic
1176579195 21:8459056-8459078 GGCCCTGCCACCTTTCGCTGCGG + Intergenic
1178447760 21:32661111-32661133 GGCACAGCTACCTTCCCATCTGG - Intronic
1180050410 21:45328541-45328563 GGCACAGGTAGCTTTCCATGAGG - Intergenic
1203257003 22_KI270733v1_random:144365-144387 GGCCCTGCCACCTTTCGCTGCGG + Intergenic
1203257375 22_KI270733v1_random:148684-148706 GGCCCTGCCACCTTTCGCTGCGG + Intergenic
950892123 3:16413435-16413457 GGCATTGCCACCTTCCTATGGGG + Intronic
951165963 3:19485566-19485588 GGCACAGCTACCTTCCTATCTGG + Intronic
951244514 3:20324892-20324914 GGCCAAGCAACCTTTCGATGAGG - Intergenic
953821023 3:46207466-46207488 GGCACTGCTATCTTTGGAAGAGG - Intronic
960916506 3:122700987-122701009 GGCACGGCTTCCTGTCGATGTGG + Exonic
961045746 3:123706742-123706764 CACACTGCTACATTTCCATGAGG - Intronic
961045748 3:123706765-123706787 CACACTGCTACATTTCCATGAGG - Intronic
961045750 3:123706788-123706810 CACACTGCTACATTTCCATGAGG - Intronic
961468491 3:127096563-127096585 GGCACTGCTGCATCTCCATGAGG + Intergenic
983896958 4:173091275-173091297 GGCACTGTAACCTTCAGATGTGG + Intergenic
987288095 5:16479895-16479917 GGCACTGCTACCTTTCGATGGGG - Intronic
991347565 5:65685996-65686018 GGCTCTTCAACCTTTTGATGAGG - Intronic
995295880 5:110521127-110521149 GGCACTGATTCTTTTCTATGTGG + Intronic
998114423 5:139525289-139525311 GTCACTGCTACCATTGGCTGAGG + Intergenic
1002356803 5:178636680-178636702 GCCACTGCTATCTTTTGAAGTGG - Intergenic
1002758922 6:186811-186833 GCCACTACGACCTTTGGATGTGG - Intergenic
1016685817 6:146880989-146881011 GGAACTGCTGTCTTTCCATGGGG - Intergenic
1021546867 7:21823217-21823239 GGCACTACTATCTTTTGATAGGG + Intronic
1025288359 7:57687165-57687187 GGCACTACTTTCCTTCGATGAGG + Intergenic
1039432416 8:37535226-37535248 GGCGCTGCTACCTCTTGCTGGGG + Intergenic
1045448540 8:102293777-102293799 AGCATTGCTACCTTACGCTGTGG - Exonic
1049357603 8:142196422-142196444 GGCACTGCTGCCCCTCGGTGTGG + Intergenic
1058487832 9:105459850-105459872 CGCACTGCAATCTTTAGATGAGG - Intronic
1061833388 9:133310973-133310995 GGAACTGCTTCCTTTGGAGGAGG - Intergenic
1061914492 9:133742367-133742389 GGCACTGCCACCGTCTGATGGGG + Intergenic
1062497109 9:136837175-136837197 GGCACTGCTGCCCTTGGAAGTGG + Intronic
1203473161 Un_GL000220v1:126042-126064 GGCCCTGCCACCTTTCGCTGTGG + Intergenic
1203473556 Un_GL000220v1:130514-130536 GGCCCTGCCACCTTTCGCTGCGG + Intergenic
1189312741 X:40031587-40031609 GGCACTGCTGCCTTGGGGTGGGG + Intergenic
1191740811 X:64433894-64433916 GGCACTGCTGCAGTTCAATGGGG + Intergenic
1201641748 Y:16186321-16186343 GGCTCTGCTAGCTTTAAATGTGG - Intergenic
1201661067 Y:16399000-16399022 GGCTCTGCTAGCTTTAAATGTGG + Intergenic