ID: 987288390

View in Genome Browser
Species Human (GRCh38)
Location 5:16483772-16483794
Sequence CAGGTTAATCATAGGGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987288390 Original CRISPR CAGGTTAATCATAGGGTTCC AGG Intronic
906512583 1:46419149-46419171 CAGGTTAATCATGGCCTTGCAGG - Intergenic
908642663 1:66242690-66242712 TAGGTTAATCAAAGGTTTCATGG + Intronic
909021325 1:70434485-70434507 CAGATTAGTCAAAGTGTTCCTGG + Intronic
909649518 1:77958538-77958560 CAGATTTATCAAAGGGTTACTGG - Intronic
917087307 1:171316852-171316874 CAGGTAAGTCTAAGGGTTCCTGG + Intronic
920192156 1:204200725-204200747 CAGGCTAATCAGGGGGTTTCAGG + Intronic
1063575486 10:7258233-7258255 CAGGTTAAGAATGTGGTTCCTGG - Intronic
1066571970 10:36783576-36783598 CAGGCTAAGCGTAGGGTGCCAGG + Intergenic
1070144838 10:73766240-73766262 GAGGTTAATGATAGGGTGTCTGG + Intronic
1070519847 10:77243155-77243177 CAGCTTTATCATGGGGTTCATGG - Intronic
1070975566 10:80603409-80603431 CAGGTGAATCCTGAGGTTCCTGG + Intronic
1072940213 10:99756696-99756718 CATGTTATTCAGAGGCTTCCTGG - Intergenic
1078352034 11:10602629-10602651 CAGGATATTTATAGGGTTGCTGG + Intronic
1078897249 11:15607685-15607707 TAGATTAATCATAGACTTCCAGG + Intergenic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1080300109 11:30774725-30774747 CAGGTTTATAATTGGTTTCCAGG - Intergenic
1080586498 11:33687632-33687654 CAGGTTAATCTTGGACTTCCCGG + Intergenic
1081067147 11:38558219-38558241 CTGGTTAATACTAGAGTTCCAGG - Intergenic
1089777311 11:120847463-120847485 CAGGTTCATCAAAAGCTTCCTGG + Intronic
1090292655 11:125558990-125559012 CAGGTTAATCACATGAATCCAGG + Intergenic
1094386709 12:29902338-29902360 CAGGTTTCTCATATGATTCCAGG + Intergenic
1094577837 12:31703890-31703912 GATGGCAATCATAGGGTTCCAGG - Intronic
1095998204 12:48106909-48106931 CAGGTTAATCAATGTGTCCCAGG - Intronic
1102909676 12:116703339-116703361 CGGCTAAATCGTAGGGTTCCTGG + Intergenic
1103341588 12:120223963-120223985 GTGGTTAATCACAGGTTTCCTGG - Intronic
1108054997 13:46476806-46476828 CACGTTAATAATAGAGATCCAGG - Intergenic
1108942666 13:55977249-55977271 CAGGCTGTTCAGAGGGTTCCAGG - Intergenic
1112430295 13:99345162-99345184 CATGTCAATCACAGGGCTCCTGG - Intronic
1112852379 13:103722675-103722697 CAGTTTAATCAGAGAGTGCCAGG - Intergenic
1117905985 14:60587586-60587608 CAGGTTAATTATAGTTTTCAAGG - Intergenic
1121296693 14:92832125-92832147 CAGGTTAATCTTAGCTTTCTTGG - Intronic
1128745245 15:70109920-70109942 AATGTTCATCAAAGGGTTCCTGG + Intergenic
1129762213 15:78136341-78136363 CAGGTTAAACAAGGGGTTGCAGG - Intronic
1131054311 15:89366675-89366697 GAGGTGAATCATAGGGCTCAAGG + Intergenic
1141894832 16:86952824-86952846 AAGGTTAATGATAGGGGTCTGGG - Intergenic
1146741348 17:35286546-35286568 CAGGTTAATAATATGGACCCAGG + Intergenic
1148188604 17:45662831-45662853 AAGTTTAATCATAGGGTTGCTGG + Intergenic
1150557527 17:66267884-66267906 CAAGTTGATCCTTGGGTTCCAGG + Intergenic
1164996371 19:32722350-32722372 CAGGTAAATGAAAGAGTTCCTGG - Intronic
927076861 2:19587314-19587336 CAGGAAAATGATAAGGTTCCAGG + Intergenic
931167265 2:59761526-59761548 CAGGGTGATCAGAGGATTCCTGG + Intergenic
935863662 2:107361953-107361975 AAGTTTAATCATATGGTGCCTGG + Intergenic
940137529 2:150455451-150455473 CAGGTTAAGAATAGTTTTCCTGG + Intergenic
941186293 2:162324904-162324926 GAGGTTTATCTAAGGGTTCCTGG + Intronic
943936710 2:193927546-193927568 TAGTTTAATTATAGTGTTCCTGG + Intergenic
1169386122 20:5150880-5150902 CTGATTCATCATAGGGTTCCTGG + Intronic
1172409876 20:34713020-34713042 CAAGTTGCTCAGAGGGTTCCAGG - Exonic
1182196032 22:28519196-28519218 CAGGTTACTGTGAGGGTTCCTGG - Intronic
1182705401 22:32274637-32274659 CAGGTGGCTCATAGGCTTCCTGG - Intergenic
1184109298 22:42385559-42385581 CGGGCTCATCATAGGGTCCCAGG + Intronic
949903840 3:8842092-8842114 TAGGCTAATTAGAGGGTTCCAGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
966006825 3:175024258-175024280 CATATTAATCATAGGGTACTTGG - Intronic
972630808 4:40840252-40840274 CGGTGTAATTATAGGGTTCCTGG + Intronic
972879191 4:43402706-43402728 CAGGTTAAACAAAAGTTTCCTGG - Intergenic
975592091 4:76010926-76010948 AATGTTAACCATAGGGTTGCAGG - Intergenic
976933112 4:90593276-90593298 CAGTTAAATCATAGTGTTACTGG + Intronic
979644793 4:123055098-123055120 CACGTGAATCATAGGGTGCAGGG - Intronic
981286035 4:143020177-143020199 CAGCTTTAGCATAGGGTTCTAGG + Intergenic
984712723 4:182899205-182899227 CAGGTGAATCAAAAGGTTCCAGG - Intronic
987288390 5:16483772-16483794 CAGGTTAATCATAGGGTTCCAGG + Intronic
988967212 5:36431733-36431755 CAGGCTCAGCATAGGATTCCTGG + Intergenic
989816286 5:45741577-45741599 CAGGATAATCATATGTTTTCAGG - Intergenic
1000908307 5:166990042-166990064 CATGTTAATCATAGGAATTCTGG + Intergenic
1003510652 6:6777177-6777199 CAGTTTGAGCATAGAGTTCCAGG + Intergenic
1015240343 6:131015489-131015511 CAGTTTAAACATGGGTTTCCTGG + Intronic
1019781254 7:2941284-2941306 CAGGTTAATCACTGGGGTGCAGG - Intronic
1045994996 8:108352175-108352197 CATGCTGATCATAGTGTTCCAGG + Intronic
1048581337 8:135731883-135731905 CAGGTTTCTCACTGGGTTCCCGG - Intergenic
1189012314 X:37058935-37058957 CAGGGTAATCACATGGTTTCTGG + Intergenic
1189036398 X:37497317-37497339 CAGGGTAATCACATGGTTTCTGG - Intronic
1191787349 X:64930694-64930716 CAGTTTTATCATAGGGATGCAGG - Intronic
1194285327 X:92003487-92003509 CAGTTTAGTCATGGGGTCCCAGG + Intronic
1197907283 X:131439202-131439224 CAGGTTAATCACTGTTTTCCCGG - Intergenic
1200602898 Y:5228029-5228051 CAGTTTAGTCATGGGGTCCCAGG + Intronic