ID: 987288762

View in Genome Browser
Species Human (GRCh38)
Location 5:16487987-16488009
Sequence CTGTTTAAGCAGCAGCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987288757_987288762 9 Left 987288757 5:16487955-16487977 CCTGCAGCTGTAGTTGTGAGACA 0: 1
1: 0
2: 1
3: 8
4: 134
Right 987288762 5:16487987-16488009 CTGTTTAAGCAGCAGCTGTGTGG No data
987288755_987288762 23 Left 987288755 5:16487941-16487963 CCCTTCATGCAGTTCCTGCAGCT 0: 1
1: 0
2: 4
3: 18
4: 235
Right 987288762 5:16487987-16488009 CTGTTTAAGCAGCAGCTGTGTGG No data
987288756_987288762 22 Left 987288756 5:16487942-16487964 CCTTCATGCAGTTCCTGCAGCTG 0: 1
1: 0
2: 2
3: 23
4: 279
Right 987288762 5:16487987-16488009 CTGTTTAAGCAGCAGCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987288762 Original CRISPR CTGTTTAAGCAGCAGCTGTG TGG Intronic
No off target data available for this crispr