ID: 987289417

View in Genome Browser
Species Human (GRCh38)
Location 5:16494541-16494563
Sequence CAGGAGTAAGAGAGAGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2702
Summary {0: 1, 1: 12, 2: 130, 3: 624, 4: 1935}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987289417_987289425 30 Left 987289417 5:16494541-16494563 CCCCCTGCTCTCTCTTACTCCTG 0: 1
1: 12
2: 130
3: 624
4: 1935
Right 987289425 5:16494594-16494616 TCTTTGCCTTCTGCCATGATTGG 0: 22
1: 181
2: 410
3: 686
4: 1283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987289417 Original CRISPR CAGGAGTAAGAGAGAGCAGG GGG (reversed) Intronic
Too many off-targets to display for this crispr