ID: 987290690

View in Genome Browser
Species Human (GRCh38)
Location 5:16505635-16505657
Sequence CCTTCAGGACAGCTGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987290677_987290690 27 Left 987290677 5:16505585-16505607 CCACAAGAAGATGCATGAAGAGC 0: 1
1: 0
2: 1
3: 6
4: 156
Right 987290690 5:16505635-16505657 CCTTCAGGACAGCTGGAACAGGG No data
987290681_987290690 3 Left 987290681 5:16505609-16505631 CCGTCTTGGTGCCTAGGGTCCCT 0: 1
1: 0
2: 1
3: 9
4: 143
Right 987290690 5:16505635-16505657 CCTTCAGGACAGCTGGAACAGGG No data
987290682_987290690 -8 Left 987290682 5:16505620-16505642 CCTAGGGTCCCTCTCCCTTCAGG 0: 1
1: 0
2: 3
3: 30
4: 317
Right 987290690 5:16505635-16505657 CCTTCAGGACAGCTGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987290690 Original CRISPR CCTTCAGGACAGCTGGAACA GGG Intronic
No off target data available for this crispr