ID: 987291676

View in Genome Browser
Species Human (GRCh38)
Location 5:16514238-16514260
Sequence GTTAAAAATAAGAATGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 647
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 597}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987291676_987291681 15 Left 987291676 5:16514238-16514260 CCTCCCACATTCTTATTTTTAAC 0: 1
1: 0
2: 3
3: 46
4: 597
Right 987291681 5:16514276-16514298 TGTTGAACCTTCTGCAAATACGG 0: 1
1: 0
2: 0
3: 9
4: 157
987291676_987291684 28 Left 987291676 5:16514238-16514260 CCTCCCACATTCTTATTTTTAAC 0: 1
1: 0
2: 3
3: 46
4: 597
Right 987291684 5:16514289-16514311 GCAAATACGGGAGAGCCCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 76
987291676_987291682 16 Left 987291676 5:16514238-16514260 CCTCCCACATTCTTATTTTTAAC 0: 1
1: 0
2: 3
3: 46
4: 597
Right 987291682 5:16514277-16514299 GTTGAACCTTCTGCAAATACGGG 0: 1
1: 0
2: 0
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987291676 Original CRISPR GTTAAAAATAAGAATGTGGG AGG (reversed) Intronic
900376654 1:2357831-2357853 GTCATAAATAATAATGGGGGCGG - Intronic
900804627 1:4759376-4759398 GTTCAAAATAAAAATATTGGAGG + Intronic
901308213 1:8249031-8249053 GTTAAAAATATAAATGTTGGGGG + Intergenic
901588739 1:10320995-10321017 TTTAAAAATAAGAAATTGGCTGG - Intronic
901731686 1:11284762-11284784 TTTAAAAATAGGAATCTGGCTGG - Intronic
902964193 1:19986254-19986276 GTTATAAATAAGGAAGGGGGAGG - Intergenic
903200114 1:21730025-21730047 TTTAAAAAATAGAATGTGGCAGG - Intronic
903928083 1:26845627-26845649 ATTAAAAAAAAGAATGAGGCCGG - Intronic
904062460 1:27722537-27722559 TTTAAAAAAAAGAATGTAAGTGG - Intergenic
904299217 1:29543328-29543350 GTTCAACAGATGAATGTGGGAGG - Intergenic
904634990 1:31873038-31873060 AAAAAAAAAAAGAATGTGGGTGG + Intergenic
906375866 1:45296225-45296247 TTTCAACATAAGAATGTTGGAGG - Intronic
906814797 1:48867680-48867702 GTTAAAAAGAAGTATCTGGAGGG - Intronic
907067669 1:51501773-51501795 CTTAAAATTAATAATGTGGCAGG - Intronic
907099576 1:51817215-51817237 GTTTAAAATATGAATTTGGCTGG + Intronic
907775468 1:57510148-57510170 GTTAAAAATGTGAATGTGGAAGG - Intronic
908578213 1:65484381-65484403 TTTAAAAAAAAAAGTGTGGGAGG - Intronic
909315513 1:74212819-74212841 GTAAAAAACAACAATGTGGGTGG - Intronic
909345788 1:74584689-74584711 GTGAAAAATAAGCATGTGATGGG - Intronic
909755198 1:79217128-79217150 CTTCAAAATAAGTATGTGGGTGG - Intergenic
910628556 1:89334428-89334450 GTTCAACATATGAATTTGGGAGG + Intergenic
910650590 1:89562205-89562227 GGAAAAGATAAGAAAGTGGGAGG - Intronic
910981958 1:92966881-92966903 TTTAAAAATAAAACTGTGGCTGG + Intergenic
911144436 1:94539069-94539091 GGTAAAAATTAGATTTTGGGAGG - Intronic
911283059 1:95955391-95955413 ATTAAAAAATAGAATGTTGGAGG + Intergenic
911723651 1:101218797-101218819 GTTCAAATTAAAAATGTGGAAGG - Intergenic
911878855 1:103207312-103207334 GTAAAAATTAAGGATGTGGGAGG + Intergenic
912526364 1:110286279-110286301 GATAAAAATAAAGATGTGGGCGG - Intergenic
912635397 1:111287369-111287391 AATAAAAATAAGAAAGTGAGAGG - Intergenic
914687519 1:149994123-149994145 GTTAAAAATAATAATGGGATAGG - Intronic
914760928 1:150597665-150597687 GTTAAAAAAAATAAAGTGGCCGG + Intergenic
914953733 1:152143594-152143616 GATAAAAAAAAAATTGTGGGGGG - Intergenic
915170438 1:153973612-153973634 GGAAAAAAGAAGAATCTGGGAGG - Exonic
916061787 1:161103814-161103836 CTGAAAAATCAGAGTGTGGGGGG + Intronic
916373809 1:164129374-164129396 TTTCAAAATATGAATTTGGGGGG + Intergenic
916898684 1:169195970-169195992 GTTACAACTATAAATGTGGGTGG + Intronic
917440321 1:175063225-175063247 GTTAAAAAAAAGCATTTGTGTGG + Intergenic
917871186 1:179243438-179243460 GAGAAAAATATGAATTTGGGGGG + Intergenic
919287587 1:195584654-195584676 ATTAAAAATAATAATGTGTTTGG - Intergenic
920696034 1:208181862-208181884 TTTCAAAATAAGAAAGTTGGAGG - Intronic
921410990 1:214836201-214836223 CTTTAAAATATGAATTTGGGTGG - Intergenic
921458743 1:215403927-215403949 CTTCAAAATAAGAATTTGAGGGG + Intergenic
921564496 1:216700116-216700138 GTTAAAAAAAAAAAGGTGCGGGG - Intronic
922158286 1:223057658-223057680 TTTAAAAATAAAATTATGGGAGG - Intergenic
922286263 1:224173297-224173319 TTCAAAAATATTAATGTGGGTGG + Intergenic
922325689 1:224526245-224526267 GTTTCAAATATGAATTTGGGGGG - Intronic
922968201 1:229710240-229710262 GTTAAAAATACAAATTAGGGGGG + Intergenic
923478727 1:234362148-234362170 TTTAATAATAAAAATGTGGTTGG - Intergenic
924222839 1:241895880-241895902 CTGAATAATAAGAATGTGGAAGG - Intergenic
924223070 1:241898131-241898153 CTGAATAATAAGAATGTGGAAGG - Intergenic
924227483 1:241933779-241933801 GTTAAGATTAAGAATGAGGCTGG - Intergenic
1063909429 10:10814416-10814438 GTTTAAAAATAAAATGTGGGAGG - Intergenic
1064118210 10:12596818-12596840 GTCTAAAAAAAAAATGTGGGTGG - Intronic
1064322440 10:14318321-14318343 GGTAAAAAAAAAAAGGTGGGGGG - Intronic
1064715295 10:18170610-18170632 ATTAAAAATTAGAATGTTGGTGG + Intronic
1065264630 10:23962057-23962079 TTTAAACGTAAGAATGTTGGGGG + Intronic
1065684808 10:28273768-28273790 GATAAGAATAAAAATCTGGGAGG - Intronic
1066695174 10:38070907-38070929 GATAAAAATAATATTGTGGCCGG + Intergenic
1066997325 10:42576283-42576305 GATAAAAATAATATTGTGGCCGG - Intronic
1067454228 10:46404749-46404771 GCTAAAAATAGGAATCTGTGTGG + Intergenic
1067632975 10:47979883-47979905 GCTAAAAATAGGAATCTGTGTGG - Intergenic
1068246741 10:54381560-54381582 GTTAAAAATAAAAAGATGGGAGG + Intronic
1068246938 10:54384319-54384341 GTTAAAAAAAAAAAAGGGGGGGG - Intronic
1068607321 10:59020328-59020350 ACTAAAAATAAGATTATGGGTGG + Intergenic
1069018198 10:63455059-63455081 GTTAAAAATAAAGATGTGAACGG - Intronic
1070503844 10:77096035-77096057 GATAAACTTAAGAACGTGGGAGG - Intronic
1070531057 10:77337910-77337932 GTTAAAATGAAGAATCTTGGGGG + Intronic
1070637555 10:78141415-78141437 GTTTAACATAGGAATGTGGCAGG - Intergenic
1071080075 10:81800700-81800722 GTTTAAAATATGAATTTGAGGGG - Intergenic
1071200600 10:83217782-83217804 TTTCAATATACGAATGTGGGAGG + Intergenic
1072108566 10:92296468-92296490 GAGAAAAATGAGAATGTCGGTGG - Intronic
1073233072 10:101989173-101989195 GTTAAAGAGAAGAATGTAGGAGG + Intronic
1073585251 10:104703869-104703891 GGTAAAAATTAGAGTGTAGGAGG + Intronic
1073674406 10:105629199-105629221 GTAAACAACAAGACTGTGGGTGG - Intergenic
1073775408 10:106779786-106779808 GTTAAAAATGAATATTTGGGGGG - Intronic
1073806726 10:107106721-107106743 TTTAAACATATGAATTTGGGAGG - Intronic
1074157499 10:110811668-110811690 GTTAAAAAAAAGAATTAGGAAGG - Intronic
1074265240 10:111895317-111895339 TTTTGAAAAAAGAATGTGGGAGG + Intergenic
1074486154 10:113883102-113883124 TTGAAAAAGAAGAAAGTGGGAGG - Intronic
1075045573 10:119143637-119143659 GCTAAAAATAAAAATTTGGCTGG - Intronic
1075065968 10:119289047-119289069 GTTAAAAATACAAGTGTTGGAGG - Intronic
1075663186 10:124212424-124212446 CTTCAACATATGAATGTGGGGGG + Intergenic
1075943785 10:126414141-126414163 GTTTAACATATGAATCTGGGGGG + Intergenic
1076330577 10:129662100-129662122 TTTGTAAATAAGAATGGGGGTGG + Intronic
1076556878 10:131330062-131330084 TTTAAAGAGAAGAAAGTGGGAGG - Intergenic
1078608150 11:12795716-12795738 GTTAAAAATATGTATGTGGTGGG - Intronic
1078715078 11:13832263-13832285 TTTCAATATAAGAATGTTGGGGG - Intergenic
1078770155 11:14342136-14342158 GTTAACAATTTGAATCTGGGAGG - Intronic
1080279869 11:30544705-30544727 GTTATAATTAAGAATGTTTGAGG + Intronic
1080304015 11:30817399-30817421 GTTAAAAAAAAAATTATGGGAGG + Intergenic
1080571710 11:33563050-33563072 CTTCAAAATAGGAATCTGGGGGG + Intronic
1080717159 11:34814277-34814299 ATAAAAAATCAAAATGTGGGGGG + Intergenic
1080840330 11:35977902-35977924 TTTAAACATAAGAATTTTGGAGG + Intronic
1080863177 11:36168330-36168352 GTTAAAAACAAGCATCAGGGAGG - Intronic
1081162377 11:39765382-39765404 GTTAAAAATAAAAATGTAAACGG + Intergenic
1081348370 11:42018129-42018151 TTTCAAAATAAGAATTTTGGAGG + Intergenic
1081480918 11:43488032-43488054 CTTAAAAATATGAATTTTGGGGG + Intronic
1081536637 11:44001666-44001688 GTTATAAATCTAAATGTGGGTGG + Intergenic
1082042627 11:47698466-47698488 AATAAAAATAAGAATGTGGCTGG - Intronic
1083089164 11:60182182-60182204 GTAAAAATTAAGAATGTGTCTGG - Intronic
1085027354 11:73244042-73244064 ATTAAAAAAAAAAAAGTGGGGGG + Intergenic
1085089038 11:73693914-73693936 GTTAAAAATAAGGATGGGGGAGG - Intronic
1085292832 11:75412246-75412268 CTTCAACATAAGAATTTGGGGGG - Intronic
1085363076 11:75910490-75910512 CTTAAAAAAAAAAAAGTGGGGGG - Intronic
1085540905 11:77268877-77268899 GGTGAAAATAAGTATGTGTGGGG - Intronic
1086300435 11:85421413-85421435 GTTAAAAAAAAAAAAGGGGGAGG - Intronic
1086450598 11:86912121-86912143 GGTGAAAATAAGAAAGAGGGTGG + Intronic
1086620265 11:88879253-88879275 CTTAAAAATAACAAACTGGGAGG + Intronic
1087214971 11:95483906-95483928 GTTAAAACAAAAAATGTGTGAGG - Intergenic
1087934781 11:104019818-104019840 TTTAAAAATAAAAATGTGTTTGG + Intronic
1088250985 11:107860689-107860711 ATTAAAAAAAAAAAGGTGGGAGG - Intronic
1088262962 11:107961451-107961473 TTTCAACATAAGAATTTGGGAGG + Intronic
1088709641 11:112496402-112496424 ATTCAAGATAAGATTGTGGGTGG - Intergenic
1088967028 11:114733786-114733808 GTTAAAGGTAAGGATGTAGGGGG - Intergenic
1089746646 11:120622195-120622217 GTTAAAAATAATAATAAGGCCGG - Intronic
1090578513 11:128134358-128134380 GTTAGAAATGACAATGTGGTGGG + Intergenic
1092299224 12:7229312-7229334 GGGAAAAATAAGACTTTGGGAGG + Intergenic
1092680439 12:10973961-10973983 TTTAAAAAGAACAAAGTGGGGGG + Intronic
1092978400 12:13768737-13768759 ATTAAAAATAAGCAGGTGGCCGG + Intronic
1093540179 12:20273357-20273379 ATTAAAAAAAAAAATGTAGGAGG + Intergenic
1093680636 12:21998074-21998096 TTTAAAAATTAGAATGTCAGAGG - Intergenic
1094195708 12:27747679-27747701 GTTGTAAATAAGAAGGTAGGAGG + Intronic
1094233146 12:28131505-28131527 ACTCAAAATAAGAATGTGTGTGG + Intergenic
1095274534 12:40265205-40265227 GTTGAAAATAAGTATATGGAAGG + Intronic
1096282460 12:50267949-50267971 GTTAAAAAAATAAATGTGGCCGG - Intronic
1096436864 12:51599055-51599077 GTTAAAAATAAAAGTGCAGGGGG + Intronic
1097442612 12:59629243-59629265 CTTAAAAATATGAATTTTGGGGG + Intronic
1097548257 12:61032352-61032374 GTTAGAAAGAAGGTTGTGGGAGG - Intergenic
1097721404 12:63025438-63025460 GATAAAAATATGAGTGAGGGAGG - Intergenic
1097981100 12:65738828-65738850 CTTAAAAAAAAGAAAGAGGGAGG - Intergenic
1098138339 12:67426743-67426765 GTAGAAAATAAGAAAGAGGGAGG + Intergenic
1098854132 12:75633214-75633236 TTTAAACATAAAAATTTGGGGGG - Intergenic
1099170937 12:79363190-79363212 TTTAAAAATAGGAATTTGTGGGG - Intronic
1099877199 12:88422385-88422407 GTTAAGAATAAGAAAGTGCCTGG + Intergenic
1099983861 12:89640214-89640236 TTTAAAAAAAATAATGGGGGTGG - Intronic
1100121954 12:91378912-91378934 ATTGAAAATAAGAATGTGGAGGG - Intergenic
1101241815 12:102846772-102846794 GAAAAAAATCAGAATGTGGTGGG - Intronic
1101281821 12:103265230-103265252 TTTCAACATAAGAATGTTGGAGG + Intronic
1102293054 12:111716556-111716578 TTTAATAATAAGAATTTGGAAGG + Intronic
1102302207 12:111779154-111779176 GTTCAAGACAAGAATCTGGGTGG - Intronic
1103240695 12:119411027-119411049 GTTAAAAAAATAAATGTGGCCGG - Intronic
1103533065 12:121615889-121615911 CTCAAAAAGAAGAATGTGGCCGG - Intergenic
1103589483 12:121981104-121981126 ATTAAAAATAAGAAAATGAGGGG - Intronic
1105473624 13:20713000-20713022 GTTATAAAAAAGAAAGAGGGAGG - Intronic
1106799787 13:33244188-33244210 GCTGAAAATCAGGATGTGGGAGG + Intronic
1107199848 13:37701433-37701455 GTTTAAAAAAAGAATGAGAGAGG - Intronic
1107464193 13:40634517-40634539 TTTAAAAATAAGCACCTGGGAGG + Intronic
1107509898 13:41073215-41073237 TTTAAAAATAAAACTGTGGCCGG + Intronic
1108017545 13:46091991-46092013 ATTAAAATTAAGCATGTTGGTGG + Intronic
1108379283 13:49841090-49841112 GTGAACCATAAGAATATGGGAGG + Intergenic
1108453786 13:50593275-50593297 CTGAAAAAGAAGAATGTTGGGGG - Intronic
1108920682 13:55670613-55670635 TTTATAAAAAAGAATCTGGGCGG - Intergenic
1109153159 13:58869975-58869997 GTTAAAAATTACAACCTGGGTGG - Intergenic
1109603448 13:64662567-64662589 ATCAAAAATAAGAATATGGCTGG - Intergenic
1109810172 13:67502937-67502959 ATTTAAAATAAGAATGTTGCGGG + Intergenic
1109974972 13:69819468-69819490 CCTAATAATAAGAATGTGGTGGG - Intronic
1110194882 13:72777320-72777342 TTTAAAAATTGGAATGTCGGTGG - Intronic
1110199770 13:72834882-72834904 TTTAAAAATAATAATGTGGTAGG - Intronic
1110362380 13:74642332-74642354 CTTAGAAAAAAGCATGTGGGTGG + Intergenic
1110556599 13:76866809-76866831 GTTAATATAAAAAATGTGGGAGG - Intergenic
1110660260 13:78052563-78052585 TTTAAAAAGTAGAATGAGGGAGG - Intergenic
1110900730 13:80820586-80820608 TTTAAAAATAAGAAGATGGTTGG + Intergenic
1111078381 13:83268729-83268751 CTTTAAAATGAGAATGTGAGAGG + Intergenic
1111124762 13:83900136-83900158 GTTAAAAATAATAATGTAGTTGG + Intergenic
1112049462 13:95631486-95631508 GATAAAAATAAGAATTTCTGTGG + Intronic
1112629397 13:101144063-101144085 TTTAAAAATAATTCTGTGGGGGG - Intronic
1112809915 13:103206075-103206097 TTAAAAAAAAAAAATGTGGGGGG - Intergenic
1113036611 13:106056778-106056800 GTTAAAAGTAAGAAAGTGAAAGG + Intergenic
1113043639 13:106130702-106130724 ATTAAAGATAAGATTTTGGGTGG + Intergenic
1114036137 14:18629738-18629760 TATAAAAATGAGAGTGTGGGAGG - Intergenic
1114122500 14:19685293-19685315 TATAAAAATGAGAGTGTGGGAGG + Intergenic
1114373491 14:22116343-22116365 TTTAATAATTAGAATGTGAGTGG + Intergenic
1114735042 14:25035324-25035346 TCAAAAAATAAGGATGTGGGCGG + Intronic
1115687467 14:35811233-35811255 GTTAAAAATAATTATATGGCTGG + Intergenic
1115697804 14:35919454-35919476 GTTAAAAAAATGAATGTGAGGGG - Intronic
1116043637 14:39716172-39716194 TTTAAAAATAGGAAAGTGGGTGG - Intergenic
1116044176 14:39722525-39722547 CATAAGAATAAGAATGTGAGAGG - Intergenic
1116135741 14:40921483-40921505 AAAAAAAAAAAGAATGTGGGTGG - Intergenic
1116190846 14:41663545-41663567 GAAAAAAATAAGAATAAGGGAGG + Intronic
1116200158 14:41783203-41783225 CTAAAATATAAGAATGTAGGGGG + Intronic
1116317141 14:43411790-43411812 TTTCAAAATGAGAATGTGAGTGG + Intergenic
1117007278 14:51434088-51434110 GTTAAAAATAAGGAAGGGGGAGG + Intergenic
1117389545 14:55249873-55249895 GTTCAAAATAATAATCTGAGGGG - Intergenic
1118063336 14:62164470-62164492 GTTTAAAATAAGAACGTGATGGG + Intergenic
1118511909 14:66484438-66484460 GTTAAAAAAAAGAAACTGGTTGG - Intergenic
1120415888 14:84217434-84217456 GAGAAAAATATGAATTTGGGAGG + Intergenic
1121533532 14:94675342-94675364 CTAAGAAATAAGAATGTGAGAGG - Intergenic
1124055290 15:26236198-26236220 TTTCAACATAAGAATTTGGGAGG - Intergenic
1124224809 15:27884084-27884106 TTTAAAAATAAAAATGTGCCAGG + Intronic
1124791922 15:32735780-32735802 AAAAAAAAGAAGAATGTGGGAGG + Exonic
1125033631 15:35097966-35097988 TCTAAAAATAAGAGTGAGGGAGG + Intergenic
1125051527 15:35303692-35303714 GTTAAAAAAAAAAAAGGGGGAGG + Intronic
1125187033 15:36942831-36942853 CTTAAAAATAAGAGTCTTGGGGG - Intronic
1125362609 15:38880030-38880052 GATAAAAATAATAATGTAGAAGG + Intergenic
1125701112 15:41684967-41684989 GTTAACACTTAAAATGTGGGTGG + Intronic
1125880202 15:43186746-43186768 GACAAAAATGAGAAAGTGGGTGG - Intronic
1125990868 15:44106523-44106545 TTTAAAAATCAGAATGAGGCAGG - Intronic
1126132431 15:45354770-45354792 ATTTAAATTAAAAATGTGGGAGG + Intergenic
1126452243 15:48821003-48821025 TTTAAAAAGAACAAGGTGGGAGG - Intergenic
1126628303 15:50707501-50707523 GTTAAAAAAAAGTATAGGGGTGG + Exonic
1126949829 15:53868820-53868842 ATTAAAAACAAGAATGGGTGGGG + Intergenic
1127016220 15:54691431-54691453 GTTAAAAAAAAAAAGGTGGGGGG + Intergenic
1127160176 15:56174443-56174465 GATAAAAATCAGCATGTGGCTGG + Intronic
1127706332 15:61550579-61550601 TTTAAGAAAAAGAATGAGGGAGG - Intergenic
1127750137 15:62029779-62029801 GTTAAAAATTAGAATTTTGTAGG - Intronic
1128122440 15:65162622-65162644 GTTAGAAATAAGAAGACGGGAGG - Exonic
1128604839 15:69028826-69028848 GTTAAAAAAAAAAAGGTGTGTGG - Intronic
1129036992 15:72656320-72656342 GCTAAAAAAAAAAGTGTGGGGGG - Intronic
1129062186 15:72868990-72869012 GTTAAAAAATACAATTTGGGGGG + Intergenic
1129212894 15:74080905-74080927 GCTAAAAAAAAAAGTGTGGGGGG + Intronic
1129397507 15:75260181-75260203 GCTAAAAAAAAAAGTGTGGGGGG - Intronic
1129401117 15:75284458-75284480 GCTAAAAAAAAAAGTGTGGGGGG - Intronic
1129806809 15:78468148-78468170 CTTAAAAATAAAAATATGGCTGG - Intronic
1130433447 15:83873006-83873028 TTTAAAAGGAAGAATGTGGCTGG + Intronic
1131318986 15:91368225-91368247 GTTGAAAAAAAAAAAGTGGGAGG - Intergenic
1131650886 15:94398302-94398324 GTTAAAAATAACATTTTGGGGGG + Intronic
1132307597 15:100827467-100827489 GTAAAAATGAAGAATGGGGGAGG - Intergenic
1133014120 16:2931006-2931028 TTTAAAAATATAAATGTGGCCGG + Intronic
1133140668 16:3741506-3741528 TTTAAAAAGAAAAATGTGGCCGG + Intronic
1133460684 16:5983983-5984005 GAGAAGAAGAAGAATGTGGGAGG - Intergenic
1133530893 16:6653889-6653911 GATAAAAAGATGAATTTGGGTGG + Intronic
1133634456 16:7652402-7652424 AATAAGAAGAAGAATGTGGGCGG - Intronic
1135157955 16:20070520-20070542 GTTAAAAATTAGACTGTCTGGGG + Intronic
1135935836 16:26779266-26779288 GTTTAAAAAAAGAAGGTGGGGGG + Intergenic
1136645940 16:31615013-31615035 TCTAAAAAAAAGAAGGTGGGGGG - Intergenic
1137534739 16:49311301-49311323 GTTAAAACAAAGAATGAAGGCGG - Intergenic
1137645398 16:50068697-50068719 GCTAAAAATAGAAATGTGAGAGG + Intronic
1138396554 16:56709084-56709106 CTTAAAAAGAAGCATCTGGGGGG + Intronic
1138676892 16:58657863-58657885 GTCAAAAATGAGAATGGGGTGGG - Intergenic
1138698451 16:58837825-58837847 GTTAAAAATAAACATGAGGCCGG - Intergenic
1141742047 16:85899975-85899997 GTTTAAAAAAAGAAAGTGGGGGG - Intronic
1142689022 17:1593648-1593670 GTTAAAAATAAGAATCTATTTGG + Intronic
1144006596 17:11106008-11106030 GTTTGAAATAACAATGTGGAAGG + Intergenic
1144159021 17:12538857-12538879 ACTAAAAATAAGAATGGGGAAGG + Intergenic
1144315498 17:14057082-14057104 CTTAAAACTAAGGAAGTGGGTGG - Intergenic
1145115003 17:20201162-20201184 TTTAAAAAAAAGAAAGTGGCTGG + Intronic
1145180739 17:20749575-20749597 GTAAAAAATATGAATTTGGCAGG + Intergenic
1146219731 17:31008221-31008243 GTTACATATAAGAATGTGATTGG - Intergenic
1146429417 17:32777008-32777030 TTTAAAAATATGTGTGTGGGGGG + Intronic
1146992057 17:37283391-37283413 GTTAGCAATAAGAACCTGGGAGG + Exonic
1148250997 17:46080169-46080191 TTTAAAAATAATAATGTCAGAGG - Intronic
1148439927 17:47706658-47706680 GTTAAAAATAGTCTTGTGGGAGG + Intronic
1149524736 17:57346296-57346318 GTTAAAAATAAGGATGAGAAGGG - Intronic
1149548989 17:57525873-57525895 GTTAATCATAAGGATGAGGGTGG + Intronic
1149556191 17:57575124-57575146 GTTAAAAAAGAGAATGCGGCCGG - Intronic
1149597177 17:57871173-57871195 GTGAAAAAACAGATTGTGGGAGG - Intronic
1149757786 17:59201991-59202013 ATTAAAAAAAAGGATTTGGGTGG - Exonic
1149920217 17:60650960-60650982 TTTAAAAATAAAAACTTGGGAGG + Intronic
1150014280 17:61538122-61538144 ATGAATAATAAGAAAGTGGGAGG + Intergenic
1150096585 17:62381559-62381581 GTTAACAGTAGGAATGGGGGTGG - Intronic
1150210378 17:63438367-63438389 GTTAAAAACCAGGATGGGGGAGG - Intronic
1150661483 17:67084364-67084386 GTTAAAAAAAAGAAAGAGGCCGG + Intronic
1151576208 17:74953713-74953735 AATAAAAATAAAAAAGTGGGTGG - Intronic
1152810771 17:82381383-82381405 GAAACAAATAAGAATGTGTGTGG + Intergenic
1153110089 18:1576054-1576076 GCTAAAAATAAGAGTGTTGCAGG + Intergenic
1153189968 18:2527169-2527191 TTTATAAATAATAATGTAGGGGG + Intergenic
1153700952 18:7692563-7692585 ATTCAAAATAAAAATGTTGGTGG - Intronic
1153706148 18:7747822-7747844 GTACAACATAAGAATCTGGGGGG + Intronic
1154151546 18:11909975-11909997 TTTAAAAAAAAGAGGGTGGGGGG + Intergenic
1154222570 18:12469490-12469512 TTAAAAAATCAGAATGTGGCTGG - Intronic
1155077841 18:22377698-22377720 GTGACAAATAAGTATGTGGAAGG + Intergenic
1156165757 18:34418699-34418721 GTTAAAAAAAAGAAAGAGGCCGG - Intergenic
1156481268 18:37437858-37437880 TTTCAACATAAGAATTTGGGTGG - Intronic
1156797159 18:41060168-41060190 TTTGAAAATAAGAACTTGGGAGG + Intergenic
1157605275 18:48922514-48922536 GGTAAAAATAAAAATGAGGGTGG + Intronic
1157658810 18:49420516-49420538 GTTAAAAATTAAAATTTGGGGGG + Intronic
1158272953 18:55736421-55736443 GTTAAAACTCAGAATGTAAGTGG + Intergenic
1158309467 18:56143227-56143249 TTTAAAAATATGACTATGGGTGG + Intergenic
1158926145 18:62263184-62263206 CTTAAACATAAAAATTTGGGCGG + Intronic
1159755807 18:72362581-72362603 GTTAAAAAAAAAAAAGTGGCAGG - Intergenic
1160112735 18:76048855-76048877 GTTAAAAGTCAAAAGGTGGGGGG - Intergenic
1161189762 19:2947006-2947028 TTTAAAAATAATAAAGCGGGGGG - Intergenic
1161343158 19:3753656-3753678 TTTAAAAATAAGCTTATGGGAGG + Intronic
1162044802 19:7991397-7991419 GTACAAAATAAGACAGTGGGAGG - Intronic
1162067323 19:8133928-8133950 TTTAAAAAAAAAAATGTGGCTGG + Intronic
1162119538 19:8454676-8454698 GTTAAAAAAAAAAAGGGGGGGGG - Intronic
1162845622 19:13390108-13390130 ATAAAAAATAAAAATGTAGGTGG - Intronic
1162980202 19:14234111-14234133 TTAAAAAATAAAAATGAGGGAGG + Intergenic
1165564856 19:36715950-36715972 GTGAGAAATCAGAATATGGGAGG - Intronic
1167197842 19:48043005-48043027 GTTAAAAAAAAGTAAGTGGCAGG - Intronic
1167410384 19:49340547-49340569 GTGAAAAATAATCTTGTGGGTGG - Exonic
924961622 2:40373-40395 GTTAGAGAGAAGAATGTGGAGGG - Exonic
926080681 2:9983858-9983880 TTTAAAAAAAAAAATGTGGCCGG + Intronic
926835190 2:17011435-17011457 GTTCAAAATTAGAATGAGGTGGG - Intergenic
927002024 2:18806331-18806353 ATCTAAAATAAGAATGTGGCAGG + Intergenic
927623864 2:24691861-24691883 CTTAAAACTGAGAATCTGGGGGG - Intronic
928371155 2:30741187-30741209 GGAAAAACTAAGAATGTGGCTGG - Intronic
928669162 2:33582697-33582719 TTAAAAAATAATAATGTTGGGGG + Intergenic
928703067 2:33918672-33918694 CTTCAAAATAATAATGAGGGGGG + Intergenic
928818387 2:35326880-35326902 CTGAAAAATAATAATGTTGGAGG + Intergenic
929368290 2:41188793-41188815 TTTAAAAATAGTAATGTGGCAGG + Intergenic
929766327 2:44846796-44846818 TTTCATCATAAGAATGTGGGGGG + Intergenic
930409991 2:51013268-51013290 GGCAAACATAAGCATGTGGGTGG + Intronic
930871871 2:56179092-56179114 GTTAAAAAGAAGAAACTGTGAGG + Intergenic
930956021 2:57204003-57204025 TTTAAAAATGAGAATGGAGGTGG + Intergenic
931035602 2:58239769-58239791 GTTAAGTATATGTATGTGGGTGG - Intronic
931189414 2:59985468-59985490 TTTAAAAATAAAACTGTGAGTGG + Intergenic
931337863 2:61366749-61366771 CTTAGAAATATGAATGTGGCCGG + Intronic
931613968 2:64136607-64136629 GTTAAAAATACAAATGAGGCTGG + Intronic
931700756 2:64907134-64907156 TTTAAAAATAAGAATATAGCTGG - Intergenic
931917280 2:66969852-66969874 GTTAAAAAAAAAAAAGGGGGGGG + Intergenic
932040402 2:68293448-68293470 TTTAAAAATAACAATGTGTATGG - Exonic
932221323 2:70001459-70001481 GATCAAAATAAGGATGTGGCTGG + Intergenic
933119297 2:78516292-78516314 GAAAAAAATAAGCAAGTGGGAGG + Intergenic
933843923 2:86309838-86309860 CTTCAAAATACGAATTTGGGGGG + Intronic
933903507 2:86866465-86866487 TGGAAAAATAAAAATGTGGGAGG - Intergenic
934039540 2:88116511-88116533 GTCAAAAATAAAAATGGGGCAGG - Intergenic
934944272 2:98526478-98526500 TTTAAAAATAAGAATGATGAGGG + Intronic
935316094 2:101835704-101835726 TTTAAAAATAGCAAAGTGGGAGG - Intronic
935460980 2:103333997-103334019 GTTAAATATGCCAATGTGGGTGG - Intergenic
935519282 2:104084007-104084029 TTTAAAAATAAGAATGAAGTTGG - Intergenic
935626786 2:105178116-105178138 TTTTAACATAAGAATTTGGGTGG + Intergenic
936974931 2:118209290-118209312 GGTAATAAAAAGAAAGTGGGAGG + Intergenic
937325083 2:120985483-120985505 GTCAAACAGAAAAATGTGGGTGG + Intronic
937424898 2:121790564-121790586 GTGCAAAATGAAAATGTGGGGGG + Intergenic
937462547 2:122101940-122101962 TTTCAACATAAGAATTTGGGGGG + Intergenic
937620817 2:123983311-123983333 AATAAAAATGAGTATGTGGGGGG - Intergenic
938028530 2:127971585-127971607 GATAGAAATGAGAAAGTGGGTGG - Intronic
938246854 2:129783781-129783803 AATAAAGATAAGAAAGTGGGAGG + Intergenic
938441114 2:131333846-131333868 TGTAAAAATGAGAGTGTGGGAGG - Intronic
938915513 2:135935083-135935105 GTTAAAAATAACAAGATGGCCGG - Intronic
939258398 2:139775107-139775129 GTCATAAATGAGAATTTGGGGGG + Intergenic
939770683 2:146312626-146312648 TTTAAAAATAAGTTTGAGGGTGG + Intergenic
940937351 2:159511799-159511821 GTTAAAATAAAGAATGTTGTAGG + Intronic
941087883 2:161139275-161139297 GTTAACATTAAGAATGAGGTTGG + Intronic
941224127 2:162824242-162824264 TTTAAAATAAAGAATGTTGGTGG + Intronic
941649333 2:168076716-168076738 GTTAAAAAGAAAAATTTGGGGGG - Intronic
942977230 2:182032548-182032570 ATCAAAAATAAGTATGTGGTGGG - Intronic
943135507 2:183906043-183906065 GTTAAATATAAGAGTGGGGAAGG - Intergenic
943171805 2:184411047-184411069 GATAAAACTAAGACTGAGGGAGG - Intergenic
943314075 2:186364133-186364155 GTTATAAATATGAAAGTGGTGGG - Intergenic
943619222 2:190129406-190129428 TTTAAAAATAAGTATGTTGAGGG - Intronic
943771261 2:191720394-191720416 ATTAGAAATAATAATGTGGCTGG + Intergenic
944411143 2:199443734-199443756 GTTGAATATAAGAATGAGAGTGG - Intronic
945607118 2:211948489-211948511 GTAAAAATTAAAAATGTGGTTGG - Intronic
945800720 2:214426356-214426378 GTTAGAAATAAGAGTGAGGCGGG + Intronic
946479386 2:220039621-220039643 GTTAAAAATATGTATGTGTGTGG + Intergenic
946615655 2:221506704-221506726 GTTAAAAATTAGATTGTTGAAGG + Intronic
947019444 2:225658522-225658544 GTTACAAATAAGAATGTCAGTGG + Intergenic
947648652 2:231765280-231765302 ATAAAAAATAAAAAAGTGGGAGG + Intronic
948381785 2:237555526-237555548 CTTATAAATAAGACTGTTGGAGG - Intergenic
1169369641 20:5018833-5018855 GTTAAAAAAAAAAGTATGGGTGG + Intergenic
1169771991 20:9211073-9211095 GGTTAAAAAAAGAAAGTGGGTGG - Intronic
1169933508 20:10858564-10858586 GTTCAAAATAAGAAGTAGGGTGG + Intergenic
1171453973 20:25256384-25256406 GTTAAAAAAAAAAAAGTGGAGGG + Intronic
1172380435 20:34485932-34485954 ATTAGAAAACAGAATGTGGGAGG - Intronic
1175101258 20:56580321-56580343 GTCAAAAAGAACAAGGTGGGTGG + Intergenic
1176981256 21:15383703-15383725 ATTTAAAAAAAGAATGTTGGTGG + Intergenic
1177783362 21:25643092-25643114 TTTCAACATATGAATGTGGGGGG + Intronic
1177906177 21:26973704-26973726 TTTAAAATTATGTATGTGGGTGG + Intergenic
1178008685 21:28256391-28256413 GTTAATAATGAGTATGAGGGAGG + Intergenic
1178208263 21:30495760-30495782 GTTTTAAATAACAATGTGAGAGG - Intergenic
1178493565 21:33069797-33069819 GTTAAAAAAAAATATGAGGGAGG + Intergenic
1178564885 21:33674514-33674536 ATTAAAAATAATAATATGGAGGG + Intronic
1178738301 21:35172299-35172321 CTTCAAAATATGAATTTGGGAGG - Intronic
1180256689 21:46634890-46634912 TTTAAAAAAAAAAATGTGGAAGG - Intergenic
1180460265 22:15556800-15556822 TATAAAAATGAGAGTGTGGGAGG - Intergenic
1182503451 22:30765187-30765209 ATAAAAAATAAAAATGGGGGAGG - Intronic
1183824905 22:40378430-40378452 ATTAAAAATAATAATATGGCCGG + Intronic
1183910162 22:41073080-41073102 TCTAAAAATAAGAAAGCGGGGGG + Intergenic
1183980475 22:41536889-41536911 TTTAAAAAAAAAAAGGTGGGGGG + Intronic
1184352052 22:43950968-43950990 GTTTAAAAAAAAAATGTGTGTGG + Intronic
1184386203 22:44176075-44176097 TTTAAGAATGAGATTGTGGGAGG - Intronic
1184934534 22:47711368-47711390 GTTAAAAAAAAAAATGCGGCCGG + Intergenic
949191214 3:1251269-1251291 GTTGAAAATCAGATTATGGGTGG - Intronic
949470148 3:4386069-4386091 TTGAAAAATAATAATGTGAGAGG - Intronic
949531819 3:4963364-4963386 GTTAAAAATTAAAATCTGGCTGG + Intergenic
949691304 3:6643025-6643047 TTTTAACATATGAATGTGGGAGG + Intergenic
949981841 3:9506875-9506897 TTAAAAAATAACAATGAGGGCGG - Intronic
950145267 3:10645242-10645264 GTTAAAAATAAAAATGGAGGGGG + Intronic
950693966 3:14683405-14683427 GTTAGTAATAGGAATGTGCGAGG + Intronic
950919147 3:16676598-16676620 GTAAAAAATAATTATGAGGGAGG + Intergenic
951194566 3:19809397-19809419 GTTAAAAAAAAAAAGGTGGGGGG + Intergenic
951394459 3:22148395-22148417 GTTTAATAGAAGAATCTGGGTGG - Intronic
951771701 3:26264867-26264889 GCCAAGAAGAAGAATGTGGGGGG + Intergenic
951795696 3:26535832-26535854 ATTAAAAATTATAATATGGGAGG + Intergenic
951907352 3:27718227-27718249 GTTAAAAAAAAAAGTGGGGGTGG + Intronic
952232586 3:31447524-31447546 GTTTAAAATGTGAATGTTGGCGG - Intergenic
952255362 3:31690500-31690522 GTTCAAAATAAAAAAGTTGGAGG + Intronic
952432611 3:33238611-33238633 GATAAAAAGAAGAAGGTGGCCGG + Intergenic
952777831 3:37063283-37063305 GTGGAAAATAAGTATGTGTGTGG + Intronic
953119275 3:40024030-40024052 GCTACACATAAGAAAGTGGGTGG + Intronic
953649729 3:44791401-44791423 GTTAAAAAGAACAGTGTTGGAGG - Intronic
954359068 3:50108712-50108734 GAAAAAAAAAAGAATGTAGGGGG + Intronic
955106651 3:55905369-55905391 AGTAAAAAGAAGAATGTGCGTGG - Intronic
955518124 3:59748371-59748393 GGTAAAGAAAAGAAAGTGGGAGG + Intergenic
956016358 3:64887478-64887500 GATAAAAATAACAATGTAGTAGG + Intergenic
957188631 3:76976757-76976779 GTGCAAAATAAGAATGTGTTTGG - Intronic
957399841 3:79696037-79696059 AATAAAAATGAGAATGTGGGAGG + Intronic
957884800 3:86272622-86272644 GTTAAAAATTCCAATGTGGCTGG + Intergenic
959012143 3:101089950-101089972 GGTAAAAAAAAAAATGTGGCTGG + Intergenic
959016654 3:101142372-101142394 GATAAAGATAAGGAAGTGGGTGG + Intergenic
959476255 3:106815626-106815648 CTTATAGATATGAATGTGGGTGG + Intergenic
959567122 3:107844029-107844051 GTTAAAAAAAAAAATGCGGCCGG + Intergenic
959833985 3:110896905-110896927 GATTCTAATAAGAATGTGGGTGG - Intergenic
960463677 3:117968709-117968731 GTTAAAAATAAAAGTGTAGAAGG - Intergenic
960467878 3:118019791-118019813 GTTCAATATAAGAATTTGTGTGG + Intergenic
960607449 3:119521693-119521715 TTTAAAAAAAAAAAAGTGGGCGG + Intronic
960945865 3:122966143-122966165 GTGCCAAATAAGAGTGTGGGGGG - Intronic
961177213 3:124845497-124845519 GTGAAGAATGAGAATGTGGAAGG - Intronic
961243398 3:125431483-125431505 ATTAAAAAAAAAAATGTAGGAGG + Intergenic
962631636 3:137282069-137282091 TTTCAAAATAAGAAGTTGGGGGG - Intergenic
963574358 3:147041263-147041285 TTTAAAGATAAGAATGTCTGTGG + Intergenic
964271628 3:154962724-154962746 GTTAAAAATAAAGTTTTGGGAGG + Intergenic
964330256 3:155594278-155594300 ATTAAAAATAAGTATGAGGCTGG + Intronic
964446770 3:156767521-156767543 GTTATAGAGAAGAATCTGGGAGG + Intergenic
964838858 3:160971759-160971781 AATAAAAAAAAGAATGTGGTAGG - Intronic
965147508 3:164925455-164925477 GATAAAAACAAAAATGTGGCTGG - Intergenic
965333660 3:167408603-167408625 GTTAAAAATGCAAACGTGGGAGG - Intergenic
965567467 3:170135445-170135467 ATTAAAAAAAAAAATCTGGGCGG - Intronic
966542180 3:181104372-181104394 GTTAAAAATGTGATTGTTGGTGG + Intergenic
967887846 3:194345485-194345507 GGTAAAAATAAGAATTTGCCGGG - Intronic
970685138 4:18559099-18559121 GTTAAAAATAGGCAGGTGGCTGG + Intergenic
970904023 4:21194284-21194306 GTTATAAACAAAAATGTGAGAGG - Intronic
970928715 4:21483817-21483839 AATAAAAATAAAAATGTGTGTGG + Intronic
971436850 4:26635867-26635889 GACAAGAATAAGAATGTTGGAGG + Intronic
972134476 4:35875076-35875098 ATTAAAAATAAGTATGAGGATGG + Intergenic
972338983 4:38134376-38134398 GTTAAATTTCAGAATGTGAGTGG - Intronic
973148977 4:46864340-46864362 GTTAAAAAAAAAAATGTCGTGGG - Intronic
974578700 4:63765862-63765884 TTTAAAAATATGAACATGGGAGG + Intergenic
974760007 4:66262959-66262981 GTTAAAGACAAGATTCTGGGAGG + Intergenic
974799055 4:66791788-66791810 GTTATAGAGAAGAATCTGGGAGG + Intergenic
974989595 4:69069154-69069176 GTTAAAAGTATGAAAGTGGATGG - Intronic
975147993 4:70991497-70991519 TTGAAAAATACAAATGTGGGAGG - Intronic
975403730 4:73965918-73965940 ATTAAAAAGGAGAATTTGGGAGG - Intergenic
975687733 4:76934043-76934065 TTTAAATATATGAATTTGGGAGG - Intergenic
975996039 4:80316764-80316786 TTAAAAAAGAAGAAAGTGGGAGG + Intronic
977121383 4:93106029-93106051 ATTAAACATAAGACTGGGGGAGG - Intronic
977155451 4:93567249-93567271 ATTGTAAATAGGAATGTGGGGGG - Intronic
977321934 4:95527882-95527904 GTTGAAAACAAAAATGTGGGAGG - Intronic
977971237 4:103217022-103217044 CTTAAAAAGAAGATTGAGGGAGG + Intergenic
978589027 4:110304074-110304096 ATTAGAAATAAGAATGGGAGGGG + Intergenic
978905883 4:114005008-114005030 GTTTAAAGTAAGAATGAGAGTGG - Intergenic
979028088 4:115602935-115602957 GGTAGAAATATGAATGTGGATGG - Intergenic
980222777 4:129941517-129941539 GTTAACAATAATGATTTGGGTGG - Intergenic
980702489 4:136450841-136450863 CTTAAAAATATGAATGTGAAGGG + Intergenic
981023408 4:140052092-140052114 GAAAAAAATGAGAATGTGGGAGG + Intronic
981550162 4:145935968-145935990 TTTAAAAAAAAAAATGTTGGCGG - Intronic
981637862 4:146900672-146900694 TTTAAAAATCAGAATGAGAGGGG + Intronic
981732534 4:147914560-147914582 GTTAAAAAAAAAAAGGGGGGGGG - Intronic
982408431 4:155045762-155045784 GTTCAACATATGAATTTGGGAGG - Intergenic
982441097 4:155436863-155436885 ATTAAAAGTATGATTGTGGGTGG + Intergenic
983562579 4:169115835-169115857 GTTAAAAATATATATGTGTGAGG - Intronic
983675179 4:170283920-170283942 GATAAAAATCAGAATGTGTTTGG + Intergenic
983715710 4:170778807-170778829 TTTAAAAATGAAAATGTGGCTGG + Intergenic
984851240 4:184154599-184154621 TTTAAAAATAAAATTTTGGGAGG - Intronic
985858907 5:2454070-2454092 GTTCAACATGAGAGTGTGGGTGG + Intergenic
986270050 5:6222122-6222144 GTTAAAAATAATCAGTTGGGAGG + Intergenic
986280825 5:6320999-6321021 CTTCAAAATATGAATTTGGGAGG + Intergenic
987291676 5:16514238-16514260 GTTAAAAATAAGAATGTGGGAGG - Intronic
987960879 5:24806678-24806700 TTTCAGAATAAGAATGTGAGAGG + Intergenic
988071653 5:26297268-26297290 GTTAAAAAAAAGAAGATGGAAGG - Intergenic
988076086 5:26357413-26357435 GTTAAAAAAAAGAAAGAGGCAGG - Intergenic
988303107 5:29459183-29459205 GTAAAAAATAAAAATATGGCCGG - Intergenic
988426079 5:31066328-31066350 GTTCAAGATGAGAATGCGGGTGG - Intergenic
988595749 5:32588830-32588852 ATAAAAAATAAGAATGTGAATGG + Intronic
988638818 5:33018177-33018199 GTTCAAAAGAAGAATATGGAAGG + Intergenic
988931299 5:36038019-36038041 GTTGTAAATAAGAAAGAGGGTGG + Intronic
988997025 5:36724619-36724641 GTTGAAAATAAGGAAGAGGGAGG + Intergenic
989220118 5:38949398-38949420 TTTAAAAAGAAGCATGTCGGGGG - Exonic
989329036 5:40234141-40234163 GTTAAAAATACAAAGATGGGAGG - Intergenic
990172775 5:53073093-53073115 GTTAAAAGTAAAAAGGAGGGGGG - Intronic
990514398 5:56518320-56518342 GTTAGAAATAAGGATTTGGTAGG - Intronic
990828185 5:59925197-59925219 GTTAAAAAGTAGAAAGTAGGAGG + Intronic
990973520 5:61536243-61536265 GGTAGAAATAAAAAGGTGGGTGG - Intronic
991309980 5:65227844-65227866 GTTACAAAAAATACTGTGGGAGG + Intronic
991336428 5:65553099-65553121 GCAAAAAATAAAAAGGTGGGGGG + Intronic
991622574 5:68560020-68560042 TTTCAACATATGAATGTGGGAGG + Intergenic
991984475 5:72269894-72269916 ATAAAAAATAAAAATGTGGCCGG + Intronic
992426269 5:76661100-76661122 GTTAAAAATAAAAAGGTGTGGGG - Intronic
994311394 5:98275611-98275633 TTTAAAAATAATAAAATGGGAGG + Intergenic
994745255 5:103669647-103669669 GGGAAAAATAAAAATGTCGGGGG - Intergenic
994979003 5:106848172-106848194 GTAAAAAATAAGAATAAGGCCGG - Intergenic
996148659 5:120007992-120008014 GCAAAAAATAAGAATCTGGATGG - Intergenic
996258381 5:121434837-121434859 GTTTAATATATGAATTTGGGAGG - Intergenic
997930191 5:138066501-138066523 TATAAAAATAAAAATGTGGCCGG + Intergenic
998200916 5:140119525-140119547 GTTGATAATGAGAATCTGGGTGG + Exonic
998987739 5:147780761-147780783 GTGAAAATTATAAATGTGGGGGG + Intronic
999014027 5:148077457-148077479 CTTAAAAATAATAATGAAGGAGG + Intronic
999306702 5:150524220-150524242 GTTGAAAACAAGACAGTGGGTGG + Intronic
999899184 5:156067963-156067985 ATTAAAAAAAAAAAAGTGGGGGG - Intronic
999954177 5:156682346-156682368 TTTAAAAATAAGATTCTGGAAGG + Intronic
1000353273 5:160369509-160369531 GGCAAAAATAAGGATGTGAGAGG + Intronic
1000894951 5:166844479-166844501 TTTAAAAATATGGATATGGGAGG - Intergenic
1000933045 5:167275299-167275321 TTAAAAAAGAAGAAAGTGGGAGG - Intergenic
1001656253 5:173352733-173352755 GTTAAAATTAAAAATGTGGCAGG + Intergenic
1001821153 5:174711297-174711319 TTTAAAAATAAAAGTGTGGCGGG + Intergenic
1002961421 6:1918448-1918470 TTTAAAAATAAGAATAAGGCCGG + Intronic
1003453132 6:6255840-6255862 TTTAAAAAGAAGATTGAGGGTGG + Intronic
1003456766 6:6290441-6290463 TATAAAAATAAAAATGTGGTAGG + Intronic
1003531708 6:6942516-6942538 GTTTAAAAAAAAAATGTGAGAGG + Intergenic
1003751959 6:9068815-9068837 GTTAAACATATGAATTTTGGTGG + Intergenic
1004069826 6:12288238-12288260 GTTAAAAAAAAAAAAGTAGGGGG + Intergenic
1004221410 6:13750429-13750451 TTTAAAAAGAAGAATGAAGGTGG - Intergenic
1004775215 6:18836551-18836573 TTTAAAAATAAGAATCTGTAAGG - Intergenic
1004780596 6:18904229-18904251 TTTAAAAAGAGGAATGTGGCAGG + Intergenic
1005031031 6:21509348-21509370 AATAAAAATAAGTATGTGTGAGG - Intergenic
1005383701 6:25264216-25264238 CTTCAAAATATGAATCTGGGGGG - Intergenic
1005623534 6:27642408-27642430 GTTAAAAATAAAAATGGGCCCGG + Intergenic
1005694755 6:28341545-28341567 TTTAAACATAAGAATTTTGGGGG + Intronic
1005879710 6:30046439-30046461 TTTAAACATAGGAATTTGGGTGG + Intergenic
1005972487 6:30772221-30772243 GTTCAACATACGAATTTGGGGGG + Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007153819 6:39723070-39723092 GTTTAAGCTAAGAATCTGGGGGG + Intronic
1007296743 6:40828856-40828878 TTTAAAAATAAGCATGTGGATGG - Intergenic
1008132940 6:47739226-47739248 GCTGAGAATAAGAATGGGGGAGG + Intergenic
1008305885 6:49899586-49899608 GTTAGGAAGAAGAATGTGGTTGG - Intergenic
1008747844 6:54694349-54694371 GTTAACATCAACAATGTGGGTGG - Intergenic
1008808011 6:55455167-55455189 ATTAACAATAAGAATGTGAATGG - Intronic
1008892632 6:56512866-56512888 GCTGCACATAAGAATGTGGGAGG + Intronic
1010433852 6:75808507-75808529 CTTAAACATATGAATTTGGGGGG + Intronic
1010496252 6:76536791-76536813 GTTAAATATAACACTTTGGGAGG - Intergenic
1011471853 6:87716136-87716158 GTAAATAAAAAGAATGTGGCTGG + Intergenic
1011563782 6:88651749-88651771 GTTTAAAATAAAAATTTGGGGGG - Intronic
1011650497 6:89502030-89502052 GTTAACAATAAGAATATGGGAGG - Intronic
1012322749 6:97871150-97871172 TTTAAAAATAAGAATGACAGTGG - Intergenic
1012972037 6:105741625-105741647 TTTAAAAATAAAACTGTGTGGGG + Intergenic
1013158954 6:107522869-107522891 GTGATTAATCAGAATGTGGGAGG + Intronic
1013334807 6:109145829-109145851 GTTTAAAATAGAAATGTAGGAGG + Intronic
1013699797 6:112751466-112751488 GTTAAAAATATCACTTTGGGAGG - Intergenic
1013728590 6:113134105-113134127 ATTTAATATATGAATGTGGGTGG - Intergenic
1014025120 6:116637764-116637786 GTTAAAAAAATTAATGTGGCTGG + Intronic
1014133165 6:117857765-117857787 TTTAAAAATAAAAAGGTGTGGGG - Intergenic
1015056012 6:128904233-128904255 GCTAAAAGTAAGACTGTAGGTGG - Intronic
1015140504 6:129925784-129925806 TTTAAAAATAAGCATATGGCCGG - Intergenic
1015470981 6:133606142-133606164 GATAAAAGTAAGAAATTGGGAGG + Intergenic
1016955829 6:149625968-149625990 GTTGAGAATGAGAATTTGGGAGG + Intronic
1017059898 6:150472739-150472761 CCTAAAGATAAGAAGGTGGGAGG - Intergenic
1017092335 6:150771114-150771136 AAGAAAAATAAGAATGAGGGTGG + Intronic
1017670567 6:156765907-156765929 GCTAGAAATTAGAATGTGGCAGG + Intergenic
1017684413 6:156897568-156897590 TTTAAAAATAAGAATCTGGCTGG - Intronic
1017700836 6:157069057-157069079 GTTAAACATTAAAATGTAGGGGG - Intronic
1017933956 6:158987765-158987787 GCTAAAAGTTAGTATGTGGGGGG - Intronic
1019222683 6:170486739-170486761 ATTAAAAATAAAACTCTGGGTGG + Intergenic
1021174349 7:17433835-17433857 CTTAAAAATAAAAATGTTGTAGG - Intergenic
1021414061 7:20361619-20361641 GTTCAACATATGAATTTGGGGGG + Intronic
1021485488 7:21164049-21164071 TTTAAAAAGAAGAATCTGGTAGG - Intergenic
1021684792 7:23173833-23173855 GTTAAGAGTAAGAATTTAGGTGG + Intronic
1022704797 7:32792328-32792350 TTGAAAAATCATAATGTGGGAGG + Intergenic
1022910132 7:34892931-34892953 TTGAAAAATCATAATGTGGGAGG + Intergenic
1022975688 7:35553972-35553994 GTTAAAAATAAGATTGTCTCAGG + Intergenic
1023047705 7:36225348-36225370 GCCAAAAATCTGAATGTGGGTGG - Intronic
1023062416 7:36341484-36341506 TTTCAAAATAAGAATGTGGGTGG - Intronic
1023920778 7:44627971-44627993 TTTAAAAATAACAATGGGGCTGG - Intronic
1024635478 7:51285792-51285814 TTGAAAAATAAGAATGTTGGAGG + Intronic
1025846770 7:65206250-65206272 CTTAAAAATAATAATATGGCTGG + Intergenic
1025909751 7:65818829-65818851 TTTAAAAAAAAAAATGTGGTTGG + Intergenic
1027947054 7:84760511-84760533 GTTAAAAATCATAATTTTGGAGG - Intergenic
1028021197 7:85775962-85775984 GATGAAAATAATATTGTGGGCGG - Intergenic
1028311746 7:89346951-89346973 ATGTAAAATAAGAATGTGTGTGG + Intergenic
1028320178 7:89450099-89450121 GATAAAAATAAGACTGTAGTGGG + Intergenic
1028478551 7:91278355-91278377 GTAAAGAATGAGAATGTGGAAGG - Intergenic
1028763531 7:94522955-94522977 GTTAAAAATAAAAAGTTGGCCGG - Intronic
1028781424 7:94741445-94741467 AATAAAAAAAAGTATGTGGGAGG + Intergenic
1028805158 7:95017658-95017680 TTTAAAAAAAAGAAGGTTGGAGG + Intronic
1028850261 7:95530158-95530180 AGAAAAAATAAGGATGTGGGGGG + Intronic
1029374475 7:100169706-100169728 TTTAAAAAAAACAAGGTGGGGGG - Exonic
1029575317 7:101399754-101399776 GTTCAAAATTAGAATGAAGGCGG - Intronic
1029958642 7:104666819-104666841 ATTAAAAAAAAGAATGAGGCTGG - Intronic
1030495880 7:110299573-110299595 GCTGAAAAAAATAATGTGGGAGG - Intergenic
1031137217 7:117898089-117898111 GTTAAATATGAGTATGTAGGGGG - Intergenic
1031668597 7:124516410-124516432 GTTATATATATGAGTGTGGGGGG - Intergenic
1032337544 7:131040105-131040127 GGGAAAAAAAAGTATGTGGGAGG + Intergenic
1032703256 7:134400259-134400281 CTTAAAAATAACAATGGGGCTGG + Intergenic
1032895469 7:136246127-136246149 GATATAAATAAGAATGGGGGTGG - Intergenic
1033108197 7:138550004-138550026 GCTAAGATTAAGAATGGGGGAGG + Intronic
1033118960 7:138650124-138650146 ATTAAAAATAAGAATTTTGCTGG - Intronic
1033290210 7:140077024-140077046 GTCAAGAATAATAATGTTGGAGG - Intergenic
1033353428 7:140580935-140580957 TTTAAAAATAACAAGCTGGGTGG - Intronic
1033927738 7:146484847-146484869 CTTAAAAATAAGAATATGTAAGG - Intronic
1034233638 7:149552064-149552086 GATAAAAATAAGAAAGTTAGAGG + Intergenic
1034691538 7:153018138-153018160 GAGAAAAGAAAGAATGTGGGTGG - Intergenic
1034946683 7:155266936-155266958 ATTAAAAAAAAAAAGGTGGGAGG - Intergenic
1035223520 7:157420759-157420781 GGGAAAAACAAGAATGTGCGGGG - Intergenic
1035449397 7:158966095-158966117 GCAAAAAATAAGATGGTGGGGGG - Intergenic
1035944509 8:3946469-3946491 TTTAAAAAGAACAAAGTGGGAGG - Intronic
1039324298 8:36467527-36467549 GTTAAAAAAAAAAAAATGGGAGG + Intergenic
1040716197 8:50255825-50255847 GTTCAACATAAGAATTTGGGGGG + Intronic
1040786498 8:51170899-51170921 GTTAAATATAAGAAAGTTTGCGG - Intergenic
1041521221 8:58758334-58758356 GTCAACAATTACAATGTGGGAGG - Intergenic
1042376052 8:68054514-68054536 GTCAAAAATAAAAATCTGGTAGG + Intronic
1043001572 8:74766352-74766374 ATTAAAAAAAAGAATATGGGGGG + Intronic
1044088928 8:87975274-87975296 CTTAAAAAAAAAAATGTTGGGGG + Intergenic
1044689061 8:94858967-94858989 GTTTAAAATAAGAAGGAGGCTGG + Intronic
1044733874 8:95257495-95257517 GTTAAAAAAAACATTGTTGGAGG - Intronic
1046010489 8:108540603-108540625 GTGAAATCTAAGAATATGGGCGG - Intergenic
1046267757 8:111853446-111853468 ATTAAAAATAAGAAAGTAGCTGG - Intergenic
1046536536 8:115520592-115520614 GCAAAAAATAAAAATGTAGGTGG + Intronic
1046800724 8:118423596-118423618 TATAAAAATAAGCATGGGGGTGG - Intronic
1047740700 8:127804017-127804039 ATTAAAAATAAGAATTTTTGAGG - Intergenic
1050017490 9:1250231-1250253 GTTAAAAAAAAAAAAGTTGGGGG - Intergenic
1050983373 9:12049462-12049484 TTTCAAAATATGAATTTGGGAGG + Intergenic
1051756493 9:20406384-20406406 CTTAAAAATATGTATGTGGTAGG - Intronic
1051972696 9:22909980-22910002 GTTAGAAATATGAATGTGAAAGG - Intergenic
1051990866 9:23151387-23151409 GTTAAAAAAAAAAAACTGGGGGG - Intergenic
1052400175 9:27990463-27990485 GTTAAAAATAAAAGGGGGGGGGG - Intronic
1052524350 9:29594765-29594787 ATTAAAATTAAAAATGTGGCCGG + Intergenic
1052525828 9:29618446-29618468 TTTCAAAATAAGAAGGTGGGTGG + Intergenic
1052626919 9:30986981-30987003 GTAAAAAATAATCTTGTGGGGGG + Intergenic
1052712802 9:32077658-32077680 GATAAAAATAAAAATGTTAGAGG - Intergenic
1053910016 9:42889070-42889092 ATTAAAAAAAAGAATGAGGTAGG + Intergenic
1054148633 9:61582841-61582863 TTTAAAAAAAAGAGTGTGTGTGG - Intergenic
1054371773 9:64406017-64406039 ATTAAAAAAAAGAATGAGGTAGG + Intronic
1054760934 9:69003464-69003486 GTTAAAAAAAAAAAAGGGGGGGG + Intronic
1055093236 9:72383961-72383983 ATTAAAAAAATGGATGTGGGCGG - Intergenic
1055094121 9:72392975-72392997 ATTAAAAATAAAATAGTGGGTGG + Intergenic
1055549895 9:77423553-77423575 TTTAAAAATAAGAATGTTAATGG - Exonic
1055903164 9:81264191-81264213 TTTAAAAATAACGAGGTGGGTGG + Intergenic
1055919899 9:81449324-81449346 TTTAAAAAATTGAATGTGGGAGG - Intergenic
1057247960 9:93473829-93473851 GTTAAAAGTGAGTATGGGGGTGG + Intronic
1059468624 9:114486203-114486225 CTTAAAAAGAAGAAAGTTGGGGG - Intronic
1059771424 9:117430162-117430184 GTTAAAAAGAAGTGTGTGGGTGG + Intergenic
1060451964 9:123750996-123751018 GTTTAAAATAAGTGTTTGGGAGG - Intronic
1060577220 9:124707757-124707779 CTTCAAAATAAAAAGGTGGGGGG - Intronic
1060678569 9:125540193-125540215 GTGAAAAATCAGAAGGTGGTAGG - Intronic
1060699758 9:125740484-125740506 GATAAAAATTAGAAGGTGGTGGG + Intergenic
1062125959 9:134863093-134863115 TTTAAACATATGACTGTGGGGGG + Intergenic
1185724390 X:2407693-2407715 CTTATAAGTAAGAATGTAGGAGG - Intronic
1185801371 X:3014323-3014345 GTTGAATATAATAATGTGTGCGG + Intronic
1185834515 X:3332538-3332560 CTTAAAAAGAAGAATGTGGCCGG - Intronic
1186151214 X:6676672-6676694 GTTCAACATAAGAATTTTGGGGG - Intergenic
1186690078 X:11966190-11966212 GTTCAACATATGAATGTGGGGGG - Intergenic
1186806448 X:13144778-13144800 CTTTAACATATGAATGTGGGGGG + Intergenic
1187204842 X:17171929-17171951 GTTAATAATAATAATGATGGTGG + Intergenic
1188138381 X:26518072-26518094 TTTCAAAATATGAATTTGGGAGG + Intergenic
1188345367 X:29058077-29058099 GTTAAAAATAGGAAAGAGGCCGG + Intronic
1189074186 X:37898304-37898326 TTTCAACATATGAATGTGGGGGG + Intronic
1189440115 X:41028371-41028393 TTTAAAAATATATATGTGGGCGG + Intergenic
1189557139 X:42156733-42156755 GTTTAAAAAAAGAATGTCGATGG - Intergenic
1191168007 X:57411881-57411903 ATTAAAAATAATAATGTTGTGGG - Intronic
1191706596 X:64100525-64100547 GATAAACAGAAGAGTGTGGGAGG + Intergenic
1191838444 X:65490391-65490413 AAAAAAAAAAAGAATGTGGGTGG + Intronic
1192314741 X:70042869-70042891 GTTAAAAAAAAAAAAGAGGGAGG - Intronic
1192464925 X:71347952-71347974 GTAAAAAAAAAAAATTTGGGTGG - Intergenic
1193571115 X:83145302-83145324 CTTATACATAAAAATGTGGGGGG + Intergenic
1195374811 X:104216642-104216664 ATTAAAAATACCAATGGGGGAGG + Intergenic
1196376449 X:115038397-115038419 GTAAAAAACAGGAAGGTGGGTGG + Intergenic
1196481458 X:116155023-116155045 GTGAAAAAGCAGAATATGGGTGG + Intergenic
1197176925 X:123495896-123495918 ATTCAAGATAAGAATGAGGGAGG - Intergenic
1197303314 X:124807671-124807693 TTAAAAAATCAAAATGTGGGGGG + Intronic
1198443704 X:136690014-136690036 CTTATAAATAAAAATGTGGGGGG + Intronic
1199027160 X:142953481-142953503 CTTATAAGTGAGAATGTGGGTGG + Intergenic
1200001279 X:153061522-153061544 CTTAAAAATAGGAATGTGCCAGG - Intergenic
1200275133 X:154724901-154724923 GTTTAACATATGAATTTGGGGGG - Intronic
1201387656 Y:13460298-13460320 GTTAAAGATAAAAATATGGTAGG - Intronic
1201629363 Y:16052728-16052750 GTTCAAAATAAGAATTTTGGGGG - Intergenic
1201980066 Y:19897441-19897463 GCAAAAAATAAGAAAGTTGGAGG + Intergenic