ID: 987292762

View in Genome Browser
Species Human (GRCh38)
Location 5:16524027-16524049
Sequence CTCAGATGGAAGGCGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 434}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987292762_987292771 21 Left 987292762 5:16524027-16524049 CCCTGCCCCGCCTTCCATCTGAG 0: 1
1: 0
2: 3
3: 37
4: 434
Right 987292771 5:16524071-16524093 ATCAGTTCCCTCAAAGATGATGG 0: 1
1: 0
2: 0
3: 19
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987292762 Original CRISPR CTCAGATGGAAGGCGGGGCA GGG (reversed) Intronic
901618356 1:10560345-10560367 AAAAGATGGAAGGCCGGGCATGG - Intronic
902122025 1:14174293-14174315 CTCAGAAGGAAAGGAGGGCAAGG + Intergenic
902372386 1:16014752-16014774 CAGAGATGGAAGCCAGGGCATGG - Exonic
902665497 1:17934821-17934843 ATAAAATGGAAGGCGTGGCATGG + Intergenic
902817255 1:18923324-18923346 CTCATGAGGAAGGCGAGGCAGGG + Intronic
903954115 1:27013023-27013045 CTGAGAAGGAGGGCGGGGCAGGG - Intergenic
904039264 1:27575020-27575042 CGCAGTTGGGAGGCGGGGCGGGG + Intronic
904471022 1:30736279-30736301 CTCAGATGGAAGCAGGAGCTGGG + Intronic
906259336 1:44374669-44374691 CTCAGATGGTAGAAGAGGCAAGG - Intergenic
907312474 1:53546870-53546892 CTGTGATGGAAGGAAGGGCATGG - Intronic
907364410 1:53946649-53946671 CCCAGAGGGACGGCGGGGCGCGG + Intronic
907845764 1:58205184-58205206 CTCAGATGGAAGTCTGTCCATGG - Intronic
907877259 1:58503653-58503675 CTCACATGGTAGAAGGGGCAAGG - Intronic
908429323 1:64040683-64040705 CTCACATGGTAGGAGAGGCAGGG + Intronic
909623163 1:77687731-77687753 CCCAGATGGAAGGAGGGGTGGGG - Intergenic
910224211 1:84919771-84919793 CACTGATGGAGGGTGGGGCATGG + Intergenic
910544645 1:88400117-88400139 CTCACATGGTAGAAGGGGCAAGG + Intergenic
910711800 1:90189862-90189884 CTCACAGGGAAGGCGGGGAAGGG - Intergenic
912445434 1:109732474-109732496 TTCAGATGGATGGTGGGGGAAGG - Intronic
913219946 1:116651280-116651302 CTAAGATGGAAGGCAGGGATAGG - Intronic
913365787 1:118036944-118036966 CTCAGTGGGAAGGCTGGGAATGG + Intronic
913996025 1:143652451-143652473 CTCAGAGGGGAGCCGGGGCGAGG - Intergenic
914077496 1:144369073-144369095 CTCACATGGAGGAAGGGGCAAGG + Intergenic
914101683 1:144597432-144597454 CTCACATGGAGGAAGGGGCAAGG - Intergenic
915100357 1:153494984-153495006 CTCAGAAGGAAGGTGGGGAGGGG - Intergenic
915734918 1:158078567-158078589 GTGAGGTGGAAGGAGGGGCACGG - Intronic
915863384 1:159471771-159471793 CTCAGTTGGCAGAAGGGGCAAGG - Intergenic
917123495 1:171665065-171665087 CTGAGAGGGAAAGCAGGGCATGG - Intergenic
918003825 1:180523509-180523531 CTCAGATGGACAATGGGGCATGG - Intergenic
918257917 1:182766834-182766856 CTCAGATGGAAGGTGAGCAAGGG + Intergenic
919889152 1:201957846-201957868 CTCAGGTGTGAGGCCGGGCACGG + Intronic
920297678 1:204969031-204969053 CTCAGAGGGAAGGGTGGGCATGG - Intronic
920381824 1:205539202-205539224 CTCAGATTGTGGGCTGGGCATGG - Intergenic
920982588 1:210852241-210852263 CCCAGAGGGAAGGAGGGGCTTGG + Intronic
921308147 1:213817313-213817335 CAGAGAAGGAAGGCGGGGGAAGG + Intergenic
921686464 1:218094749-218094771 CTCACATGGTAGAAGGGGCAAGG - Intergenic
922117251 1:222626047-222626069 ATCAGATGGGGGGCTGGGCATGG - Intronic
922242571 1:223765505-223765527 CACAGATGGAGGGTGGGGCTGGG + Intronic
922255173 1:223887306-223887328 ATCACATGGTAGGCCGGGCACGG - Intergenic
922420599 1:225458846-225458868 ATCAGTTGTAAGGCTGGGCATGG + Intergenic
922804403 1:228378085-228378107 CTCAGGTGGACGGGGGTGCAGGG - Intronic
923110699 1:230887716-230887738 CTCTTAAGGAAGGCTGGGCATGG - Intergenic
923277128 1:232406357-232406379 CTAAGGTGGAACGCTGGGCATGG + Intronic
923497821 1:234540462-234540484 CACAGATGCAAGAAGGGGCAAGG - Intergenic
924494870 1:244577602-244577624 CTCACATGGCAGAAGGGGCAAGG + Intronic
924934868 1:248759154-248759176 CACAGAGAGAAGGCGGGTCAGGG - Intergenic
1063291884 10:4758117-4758139 CTGAGGAGGAAGCCGGGGCATGG - Intergenic
1063301033 10:4849000-4849022 CACATCTGGAAGGCTGGGCAGGG - Intergenic
1063613226 10:7580706-7580728 CGCAGAGGGGAGGAGGGGCATGG + Intronic
1064306857 10:14175271-14175293 CACAGATGGAAAGAAGGGCAAGG - Intronic
1065047637 10:21758460-21758482 CTCAGATGGGAGGAGGGGGCGGG - Intronic
1065327462 10:24561474-24561496 CTCACATGGTAGAGGGGGCAAGG - Intergenic
1065875644 10:29995207-29995229 GTCACATGGAAGGCTGGGGAGGG + Intergenic
1066054576 10:31668500-31668522 CTCACATGGAAGAAGGGACAGGG + Intergenic
1067159712 10:43815008-43815030 CTCAATTGGAGGGCAGGGCAGGG - Intergenic
1068520632 10:58073461-58073483 CTCAGAAGGAGGGAGGGGCCAGG - Intergenic
1068766645 10:60771806-60771828 CTCACATGGTAGAGGGGGCAAGG - Intergenic
1068902673 10:62287494-62287516 CTCACATGGCAGAAGGGGCAAGG + Intergenic
1069497594 10:68920087-68920109 CTGAGTTGTAAGGCTGGGCATGG + Intronic
1069720914 10:70548829-70548851 CCTAGCTGGAAGGCAGGGCAAGG + Intronic
1070130529 10:73652764-73652786 AGCAGGTTGAAGGCGGGGCAAGG - Intronic
1070330928 10:75416389-75416411 ATCAGATGGACGGAGGGGCAGGG - Intergenic
1070602952 10:77878436-77878458 CTCCTAAGGAAGGCAGGGCATGG + Intronic
1070698014 10:78577434-78577456 CTGAGTTGGAAGCCTGGGCAAGG + Intergenic
1070952624 10:80443484-80443506 CTCCAATGGAAGGTGTGGCATGG - Intergenic
1071177238 10:82940723-82940745 CTCACATGGTAGAAGGGGCAGGG + Intronic
1072066875 10:91879915-91879937 CTCAGTGGGCAGGGGGGGCATGG - Intergenic
1072552062 10:96486761-96486783 CACAGTTTGAAGGCGGAGCATGG + Intronic
1072758717 10:98038495-98038517 CTCAAAGGCAAGGCGGGGCGGGG + Intergenic
1072785746 10:98279936-98279958 CTCAGGGGGAAAGCGTGGCAAGG + Intergenic
1073643477 10:105276259-105276281 TTCAGGTGGAAGTGGGGGCAGGG - Intergenic
1074818432 10:117162508-117162530 CCCAGATGGAAGACAGAGCAGGG - Intergenic
1074924623 10:118055178-118055200 CTCGGATGGAAGGAGGCTCAGGG - Intergenic
1075077089 10:119358890-119358912 CTCAGAGGAAAGGCCGGGCAAGG - Intronic
1075467744 10:122664220-122664242 CTCAGAAGGTAGGTGGGGAAGGG + Intergenic
1076161970 10:128251363-128251385 CCCAGATGGAAGCCCAGGCAGGG - Intergenic
1076738382 10:132468623-132468645 AGGAGATGGAAGGCGGGGGAGGG + Intergenic
1077218600 11:1405391-1405413 CACAGGGGGAAGGCTGGGCAAGG - Intronic
1077278610 11:1730616-1730638 CTCAGATGGATGGGGGCACAAGG - Intergenic
1077578524 11:3402459-3402481 CTCAGATGGCAGGGGTGGCCTGG + Intergenic
1077614943 11:3667763-3667785 CTCTGGGGGCAGGCGGGGCAGGG + Exonic
1078444662 11:11395173-11395195 CACAGTTGGAAGGTTGGGCATGG + Intronic
1078999578 11:16739934-16739956 CTCTGATGGGAGGTGGGGCGAGG + Intronic
1079151949 11:17907776-17907798 CTCAGAGGGAAGATGGGGTAGGG + Intronic
1080397288 11:31901949-31901971 CTCACATGGCAGAAGGGGCAAGG + Intronic
1080503643 11:32892760-32892782 CTCAGAGGGGAGGCGGGGCAAGG + Intergenic
1081885850 11:46495558-46495580 TGCAGATGAAAGGAGGGGCAAGG + Intronic
1083145526 11:60755521-60755543 ATCAGATAGTAGGCCGGGCACGG - Intergenic
1083288525 11:61676637-61676659 CTCAGAGAGAAGGCCAGGCATGG + Intergenic
1083846654 11:65338461-65338483 GTCAAATGGAAGGCAGGGCCAGG - Intronic
1084081102 11:66825521-66825543 CTCACATGGCAGAAGGGGCAAGG - Intronic
1084088551 11:66865823-66865845 CTCAGATGGGAGGTGGTGCTTGG + Intronic
1084328693 11:68416952-68416974 CTCATAGGGAAAGCGGGGCCAGG + Intronic
1085965668 11:81521022-81521044 CCCAGATGGAAGTCAGGGAACGG - Intergenic
1087144959 11:94801818-94801840 CTGACATTGAAGGAGGGGCAGGG + Intronic
1087159773 11:94937273-94937295 CTCAGGTCGGAGGTGGGGCATGG + Intergenic
1087512458 11:99115002-99115024 CTCACATGGAAGAAGGGGGAAGG - Intronic
1087673662 11:101134248-101134270 CTCACATGGTAGAAGGGGCAGGG - Intergenic
1088223357 11:107591753-107591775 CCAAAATGGAAGGCGGGACAAGG + Intronic
1088910972 11:114192348-114192370 CCCAGATAGAAGGCGGTGGAAGG + Intronic
1089054093 11:115570868-115570890 CTCATAAGCAAGGCCGGGCATGG - Intergenic
1089420536 11:118330094-118330116 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1091746622 12:2996901-2996923 TACAGATGCAAGGCCGGGCATGG - Intronic
1091910539 12:4227093-4227115 CTCAGAAGGGAAGAGGGGCAGGG - Intergenic
1092926797 12:13278963-13278985 ATCAGATGGGAGGCAGAGCAGGG + Intergenic
1093480844 12:19602383-19602405 CTCATATGGCAGAGGGGGCATGG - Intronic
1094318536 12:29159246-29159268 GTAAGATGGGAGGCCGGGCACGG + Intronic
1094392873 12:29971825-29971847 TTCAGATGGAGGGCTGTGCATGG - Intergenic
1094619891 12:32069972-32069994 CTCAGAAGGGTGGCGGGGCTGGG - Intergenic
1095877700 12:47099826-47099848 CCCAGATGGAATGGGAGGCAGGG - Intronic
1096413068 12:51391210-51391232 CACAGAAGGAATGCAGGGCATGG + Intronic
1096793134 12:54057571-54057593 CTAAGATGGAAAGCAGGGAAGGG + Intergenic
1097036635 12:56128747-56128769 CCCAGATGGAAGGGGTGGAAGGG - Intronic
1097054582 12:56242023-56242045 CAAAGATGGTAGGAGGGGCAGGG - Exonic
1100113123 12:91269760-91269782 CTCTGGTGGAAGGGGAGGCAGGG + Intergenic
1100360044 12:93869013-93869035 ATCAGCTGGAAGGCTGAGCAGGG + Intronic
1102138054 12:110591748-110591770 CTCAGCAGGCAGGCGGGACAGGG + Intergenic
1102281226 12:111620521-111620543 CTCAATGGGAAGGCTGGGCATGG - Intergenic
1102468614 12:113145762-113145784 CTCAAAAGGAAGGAGGGGGAGGG - Intergenic
1102695336 12:114794626-114794648 CTCAGAAGTGAGGCCGGGCATGG + Intergenic
1103283332 12:119778928-119778950 CTCACAGGGCAGGCCGGGCATGG + Intronic
1103664632 12:122553212-122553234 ATCAAATGGAAGGAAGGGCAGGG + Intronic
1103844409 12:123891560-123891582 CTGAGAGGGCAGGCGGAGCACGG + Intronic
1104034307 12:125087785-125087807 CTCAAGGGGGAGGCGGGGCAGGG - Intronic
1104208081 12:126659988-126660010 CTCACATGGAAGGAAGAGCAAGG + Intergenic
1105009661 12:132747109-132747131 GTCAGGTGGAGGGTGGGGCATGG + Intronic
1106181092 13:27369904-27369926 CTCACATGGAGGGCGAGGCGGGG + Intergenic
1107372603 13:39768846-39768868 CTCTGATGGTAGGCGGGGGGTGG - Intronic
1110536598 13:76658038-76658060 CTCAGGTTGGAGGCGGGGCCTGG + Intergenic
1111381167 13:87454703-87454725 CTCATATGGAAGAAGGGACAAGG - Intergenic
1112919779 13:104597874-104597896 CTCAGAAAGAAGGAGGGCCAGGG - Intergenic
1113868396 13:113543491-113543513 CACAGATGGAGGGCGGGGGGAGG - Intronic
1114190688 14:20437576-20437598 CTCATGTGGAGGGCGGGGTAGGG + Intergenic
1114499787 14:23160155-23160177 CACAGATGGAAGCCTGGGAAAGG + Intronic
1114513423 14:23281057-23281079 CACAGATAGAAGGCTGGGCCCGG - Intronic
1115058241 14:29157074-29157096 GGCAGATGGAAAGAGGGGCAAGG + Intergenic
1116849674 14:49894799-49894821 CTCATAAGGAAGGGGGGGGAAGG - Exonic
1117287814 14:54304263-54304285 CTCATATGGCAGAAGGGGCAAGG - Intergenic
1117803963 14:59470856-59470878 CACAGAGGGAAGGAGGGACAGGG + Intronic
1118019290 14:61695142-61695164 CTCCGAAGGAAGGCGGTGCCCGG - Intergenic
1118885949 14:69865984-69866006 CTAAGGTGGAAGGCAGGGCCTGG + Intronic
1118987799 14:70771685-70771707 CTCAGATGGATGGTGGGGCTTGG - Intronic
1121997221 14:98612602-98612624 CTAGGCTGGAAGGTGGGGCATGG + Intergenic
1122028513 14:98895309-98895331 CTCAGAGGGGAGGCCAGGCATGG + Intergenic
1122277783 14:100604031-100604053 GCCAGATGGAAGGACGGGCAAGG - Intergenic
1122525938 14:102384386-102384408 ATCACATGGTAGGCCGGGCATGG + Intronic
1122533427 14:102445217-102445239 CCCATATGGAAGGAGGGGGAGGG + Intronic
1122717370 14:103703634-103703656 CACAGGGGGAAGGAGGGGCAGGG - Intronic
1123119816 14:105911399-105911421 AGCAGATGGGAGGAGGGGCAGGG + Intergenic
1123479504 15:20617932-20617954 CCCAGATGGATGGCAGAGCAGGG - Intergenic
1123638503 15:22382432-22382454 CCCAGATGGATGGCAGAGCAGGG + Intergenic
1124038710 15:26080647-26080669 CTCAAGTGGAAGGCTGGGAATGG - Intergenic
1125797037 15:42410670-42410692 CTGAGAAGGAAGGGGTGGCAGGG + Intronic
1126251148 15:46569693-46569715 TTGAGATGGAAGACGGGGCATGG - Intergenic
1126395318 15:48209355-48209377 CTAAGATTGGAGGCCGGGCATGG - Intronic
1126688015 15:51265249-51265271 CTCAGAGGGAAGGGAGGACATGG - Intronic
1128079172 15:64845984-64846006 ATCAGGTGGAAGGCCTGGCAGGG + Intronic
1128156150 15:65393256-65393278 CTCTGATGGAGGGCGGGGCCAGG + Intronic
1128647811 15:69389798-69389820 CTCAGATGGGAGGGGAGGGAGGG + Intronic
1128983018 15:72199938-72199960 CTCAGATGGCAGGGTTGGCAGGG + Intronic
1129161856 15:73752068-73752090 TTCTGAGGGAAGGCGGGGCTGGG - Intronic
1130031483 15:80318252-80318274 CTCAGGTGGTAGAAGGGGCATGG + Intergenic
1130442596 15:83970212-83970234 GTGAGATGGAAGGAGGGGGAGGG + Intronic
1131067745 15:89444716-89444738 TTCAGATGGAGTGGGGGGCAGGG - Intergenic
1131113254 15:89778212-89778234 CTGAGCTGGAAGGCGGCGCCCGG - Exonic
1132143386 15:99412692-99412714 CACAGAGGCACGGCGGGGCATGG + Intergenic
1132300590 15:100773210-100773232 CTGAGAGGGAAGCCGGGGGATGG + Intergenic
1132459510 16:44017-44039 CTCAGAGGACAGGCCGGGCATGG + Intergenic
1132557041 16:577079-577101 CCCAGAAGGAAGGAGGGGCGGGG + Intronic
1132721212 16:1316832-1316854 CTGAGGTGCAAGGCTGGGCACGG + Intronic
1132882845 16:2170095-2170117 CTCAGAGGGAAGGCAGGGCCAGG - Intronic
1133191723 16:4138772-4138794 CTCGGATGGTGGGCGGGGCTTGG - Intergenic
1133347130 16:5078608-5078630 CTCAGATGGCAGGGGTGGCCTGG + Intronic
1134323590 16:13186585-13186607 TTAAGATGGATGGCTGGGCACGG - Intronic
1134617883 16:15665733-15665755 ATAAGATGGAAGGCCAGGCATGG - Intronic
1135084824 16:19466853-19466875 CACATATGAAAGGCTGGGCACGG + Intronic
1135095821 16:19563970-19563992 CTCAGCGGGAAAGCTGGGCAAGG + Intronic
1136417527 16:30112985-30113007 CTCACATGGCAGCCTGGGCAGGG + Intronic
1136559804 16:31032690-31032712 CTCAGATGCAAGGCAGGGGCTGG + Intergenic
1136673376 16:31877424-31877446 CTCAGAAGGTAGGAGGGGAAGGG + Intronic
1140231090 16:73117826-73117848 CTCATATGGTAGAAGGGGCAAGG - Intergenic
1141409941 16:83826250-83826272 CACAGATGGAAGTCTGGGCGCGG - Intergenic
1141563714 16:84887197-84887219 CTCAGCAGGAGGGCGGGGCTGGG - Intronic
1143339620 17:6200543-6200565 CTTACATGGTAGGAGGGGCAAGG + Intergenic
1143447303 17:7017064-7017086 CTCACCTGGATGGCAGGGCACGG + Intronic
1145102541 17:20088904-20088926 CTCACATGGCAGAAGGGGCAAGG - Intronic
1146842602 17:36166262-36166284 GTCCGTTGGGAGGCGGGGCATGG + Exonic
1146854914 17:36254221-36254243 GTCCGTTGGGAGGCGGGGCATGG + Exonic
1146865706 17:36334155-36334177 GTCCGTTGGGAGGCGGGGCATGG - Exonic
1146870814 17:36378113-36378135 GTCCGTTGGGAGGCGGGGCATGG + Exonic
1146878174 17:36429195-36429217 GTCGGTTGGGAGGCGGGGCATGG + Exonic
1146882123 17:36450341-36450363 GTCGGTTGGGAGGCGGGGCATGG + Intergenic
1146895612 17:36539481-36539503 AATAGATGGAAGGCTGGGCATGG + Intronic
1147068575 17:37934767-37934789 GTCCGTTGGGAGGCGGGGCATGG - Exonic
1147073698 17:37978737-37978759 GTCCGTTGGGAGGCGGGGCATGG + Intronic
1147080098 17:38014304-38014326 GTCCGTTGGGAGGCGGGGCATGG - Intronic
1147085219 17:38058275-38058297 GTCCGTTGGGAGGCGGGGCATGG + Exonic
1147096047 17:38138264-38138286 GTCCGTTGGGAGGCGGGGCATGG - Intergenic
1147101166 17:38182241-38182263 GTCCGTTGGGAGGCGGGGCATGG + Intergenic
1147832674 17:43307847-43307869 ATCAGCTGCAAGGCCGGGCACGG + Intergenic
1148145858 17:45364507-45364529 CTGGGATGGGAGGCTGGGCAAGG - Intergenic
1148934468 17:51153775-51153797 ATCGGATGGGAGGAGGGGCAGGG + Intronic
1148971933 17:51491254-51491276 CTCACATGGAAGAAGGGGCAAGG - Intergenic
1149778675 17:59378787-59378809 AACAGATGGAGGGAGGGGCAGGG - Intronic
1149845764 17:60008747-60008769 GTCCGTTGGGAGGCGGGGCATGG + Intergenic
1149986431 17:61350922-61350944 TTAAGATTGAAGGCTGGGCATGG - Intronic
1150084112 17:62265327-62265349 GTCCGTTGGGAGGCGGGGCATGG + Intergenic
1150343632 17:64387830-64387852 CTGAGATGGAAGGAAGGGAAAGG + Intronic
1150934669 17:69622746-69622768 CCCAGTTGGAAGGAGGGGCATGG - Intergenic
1151532793 17:74717860-74717882 CTCACATGGTAGAAGGGGCAAGG - Intronic
1151664132 17:75535754-75535776 TTGAGATGGAAGGCGGGCCAGGG + Intronic
1152941707 17:83176202-83176224 CTCAGAGAAAAGGCTGGGCAAGG + Intergenic
1153404133 18:4716988-4717010 CTCAGAGGAAAGGCCAGGCATGG + Intergenic
1158447334 18:57532778-57532800 CTCAGAGGGAAGACGGCTCACGG - Intergenic
1159276631 18:66230832-66230854 ATCAGAATGAAGGCTGGGCATGG - Intergenic
1159657439 18:71049262-71049284 CTCAGATGAGAAGTGGGGCAAGG - Intergenic
1160348483 18:78153886-78153908 CTCACATGGCAGGAGGGGCCCGG + Intergenic
1160535239 18:79588214-79588236 CTAAAATGGAAGGCGAGGGAGGG - Intergenic
1160672161 19:370783-370805 CTCAGATGCAGGGCGGGGGGCGG + Intronic
1161005155 19:1931959-1931981 CTCAGATGGGTGGAGGGTCAGGG + Intergenic
1161486243 19:4537356-4537378 CTCAGCTGGAAGGAAGGACAAGG + Exonic
1162238437 19:9326383-9326405 TTCAGGTGAATGGCGGGGCATGG - Intronic
1162427014 19:10602835-10602857 CTCGGATGGCGGGCGGGGGAGGG + Intronic
1162444574 19:10714446-10714468 CTCACATGGCGGGAGGGGCAAGG + Intergenic
1162819103 19:13212109-13212131 CTCTGCAGGGAGGCGGGGCATGG + Exonic
1163415756 19:17185650-17185672 CTCAGGTGGAAGGCTGGGGCTGG - Intronic
1163423485 19:17228025-17228047 CTCAGAAGGGCTGCGGGGCAGGG - Intronic
1163469081 19:17486504-17486526 CCCAGAGGCCAGGCGGGGCAGGG + Intronic
1165379663 19:35469370-35469392 CTCATACTGAAGGCCGGGCACGG - Intergenic
1167649679 19:50722495-50722517 CTCAGGAGGAAGGAGGGGGAGGG + Intergenic
1167781522 19:51601788-51601810 CTCACATGGAAGGCCAGGTAAGG - Intergenic
1168107484 19:54173514-54173536 CTCAGATGGAAGCCATGGGACGG + Exonic
926180062 2:10634546-10634568 CTCAGAGGGAAGGCTGGAGAGGG + Intronic
926218971 2:10922696-10922718 CCCAGGAGGAAGGCGGGACATGG - Intergenic
927579336 2:24227628-24227650 CAGAGATGGAAGGCTGGGCATGG + Intronic
928263286 2:29787083-29787105 CTCCCAGGGAAGGCCGGGCATGG - Intronic
928341616 2:30447582-30447604 CTCAGGTGGAAGGAGGCGCGGGG + Intronic
928692570 2:33815977-33815999 ATAATATGGAAGGCTGGGCACGG - Intergenic
929572200 2:43029712-43029734 CTCTGATGGCTGGCGGGGCATGG + Intergenic
930605945 2:53493172-53493194 CTCACATGGGAGAAGGGGCAAGG - Intergenic
931752175 2:65339272-65339294 CTGGAATGGAAGGGGGGGCAGGG + Intronic
932659341 2:73639083-73639105 ACCATATGGAAGGCTGGGCATGG - Intergenic
932665902 2:73698756-73698778 ACCATATGGAAGGCTGGGCATGG - Intergenic
932837675 2:75052250-75052272 CTCAGATGGTGGAAGGGGCAAGG - Intronic
933184781 2:79267044-79267066 CCCTGATGGAAAGCGGGGCAGGG + Intronic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
938554912 2:132416032-132416054 CTCCGTGGGAAGGCGAGGCAGGG + Intergenic
938560533 2:132468720-132468742 TACAGATGGAAGGTGGGGCAGGG + Intronic
939006301 2:136791543-136791565 CTCGGATGGGGGGCGGGGGAGGG - Intronic
940285560 2:152029780-152029802 CTCAAATGGTAGAAGGGGCAAGG - Intronic
940372781 2:152921408-152921430 CTCACATGGTAGAAGGGGCAAGG + Intergenic
941013989 2:160333583-160333605 CTCAGAAGGAAGGCAGGGAATGG + Intronic
941722926 2:168831234-168831256 CTCAGATGGCAGAAGGGGCTAGG + Intronic
942396537 2:175555773-175555795 ATCAGATGGAAGGCCAGGCGCGG - Intergenic
942443779 2:176064049-176064071 CTCAGATGGATGGCAAGGGACGG + Intergenic
944075956 2:195731022-195731044 CAGAGTTGGAAGGCAGGGCAAGG - Intronic
944577778 2:201106241-201106263 CTCATATGGTAGAAGGGGCAAGG - Intergenic
945105803 2:206312702-206312724 CTGATATGGTAGGCTGGGCATGG - Exonic
946354442 2:219176395-219176417 CTGGGCTGGAAGGCGGGGCAGGG + Intronic
946491621 2:220154201-220154223 CTGAGAGGGAAGGCGGCCCAGGG + Intergenic
946764132 2:223024264-223024286 GTAAGATGGAAGGTGGTGCAGGG - Intergenic
946946136 2:224824722-224824744 ATCAGAAGTAAGGCTGGGCACGG - Intronic
947845136 2:233237708-233237730 CTCACATGGTAGGAGGAGCAAGG + Intronic
948037830 2:234873532-234873554 CTAAGAAGGAAGGGTGGGCAAGG + Intergenic
948698177 2:239744269-239744291 CACAGATGGAAGGAGGCCCAGGG + Intergenic
948888740 2:240896770-240896792 CTCAGGTTGGAGGCTGGGCAGGG - Intronic
1168875190 20:1166555-1166577 CTCAGATGGAAGCTGGGCCTGGG + Exonic
1169489971 20:6063110-6063132 GACAGAAGGAAGGCCGGGCATGG + Intergenic
1171377293 20:24702393-24702415 CAGAGGTGGAGGGCGGGGCAAGG + Intergenic
1172592402 20:36127121-36127143 CTCAGATGGGAGGCGGGGTATGG - Intronic
1172759745 20:37313772-37313794 CCCAGCTGGAAGGAGGAGCAGGG + Intronic
1172856650 20:38009464-38009486 CCCAGAAGGAAGAAGGGGCATGG - Intronic
1173589325 20:44211686-44211708 CTCAGATGGTAGGCGGGAAAAGG + Intergenic
1174007155 20:47419826-47419848 CTCAAAAGGAAGGCGGTGCTGGG + Intergenic
1174484538 20:50852883-50852905 CTCAAATGCCAGGCTGGGCAGGG - Intronic
1175085540 20:56455637-56455659 CTCACATGGCTGGCCGGGCATGG + Intronic
1176054260 20:63135509-63135531 CCCAGAGGGGAGGCGGGGCCCGG + Intergenic
1177190412 21:17845227-17845249 CTCAGAGGGAGGGCCAGGCATGG + Intergenic
1178542227 21:33462999-33463021 ATCAGGTAGAAGGCTGGGCATGG + Intronic
1178672594 21:34604940-34604962 CTCAGGTGGAAGGCAGTGCCTGG - Intronic
1179587895 21:42385280-42385302 CTCAGATGGAAGGTGGGAGTTGG - Intronic
1180747663 22:18102178-18102200 CTCAGGTGGAATGCTGGGCATGG + Exonic
1180821240 22:18829309-18829331 CTAAGATGGAAGGCAGGGATAGG - Intergenic
1181191738 22:21146736-21146758 CTAAGATGGAAGGCAGGGATAGG + Intergenic
1181207459 22:21263774-21263796 CTAAGATGGAAGGCAGGGATAGG - Intergenic
1182011305 22:27002946-27002968 CTGAAATGGAAGTAGGGGCAAGG - Intergenic
1182461867 22:30489144-30489166 CTCAACTGGAAGGCTGAGCATGG + Exonic
1182558473 22:31141531-31141553 CTCAGATGGAGCCTGGGGCAGGG - Intergenic
1183741551 22:39671162-39671184 GTCAGAGGGAAGGTGGGTCAGGG + Intronic
1184232489 22:43166197-43166219 CTCAGAAGGCAGGCCAGGCATGG - Intergenic
1184286323 22:43473695-43473717 CTCAGATGGAGTAGGGGGCAGGG + Intronic
1185385116 22:50528293-50528315 CACAGATGGCTGGCGGGGCACGG - Intronic
1203219460 22_KI270731v1_random:31642-31664 CTAAGATGGAAGGCAGGGATAGG + Intergenic
1203271365 22_KI270734v1_random:55185-55207 CTAAGATGGAAGGCAGGGATAGG - Intergenic
949540210 3:5026682-5026704 CTCACAGGGAAGGCCGGGCGGGG - Intergenic
949936942 3:9123168-9123190 GGCAGCTGGAAGGCGTGGCAGGG + Intronic
949986162 3:9542914-9542936 CTGAGAAGGAAGGAGGGTCAGGG + Intronic
950152210 3:10696596-10696618 AGCAGAGGGAAGGCAGGGCAGGG - Intronic
952136373 3:30426569-30426591 CTCAGCTGGAGAGCGGGGGAAGG + Intergenic
954277756 3:49553864-49553886 CACAGATGGAAGGTGTGACAGGG - Intergenic
954812642 3:53257456-53257478 CTCAAACGGATGGCTGGGCAGGG + Intergenic
956038181 3:65118164-65118186 GTTAGTTGGAAGTCGGGGCAAGG - Intergenic
956191447 3:66612045-66612067 CTCAGGTGGAAGAGGGGGCAGGG + Intergenic
956957343 3:74356124-74356146 CTCACATGGTAGAAGGGGCAAGG - Intronic
960217866 3:115064741-115064763 TTCAGAGAGAAGGCCGGGCACGG - Intronic
960636484 3:119789729-119789751 CTCAGAGAGAAGGCAGGACAGGG - Intronic
961009098 3:123424190-123424212 CTGAGATGGAATGGTGGGCAGGG + Intronic
961609607 3:128126170-128126192 CTCTGGTGGAAGTGGGGGCATGG - Intronic
962523151 3:136215313-136215335 ATCAAATTGAAGGCTGGGCATGG - Intergenic
966524733 3:180908343-180908365 CTCACAAAGAAGGCAGGGCATGG + Intronic
967204059 3:187103437-187103459 CTCAGGTGGCGGGTGGGGCACGG - Intergenic
968169049 3:196493810-196493832 AGCAAATGGAAGGCTGGGCACGG - Intronic
968423189 4:502424-502446 CTCAGACTGGAGGCAGGGCAGGG - Intronic
969081370 4:4621180-4621202 CTCACATGGCAGAAGGGGCAAGG + Intergenic
969342140 4:6548934-6548956 CTAAGAGGGAAGGCGGGGAGAGG - Intronic
969355867 4:6625265-6625287 CTCACATGGCAGAAGGGGCAAGG + Intergenic
969728331 4:8938978-8939000 CACAGATGGAAGGCAGGGCCCGG + Intergenic
969965234 4:10987180-10987202 CTCATATGGTAGAAGGGGCAAGG - Intergenic
970162723 4:13205365-13205387 CTCACATGGCAGAAGGGGCAGGG + Intergenic
970550677 4:17177967-17177989 CTCACATGGAGGAAGGGGCAAGG + Intergenic
971412696 4:26391989-26392011 CTCACATGGCAGGAGGGACAAGG + Intronic
972142310 4:35976096-35976118 CTCACATGGCAGAAGGGGCAAGG + Intronic
972284105 4:37631697-37631719 ATCAGCTGGAAGGTTGGGCAGGG - Intronic
972803755 4:42506303-42506325 CTCACATGGTAGAAGGGGCAAGG - Intronic
972895913 4:43619955-43619977 CTCAGATGGGACTTGGGGCATGG - Intergenic
973040292 4:45461354-45461376 ATCACATTGAAGGCCGGGCATGG + Intergenic
976334697 4:83871822-83871844 CTCACATGGTAGAAGGGGCAAGG + Intergenic
977530261 4:98192753-98192775 CTCAGCTGTTAGGCTGGGCATGG - Intergenic
977748463 4:100579857-100579879 CTCACATGGCAGAAGGGGCAAGG - Intronic
979174392 4:117644497-117644519 CTCACATGGCAGAAGGGGCAAGG + Intergenic
979498668 4:121413430-121413452 CTCAGAAGGAAAGCGTGGGAAGG - Intergenic
980152724 4:129067988-129068010 CTCAGGTGGAAAGGGTGGCAAGG - Intronic
980614584 4:135202325-135202347 CTCACATGGAGGAAGGGGCAAGG - Intergenic
980914765 4:139023779-139023801 TTCAGAGGCAAGGCCGGGCATGG - Intronic
981157141 4:141451807-141451829 CTTACATGGAAGAAGGGGCAGGG + Intergenic
981244010 4:142513370-142513392 CTCACATGGTAGGAGGGGCAAGG + Intronic
981274988 4:142888736-142888758 CTCACATGGCAGAAGGGGCAAGG - Intergenic
982237234 4:153263038-153263060 ATCACATGGGAGGCTGGGCATGG + Intronic
982697296 4:158616706-158616728 ATTAGAGGGAAGGCTGGGCATGG + Intronic
983849687 4:172565084-172565106 CTCACATGGAAGAAGGGGCAAGG + Intronic
984018948 4:174461137-174461159 CTGAGACTGAAGGCAGGGCATGG + Intergenic
984435962 4:179710427-179710449 CTCACATGGCAGAAGGGGCAAGG + Intergenic
984863383 4:184259180-184259202 CTCACATGGCAGAAGGGGCAAGG - Intergenic
985574191 5:665937-665959 CGGGGATGGAAGGCGGGGCCTGG - Intronic
985778540 5:1857751-1857773 CTACGAGGGGAGGCGGGGCAGGG + Intergenic
987292762 5:16524027-16524049 CTCAGATGGAAGGCGGGGCAGGG - Intronic
987416866 5:17671091-17671113 CTGAGGTGGGAGGCAGGGCAAGG + Intergenic
987700352 5:21390173-21390195 CTCACATGGCAGAAGGGGCAAGG - Intergenic
990806224 5:59665804-59665826 CTCACTTGGAAGAAGGGGCAAGG - Intronic
991402801 5:66272115-66272137 CTCACATGGTGGGTGGGGCAAGG + Intergenic
991739821 5:69658708-69658730 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991757678 5:69894469-69894491 CTCACATGGCAGAAGGGGCAAGG - Intergenic
991791396 5:70238449-70238471 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991819284 5:70534833-70534855 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991837081 5:70770351-70770373 CTCACATGGCAGAAGGGGCAAGG - Intergenic
991883845 5:71238791-71238813 CTCACATGGCAGAAGGGGCAAGG + Intergenic
992157934 5:73973074-73973096 CTCACATGGCAGAAGGGGCAAGG + Intergenic
994710724 5:103259983-103260005 CTGAGGTGGAAGGAGAGGCAGGG - Intronic
994932589 5:106207919-106207941 CTCAGATGCAATGAGGGCCATGG - Intergenic
996068677 5:119109089-119109111 TTCAGATGGTAGGCCAGGCACGG - Intronic
997251596 5:132392863-132392885 CTCTGATGGAAGGCCTGGGATGG - Intronic
997559956 5:134837636-134837658 CTCACATGGCAGAAGGGGCAAGG - Intronic
997909389 5:137854963-137854985 CTCACATGGTAGAAGGGGCAAGG - Intergenic
999657937 5:153828861-153828883 CTCAGAGGGTAGGCAGGGCCAGG - Intergenic
1000825284 5:166037259-166037281 GTCAGAGGGAGGGAGGGGCAGGG - Intergenic
1001586159 5:172834813-172834835 CTCAGCTGACAGGTGGGGCAGGG + Intronic
1001750888 5:174130501-174130523 ATGAGATGAAAGGTGGGGCAGGG + Intronic
1001764446 5:174234431-174234453 CTCTGATACAACGCGGGGCAGGG - Intronic
1002058587 5:176612733-176612755 CTCAGGTGGAAGGTGGGGATGGG + Intergenic
1003113001 6:3264546-3264568 CCCAGGGGGAAGGCAGGGCAGGG + Intronic
1003315545 6:5008340-5008362 CTCATATAGAAGGAGGGGAAAGG - Intergenic
1003514962 6:6810241-6810263 CTCATAGGGAAGGAAGGGCAGGG + Intergenic
1003692056 6:8364724-8364746 CTCATATGGAAGAAGGGGCAAGG - Intergenic
1003692064 6:8364772-8364794 CTCATATGGAAGAAGGGGCAAGG - Intergenic
1003692070 6:8364807-8364829 CTCATACGGAAGAAGGGGCAAGG - Intergenic
1005550217 6:26904606-26904628 CTCACATGGCAGAAGGGGCAAGG + Intergenic
1006147045 6:31965904-31965926 TGCAGATGGCAGGCCGGGCAGGG + Exonic
1006175912 6:32121410-32121432 TTAAGATGGGAGGCTGGGCATGG + Intronic
1006212968 6:32412999-32413021 CTGAGGTGGGAGGCGGAGCAGGG - Intergenic
1006376364 6:33673727-33673749 CTCAGCCTGAAGGCAGGGCAGGG - Intronic
1006795835 6:36731862-36731884 CTCATGTGGAATGCAGGGCAGGG + Intronic
1007166875 6:39834795-39834817 CTGAGATGGAGGGCAGGGCAGGG + Intronic
1007295913 6:40820388-40820410 CTCACATGGCAGAAGGGGCAAGG - Intergenic
1008614808 6:53216465-53216487 CTCACATGGCAGAAGGGGCAGGG - Intergenic
1011507402 6:88061463-88061485 CACAGATGGAAAGTGGGGCGCGG + Intronic
1013600748 6:111702561-111702583 CTCACATGCAACGCGGGGAATGG + Intronic
1013786712 6:113789448-113789470 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1014245796 6:119067243-119067265 CTCAGATGAAAGGGGTGGAAAGG - Intronic
1015119314 6:129684125-129684147 CTCAGATGTCAGGAGTGGCAAGG + Intronic
1015771634 6:136773948-136773970 TAAAGATGGACGGCGGGGCATGG - Intronic
1016753454 6:147657732-147657754 CTCACATGGTAGAAGGGGCATGG + Intronic
1018001604 6:159583542-159583564 CACAGATGGAAGGTGGAGCCAGG + Intergenic
1018031485 6:159845222-159845244 CTCAAGGGGAAGGCGGGGTAGGG - Intergenic
1018975682 6:168563660-168563682 CTCATGTGGCAGGAGGGGCAAGG - Intronic
1019221406 6:170476071-170476093 ATCACATGGTAGGCCGGGCACGG + Intergenic
1019284901 7:218528-218550 GTCAGAGGGAGGGCGGGGCAGGG + Intronic
1019524174 7:1473306-1473328 CTCAGAGGGAGGGCCGGGCGGGG + Intronic
1020242769 7:6408699-6408721 CTGAGGTGGAAGGTGGGGCCTGG - Intergenic
1021311878 7:19106847-19106869 CTGAGCTGGAAGGCGGGGAAAGG + Intronic
1021367734 7:19801660-19801682 CTCACATGGCAGAAGGGGCAAGG - Intergenic
1022425323 7:30263335-30263357 CACAGATGGGAGGTGGGGCATGG - Intergenic
1027177894 7:75916014-75916036 CTCAGAGGCAAGGCAAGGCAAGG - Intronic
1029472640 7:100764212-100764234 CTCAGAGGAGAGGCCGGGCACGG + Intronic
1030353177 7:108512975-108512997 CTTAGATGGCAGAAGGGGCAAGG - Intronic
1032240827 7:130157513-130157535 TTCAGAATGAAGGCTGGGCACGG - Intergenic
1032932082 7:136684499-136684521 CTTACATGGAAGAAGGGGCAAGG + Intergenic
1033415811 7:141160451-141160473 GGCAGAGGGAAGGAGGGGCAAGG - Intronic
1033651555 7:143347328-143347350 CTAAAATGGGAGGCCGGGCATGG + Intronic
1034091744 7:148370403-148370425 CTCTGCTAGAAGGTGGGGCAGGG - Intronic
1034480184 7:151313971-151313993 GTGAGATGGAAAGGGGGGCAGGG + Intergenic
1034521385 7:151623074-151623096 CTCATAAGGAAGGCTGGGCACGG + Intronic
1034827298 7:154277471-154277493 AAAAGATGGAAGGCTGGGCATGG + Intronic
1034893483 7:154860187-154860209 CTCAGGGAGAAGGTGGGGCAGGG - Intronic
1035182103 7:157097051-157097073 CTCAGGTGGAAGCAGGGGCAGGG + Intergenic
1035240575 7:157526689-157526711 CTCTGAAGGAAGGCTGGGAATGG - Intergenic
1035351276 7:158247904-158247926 CACAGATGGTAGGCTGGGCGCGG - Intronic
1035360428 7:158309959-158309981 CTCATGTGGCAGACGGGGCAAGG - Intronic
1036436067 8:8734604-8734626 CTCACATGGTGGGAGGGGCAGGG - Intergenic
1038484820 8:27927142-27927164 CACAGAGGGAAGGAGGGGCTAGG - Intronic
1039079824 8:33723092-33723114 GCCAGAGGGAAGGCCGGGCAGGG + Intergenic
1040655512 8:49502981-49503003 CTCACATGGTAGGAAGGGCAAGG - Intergenic
1040673242 8:49717616-49717638 CTCACATGGCAGATGGGGCAAGG - Intergenic
1041036790 8:53799800-53799822 CTCAGATGGCAGAGGGGACAGGG - Intronic
1041716935 8:60941022-60941044 CTCACATGGAAGAAGGGCCATGG + Intergenic
1043988736 8:86725726-86725748 CTGAGAGAGAAGGCGGGGTAGGG + Intronic
1044348161 8:91130886-91130908 CTCACATGGTAGAAGGGGCAAGG + Intronic
1044510635 8:93074344-93074366 CTCACATGGTAGAGGGGGCAAGG - Intergenic
1044604051 8:94033644-94033666 ATCAGAAGGTTGGCGGGGCATGG + Intergenic
1044812686 8:96080237-96080259 ATCAGATGGAGAGGGGGGCAGGG - Intergenic
1045111152 8:98940444-98940466 CTCAGTGGGAAGGCCGAGCACGG - Intronic
1045859772 8:106803102-106803124 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1046953378 8:120039185-120039207 CTCACATGGTAGAAGGGGCAAGG - Intronic
1048444781 8:134485229-134485251 CTCAGAGGCCAGGCGGAGCAGGG - Intronic
1048747047 8:137625843-137625865 ATCACAGGGAAGGCAGGGCAAGG + Intergenic
1048870015 8:138789650-138789672 ATCACATTGAAGGAGGGGCAGGG + Intronic
1049111095 8:140643982-140644004 CTCATATGGTAGAAGGGGCAAGG - Intergenic
1049328829 8:142038942-142038964 CTCATGGGGAAGGTGGGGCATGG + Intergenic
1049398529 8:142413056-142413078 CTCAGGGGGAGGGCGGGGCTGGG + Intergenic
1049709576 8:144057524-144057546 CTCAGCGGGGAGGCCGGGCAGGG + Exonic
1049831933 8:144706167-144706189 CTCAGAGGGAAGGTGGGGCCAGG - Intergenic
1051266735 9:15316511-15316533 CTCAAATGGTAGAAGGGGCAAGG - Intergenic
1054154632 9:61631577-61631599 CTCAGAAGCAAGGCAAGGCAAGG + Intergenic
1055815127 9:80195866-80195888 CTCAGTTGGAAGGCAGAACAAGG - Intergenic
1056423476 9:86453174-86453196 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1056591258 9:87967606-87967628 CTCAGATGGATGGGCAGGCAGGG + Exonic
1057951207 9:99370272-99370294 CTCTGTTGGAAGGCAGGGGAGGG - Intergenic
1058188424 9:101883896-101883918 CTCAAATGGTAGAAGGGGCAAGG - Intergenic
1059153144 9:111967053-111967075 CTCAGAAGGAAGGGGAGGTAGGG + Intergenic
1059817533 9:117934369-117934391 CTCAGAAGGAAGGTGGGAAAAGG + Intergenic
1060759479 9:126235446-126235468 CTTTGGGGGAAGGCGGGGCACGG - Intergenic
1060973760 9:127753484-127753506 CTCAGGAGAAAGGCGGGGCCTGG + Intronic
1062189883 9:135242538-135242560 CACAGATGGCATGTGGGGCAAGG - Intergenic
1062732698 9:138118740-138118762 CTCGGCCGCAAGGCGGGGCATGG - Exonic
1185828584 X:3276623-3276645 CTCACATGGTAGAAGGGGCAAGG - Intronic
1185938509 X:4286001-4286023 CTCACATGGAGGAAGGGGCAAGG - Intergenic
1186980241 X:14950764-14950786 CACAGATGCAAAGCGGGACAGGG - Intergenic
1187974577 X:24692430-24692452 CTCACATGGAAGAAGGGGCAAGG + Intergenic
1189907946 X:45781237-45781259 CACATAAGGCAGGCGGGGCAGGG - Intergenic
1192152874 X:68722930-68722952 TTCAGCTGGACTGCGGGGCAGGG - Intronic
1192461912 X:71324225-71324247 TCCAGCTGGAAGGCCGGGCACGG - Intergenic
1195430320 X:104781978-104782000 CTCACATGGCAGAAGGGGCAAGG - Intronic
1197756962 X:130002378-130002400 CTGAGAGAGAAGGTGGGGCAGGG + Intronic
1197946140 X:131841332-131841354 CACAGCTGGAAGGTGGGGAAAGG - Intergenic
1199049499 X:143220507-143220529 CTCACATGGTAAGTGGGGCAAGG - Intergenic
1199613656 X:149638382-149638404 CTCAGGGGGAAGGGTGGGCAGGG - Intergenic
1199944621 X:152655317-152655339 CACAGATGGATGGAGGGACAGGG - Exonic
1199949423 X:152695640-152695662 CTCACATGGAAGAAGGGGCAAGG - Intergenic
1199960253 X:152772809-152772831 CTCACATGGAAGAAGGGGCAAGG + Intergenic
1200017055 X:153173920-153173942 CTCACATGGAAGACGGGGCAAGG - Intergenic
1200071614 X:153532042-153532064 GTCACATGGAAGGCAGGGCTGGG + Intronic
1200119394 X:153783275-153783297 CTCAGATGGGAGAGGAGGCATGG - Intronic
1200165150 X:154030652-154030674 CTCAGGTGGAGGTGGGGGCAGGG + Exonic
1201746884 Y:17385945-17385967 CTCAAATGGTAGAAGGGGCAGGG - Intergenic