ID: 987292865

View in Genome Browser
Species Human (GRCh38)
Location 5:16524845-16524867
Sequence CCTGCAGGTGGATGTGCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 3, 1: 2, 2: 3, 3: 19, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987292857_987292865 4 Left 987292857 5:16524818-16524840 CCAGGAAACAACATGTGCTTGCA 0: 1
1: 0
2: 2
3: 12
4: 298
Right 987292865 5:16524845-16524867 CCTGCAGGTGGATGTGCGCGGGG 0: 3
1: 2
2: 3
3: 19
4: 155
987292856_987292865 16 Left 987292856 5:16524806-16524828 CCGTATGAGAGGCCAGGAAACAA 0: 1
1: 0
2: 20
3: 448
4: 998
Right 987292865 5:16524845-16524867 CCTGCAGGTGGATGTGCGCGGGG 0: 3
1: 2
2: 3
3: 19
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987292865 Original CRISPR CCTGCAGGTGGATGTGCGCG GGG Intronic