ID: 987292877

View in Genome Browser
Species Human (GRCh38)
Location 5:16524897-16524919
Sequence CCTGCAGGTGGATGTGCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 3, 1: 2, 2: 3, 3: 19, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987292862_987292877 30 Left 987292862 5:16524844-16524866 CCCTGCAGGTGGATGTGCGCGGG 0: 1
1: 1
2: 4
3: 8
4: 90
Right 987292877 5:16524897-16524919 CCTGCAGGTGGATGTGCGCGGGG 0: 3
1: 2
2: 3
3: 19
4: 155
987292864_987292877 29 Left 987292864 5:16524845-16524867 CCTGCAGGTGGATGTGCGCGGGG 0: 3
1: 3
2: 3
3: 17
4: 160
Right 987292877 5:16524897-16524919 CCTGCAGGTGGATGTGCGCGGGG 0: 3
1: 2
2: 3
3: 19
4: 155
987292867_987292877 2 Left 987292867 5:16524872-16524894 CCGTGCTGACCTGCGTCCTCCGG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 987292877 5:16524897-16524919 CCTGCAGGTGGATGTGCGCGGGG 0: 3
1: 2
2: 3
3: 19
4: 155
987292869_987292877 -7 Left 987292869 5:16524881-16524903 CCTGCGTCCTCCGGCTCCTGCAG 0: 1
1: 3
2: 2
3: 29
4: 345
Right 987292877 5:16524897-16524919 CCTGCAGGTGGATGTGCGCGGGG 0: 3
1: 2
2: 3
3: 19
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987292877 Original CRISPR CCTGCAGGTGGATGTGCGCG GGG Intronic