ID: 987292877

View in Genome Browser
Species Human (GRCh38)
Location 5:16524897-16524919
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 3, 1: 2, 2: 3, 3: 19, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987292862_987292877 30 Left 987292862 5:16524844-16524866 CCCTGCAGGTGGATGTGCGCGGG 0: 1
1: 1
2: 4
3: 8
4: 90
Right 987292877 5:16524897-16524919 CCTGCAGGTGGATGTGCGCGGGG 0: 3
1: 2
2: 3
3: 19
4: 155
987292867_987292877 2 Left 987292867 5:16524872-16524894 CCGTGCTGACCTGCGTCCTCCGG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 987292877 5:16524897-16524919 CCTGCAGGTGGATGTGCGCGGGG 0: 3
1: 2
2: 3
3: 19
4: 155
987292869_987292877 -7 Left 987292869 5:16524881-16524903 CCTGCGTCCTCCGGCTCCTGCAG 0: 1
1: 3
2: 2
3: 29
4: 345
Right 987292877 5:16524897-16524919 CCTGCAGGTGGATGTGCGCGGGG 0: 3
1: 2
2: 3
3: 19
4: 155
987292864_987292877 29 Left 987292864 5:16524845-16524867 CCTGCAGGTGGATGTGCGCGGGG 0: 3
1: 3
2: 3
3: 17
4: 160
Right 987292877 5:16524897-16524919 CCTGCAGGTGGATGTGCGCGGGG 0: 3
1: 2
2: 3
3: 19
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900159787 1:1218107-1218129 CCAGCAGGTGCAGGTGGGCGGGG - Intronic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
904260428 1:29284650-29284672 CCTGTAGGTGGCTGTGCCCAAGG - Intronic
904333602 1:29783446-29783468 CATGCAGGAGGATGAGCGCTGGG - Intergenic
905692923 1:39955877-39955899 TCTGAATGTGGATGTTCGCGCGG + Intronic
907489773 1:54801315-54801337 CCCGCAGGTGGGTGGGCCCGAGG + Intergenic
909288696 1:73854681-73854703 TCTGCAGGTGGTGGTGGGCGGGG - Intergenic
910757224 1:90706590-90706612 CCTGAAGGTGGAGGAGCGCGGGG + Intergenic
912457567 1:109807988-109808010 CCTGCAGGTGCATGTGGCTGTGG - Intergenic
915621301 1:157086565-157086587 CTTGCAGGTGGATGGGGGTGGGG - Intergenic
916739753 1:167637777-167637799 GCTGCAGGTGGAAGTGTGAGTGG - Intronic
917598258 1:176551549-176551571 ACTGCAGGTGGATGCCAGCGTGG + Intronic
919781770 1:201225837-201225859 CCTGCAGGTGGATGGGCCCAGGG - Exonic
920655781 1:207873616-207873638 CTAGCAGGTGGATATGCCCGGGG + Intergenic
920850318 1:209623963-209623985 CCTGCAGCTGGATCTGCCCCTGG - Exonic
922901049 1:229136953-229136975 CCTGCTGGTGGCTGTGTGTGGGG + Intergenic
1062764218 10:48840-48862 GCTGCAGGTGGCTGTCCCCGTGG + Exonic
1069967870 10:72136566-72136588 TCAGCAGGGGGATGTGGGCGGGG + Intronic
1071268661 10:83986744-83986766 CGTGGAGGTGGATGTGCTCCTGG - Intergenic
1074066595 10:110020464-110020486 CATGCATGTGGATGTCTGCGGGG + Intronic
1074096345 10:110316660-110316682 CCTGAAGGTGTATGTGCTGGGGG - Intergenic
1075630184 10:123995862-123995884 CCTGCAGGGGGATGTGGGACAGG + Intergenic
1077015430 11:397112-397134 CCTGTAGGTGGAGGTGGCCGCGG - Exonic
1080898070 11:36462514-36462536 CCAGCAGCTGGATGTCCGAGTGG - Exonic
1084273973 11:68042647-68042669 CCTGCAGGAGGAGGTGCGGCGGG + Exonic
1084970923 11:72771693-72771715 CCTGGAGGTGGAGGTGGGGGTGG - Intronic
1088648417 11:111936894-111936916 CTTGCAGGCGGGTGTGCCCGTGG - Intronic
1089557215 11:119321105-119321127 GCTGCGGGTGGATGGGCGCGCGG + Intronic
1090808446 11:130217411-130217433 GCTGCAGGAGGCTGTGCGGGTGG - Intergenic
1092425957 12:8375700-8375722 CCTGCAGGTGGGTGGGCAAGGGG + Intergenic
1092887153 12:12934847-12934869 CCAGCAGGTGCTTGTGCCCGCGG + Intergenic
1094298431 12:28934204-28934226 TCTGCAGGTGCAGGTGTGCGCGG - Intergenic
1101598936 12:106191584-106191606 CCTGCAGGTGGATGATGGAGAGG + Intergenic
1104159889 12:126168188-126168210 CCTGCAGGAGGGTGTGGGTGGGG - Intergenic
1113093514 13:106639093-106639115 CCTGGAGGTGGATGTGCTCAGGG + Intergenic
1113546353 13:111153979-111154001 CCTGCGGCTGGAGGTGAGCGCGG + Exonic
1113802107 13:113092026-113092048 CCTGCAAGTGGGTGGGCGCCCGG + Intronic
1113868498 13:113544170-113544192 CCTGCAGGTGGCTGTGGCTGTGG - Intronic
1118079428 14:62341226-62341248 CCTACAGGTGGATGTGTGGAAGG + Intergenic
1118616371 14:67577030-67577052 AGTGCAGGTGGATGTGTGCAGGG - Intronic
1119498681 14:75103982-75104004 CTTGCAGGTGGATGTTCCCAAGG - Exonic
1119769813 14:77213522-77213544 CCTGCAGGTGGAGAGGCCCGGGG - Intronic
1119843119 14:77808132-77808154 CCAGCAGGTGGGTGGGAGCGAGG + Intronic
1123195426 14:106611247-106611269 CCTGCAGGTGCAGGTGCATGTGG + Intergenic
1202922117 14_KI270723v1_random:35774-35796 CCTGCAGCTGGATGAGCTCCTGG + Intergenic
1202922812 14_KI270724v1_random:1839-1861 CCTGCAGCTGGATGAGCTCCTGG - Intergenic
1132380450 15:101362497-101362519 CGTGCAGGGGTATGTGCGAGAGG + Intronic
1132519829 16:381968-381990 CCTGCGGGCGGAAGTGCCCGGGG - Exonic
1133372388 16:5255200-5255222 CCTGCAGGTGGGTGGGCAAGGGG - Intergenic
1134513343 16:14866595-14866617 CCTGGAGGTGGAAGTGCTGGAGG + Exonic
1134700980 16:16265083-16265105 CCTGGAGGTGGAAGTGCTGGAGG + Exonic
1134970845 16:18529575-18529597 CCTGGAGGTGGAAGTGCTGGAGG - Exonic
1142109294 16:88322762-88322784 CCTGAAGGTGGGTGGGCACGGGG - Intergenic
1142217349 16:88836200-88836222 CCTGCAGGTAGATCTGGGTGAGG + Exonic
1142620923 17:1165336-1165358 CCTGCGGGTGGATGGCCGGGAGG + Intronic
1143165507 17:4895444-4895466 CCAGCAGATGGATGTGCTGGAGG + Exonic
1145932639 17:28697007-28697029 CCAGCATGTGGATGTGCGGGAGG + Exonic
1147200903 17:38800188-38800210 GCAGCAGGTGGGTGGGCGCGGGG - Intergenic
1147806446 17:43135173-43135195 GCTGAAGGTGGAAGTGCACGGGG - Intergenic
1147994667 17:44354191-44354213 CCTGCAGGTCGATGTAAGAGTGG + Exonic
1147995877 17:44360097-44360119 GGTGCAGGTGTATGTGAGCGGGG - Exonic
1148568567 17:48647959-48647981 CCTGCAGGTGGTTGTCCAGGGGG + Intergenic
1150586369 17:66522155-66522177 CCTGCAGGTGGATGTGGACCAGG + Intronic
1151357723 17:73570384-73570406 CCTCCAGGTGCATGTGAGGGTGG + Intronic
1151477492 17:74352334-74352356 CCTGCAGGTGGGTGGGCGCCTGG + Exonic
1151703566 17:75755516-75755538 CCTGCTGGAGGATGTGCGGTAGG + Intronic
1152431257 17:80249281-80249303 CCTGCAGGTGGGTGTGCACTGGG + Exonic
1152957129 18:49165-49187 GCTGCAGGTGGCTGTCCCCGTGG + Exonic
1154377981 18:13824337-13824359 GCTGCATGTGGAAGTGAGCGGGG + Intronic
1160187797 18:76688895-76688917 GCTGCAGGTGGACGGGTGCGGGG - Intergenic
1160789623 19:917478-917500 CCGGGAGGAGGAGGTGCGCGCGG + Exonic
1162502543 19:11062286-11062308 CCTGCAGGTGGACTTGTGCCTGG + Intronic
1162585264 19:11554349-11554371 TCTGCAGGTGGATGAGCCTGTGG + Exonic
1165323431 19:35100072-35100094 CCAGCAGGTGGATGTGGATGTGG + Intergenic
1166978149 19:46617161-46617183 CCTGCAGGGGGGTGGGAGCGCGG + Intergenic
1167339409 19:48905950-48905972 CCTCCAGGTGGTTGTGTGCTAGG + Intronic
925005281 2:438679-438701 CCTGCTGGTGGGTGTGCGGTTGG + Intergenic
926092363 2:10059105-10059127 CCTGCTGGTGGATATGTGCTGGG - Intronic
928975703 2:37084341-37084363 CCTGCAGGTAGGAGTGCGGGAGG - Exonic
933357814 2:81235779-81235801 CCAGCAGGTGGAAGTGCGGTAGG + Intergenic
933730235 2:85450703-85450725 ACTGCAGGTGGCTGTGTGAGGGG + Intergenic
934656467 2:96118989-96119011 CCTGAAGGTGTGTGTGTGCGGGG - Intergenic
934947786 2:98554459-98554481 CCTGCAGGTGGACTGGCACGAGG + Exonic
935397058 2:102619914-102619936 CCTGCAGGTGGCGGGGCCCGTGG + Exonic
936013666 2:108942082-108942104 CCTGCAGGTGTGTGTGCTGGGGG + Intronic
936061595 2:109298567-109298589 CCTGCAGGAGGATGAGCCCCGGG + Intronic
940883996 2:158973052-158973074 CCTGCAGGTGGGTGTGATCAAGG + Intronic
941664647 2:168232270-168232292 CCTTCAGGGGGATGTGTGGGAGG - Intronic
945067188 2:205957240-205957262 CCTGCAGGTGTGTGTGTGTGGGG + Intergenic
948290967 2:236824132-236824154 CCTGGAGGTGGGTGTGTGCTGGG + Intergenic
948932981 2:241144075-241144097 CCTGCAGGTGTGTGTGTGTGTGG + Intronic
949040052 2:241843974-241843996 CCGGCCGGTGGGTGTGGGCGGGG + Intergenic
1169191197 20:3660157-3660179 CCTGCAGGAGGCTGTGCTCCGGG + Exonic
1170890306 20:20369770-20369792 CCTGCAGGTGCCCGTGCGCCCGG + Exonic
1172824056 20:37765190-37765212 CTTGCAGGTGGATGGGCAGGTGG + Exonic
1174274658 20:49395111-49395133 CCTGCCGGTGGATGAGTGGGGGG - Intronic
1174386778 20:50192078-50192100 CCGGCAGGGGGACGCGCGCGGGG - Exonic
1175258268 20:57659735-57659757 CCTGCAGGTCGCTGTGCTCAGGG + Intronic
1175685194 20:61023757-61023779 CCTGCAAGTGGTTGTGAGGGTGG - Intergenic
1176097522 20:63351133-63351155 CGTGGACGTGGATGTGGGCGTGG - Intronic
1176097526 20:63351151-63351173 CGTGGACGTGGATGTGGGCGTGG - Intronic
1176243077 20:64083997-64084019 CCTGCTGGAGGACGTGGGCGCGG - Exonic
1176412584 21:6457184-6457206 CCTGCAGGTGGACGTGCTGCGGG - Intergenic
1179255062 21:39708754-39708776 ACTGCAGGTGGATGTGTGGTAGG - Intergenic
1179688078 21:43065506-43065528 CCTGCAGGTGGACGTGCTGCGGG - Exonic
1180149365 21:45939863-45939885 CCTGCAGGCAGGTGTGGGCGGGG + Intronic
1180614921 22:17120735-17120757 GCTGCAGGAGGAGGTGGGCGTGG + Exonic
1181125949 22:20702619-20702641 TCTGCAAGGGGAGGTGCGCGAGG + Intergenic
1182283812 22:29232421-29232443 CCAGCAGGTGGAGGTGGGGGTGG + Intronic
1184225809 22:43128336-43128358 CCTGCAGGTGGAGGCGCCCACGG + Intronic
1184323036 22:43757601-43757623 GCTGCAGCTGGATGGGGGCGGGG - Intronic
1185218163 22:49615420-49615442 CCTGCACGTGGATCTGGACGGGG + Intronic
950750822 3:15126812-15126834 CCTGCAGGTGGGTGGGCAAGGGG - Intergenic
951234752 3:20221137-20221159 CCTGAAGGTGGGTGTGCCTGAGG - Intergenic
954697734 3:52436528-52436550 CGTGCACGTGCATGTGTGCGTGG - Intronic
958472286 3:94535945-94535967 CCTGCAGGTGGAAGAGGGAGTGG - Intergenic
958907358 3:99956633-99956655 CATGGAGGTGGCTGGGCGCGGGG - Intronic
961283467 3:125781567-125781589 CCTGCAGGTGGGTGGGCAAGGGG - Intergenic
961544178 3:127620760-127620782 CCCGCAGATGGATGCGCGCGTGG - Exonic
967090734 3:186132796-186132818 CCAGCAGGTGGATTTGCTCTTGG + Intronic
969014242 4:4092666-4092688 CCTGCAGGTGGATGGGCAAGGGG + Intergenic
969739734 4:9015746-9015768 CCTGCAGGTGGGTGGGCAAGGGG - Intergenic
969798899 4:9547290-9547312 CCTGCAGGTGGGTGGGCAAGGGG - Intergenic
973633432 4:52840674-52840696 CCTTCATCTGGATGTGCACGTGG + Intergenic
974653913 4:64793458-64793480 TGTGCAGGTGTATGTGTGCGTGG + Intergenic
977816350 4:101417353-101417375 CCTGCAGGTGCAGGTGTGCCTGG + Intronic
978443883 4:108762686-108762708 CCTGCAGGTGGAGGCGCGCGGGG + Intronic
985441398 4:189984480-189984502 GCTGCAGGTGGCTGTCCCCGTGG + Intergenic
987292865 5:16524845-16524867 CCTGCAGGTGGATGTGCGCGGGG + Intronic
987292877 5:16524897-16524919 CCTGCAGGTGGATGTGCGCGGGG + Intronic
987292888 5:16524949-16524971 CCTGCAGGTGGATGTGCATAGGG + Intronic
987292899 5:16525001-16525023 CCTGCAGGTGGATGTGCGTGGGG + Intronic
987292910 5:16525053-16525075 CCTGCAGGTGGATGTGCGCGGGG + Intronic
987292922 5:16525105-16525127 CCTGCAGGTGGATGTGCGTGGGG + Intronic
987292932 5:16525157-16525179 CCTGCAGGTGGATGTGCATAGGG + Intronic
987292943 5:16525209-16525231 CCTGCAGGTGGATTTGCGAGGGG + Intronic
987292955 5:16525261-16525283 CCAACAGGTGGATGTGCGCGGGG + Intronic
991442827 5:66669219-66669241 CCTCTAGGTGGATGTGCTCTGGG + Intronic
996722848 5:126647129-126647151 ACTGCAGGTGGATGTGGGGGTGG - Intergenic
998121403 5:139581062-139581084 CCTGAAGGTGGATGTGGGGGAGG + Intronic
1003054101 6:2803468-2803490 CCTGCAGGTGACAGCGCGCGTGG + Intergenic
1006258807 6:32852169-32852191 CCTGCAAGTGGCTGTGCACGTGG + Exonic
1007018590 6:38495748-38495770 CGTGCAGGTGCATCTGGGCGGGG + Intronic
1008662252 6:53680181-53680203 CCTGGAGGTGGCTGTGTGCCCGG - Intergenic
1014504877 6:122242792-122242814 CCTGCAGGGAGATGTGTGCCTGG + Intergenic
1016122160 6:140357604-140357626 CCTGGAGGAGGATGTGGGAGGGG - Intergenic
1017827890 6:158095893-158095915 CCTGCAGGTGGAAGGCTGCGGGG - Exonic
1018710421 6:166494780-166494802 CCTGGAGGTGGATGTGTGCTGGG - Intronic
1019442529 7:1054702-1054724 CCTGCAGGTGGAACCGCGTGGGG - Intronic
1019604194 7:1900367-1900389 CCCACAGGTGGATGGGCGCCAGG - Intronic
1020477483 7:8615257-8615279 CCTGCAGGAGGCAGTGCGCATGG + Intronic
1022687291 7:32608787-32608809 CCTGCAGGGGGAGGTGTGAGGGG + Intergenic
1022818510 7:33936051-33936073 CCTGCAGGTGTGTGTGTGTGTGG - Intronic
1023058239 7:36306731-36306753 CCTGGAGGTGGATGTTGGGGCGG - Intergenic
1023176728 7:37442751-37442773 CCTGCAGATGGATGTGCCCTGGG - Intronic
1026897982 7:74021602-74021624 CCTGCAGGCGGCTGTGTGGGTGG + Intergenic
1028897862 7:96062124-96062146 CCTGCAGCTGGACGTGGGCCAGG - Intronic
1029072910 7:97914304-97914326 CCTGCAGGTGGGTGGGCAAGGGG + Intergenic
1032077400 7:128842568-128842590 CCCGCAGGTGAACGTGGGCGAGG + Exonic
1032085077 7:128879608-128879630 CCTCCAGGTGGATGGGCACCCGG - Exonic
1034284064 7:149873279-149873301 GCTGCAGATGGATGTCCGCGAGG + Exonic
1035326623 7:158070307-158070329 CCTGGTGGTGGAGGTGCTCGTGG + Intronic
1035326639 7:158070360-158070382 CCTGGTGGTGGAGGTGCCCGTGG + Intronic
1035326672 7:158070483-158070505 CCTGGTGGTGGAGGTGCCCGTGG + Intronic
1035326728 7:158070663-158070685 CCTGGTGGTGGAGGTGCCCGTGG + Intronic
1035326810 7:158070931-158070953 CCTGGTGGTGGAGGTGCCCGTGG + Intronic
1035326927 7:158071414-158071436 CCTGGTGGTGGAGGTGCTCGTGG + Intronic
1035326989 7:158071711-158071733 CCTGGTGGTGGAGGTGCTCGTGG + Intronic
1037106787 8:15118541-15118563 CCTGTCTGTGGATGTGTGCGTGG + Intronic
1037492887 8:19412407-19412429 CCTGCAGCTGCATGTGAGCTGGG + Intronic
1045293098 8:100850574-100850596 CCTGCAAGAGGATGTCCGTGGGG + Intergenic
1049782313 8:144434653-144434675 CCTGCACTTGGATGTGTGGGTGG - Intronic
1050382430 9:5043128-5043150 CCCGCAGGTGTATGTGCAGGGGG + Intronic
1057448332 9:95134767-95134789 CCAGGAGGTGGATGTCCACGTGG + Intronic
1060970043 9:127732609-127732631 CCTGCAGGAGGATCTCCTCGCGG + Exonic
1062017282 9:134297178-134297200 CCAGCAGGAGGAGGAGCGCGCGG + Intergenic
1062741020 9:138175413-138175435 GCTGCAGGTGGCTGTCCCCGTGG - Intergenic
1186851420 X:13583775-13583797 CCTGCAGTTGGATGTCTGCGAGG - Intronic
1187063097 X:15806971-15806993 CATTCAGGTGGATGTGGGCCAGG + Intronic
1188285762 X:28323890-28323912 CAGGCAGGTGGATGTAAGCGGGG - Intergenic
1200817773 Y:7551401-7551423 CATGCAGGTGTATGTGTGCATGG + Intergenic