ID: 987292910

View in Genome Browser
Species Human (GRCh38)
Location 5:16525053-16525075
Sequence CCTGCAGGTGGATGTGCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 3, 1: 2, 2: 3, 3: 19, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987292898_987292910 29 Left 987292898 5:16525001-16525023 CCTGCAGGTGGATGTGCGTGGGG 0: 2
1: 3
2: 4
3: 20
4: 211
Right 987292910 5:16525053-16525075 CCTGCAGGTGGATGTGCGCGGGG 0: 3
1: 2
2: 3
3: 19
4: 155
987292902_987292910 -7 Left 987292902 5:16525037-16525059 CCTGTGTCCTCCGGCTCCTGCAG No data
Right 987292910 5:16525053-16525075 CCTGCAGGTGGATGTGCGCGGGG 0: 3
1: 2
2: 3
3: 19
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987292910 Original CRISPR CCTGCAGGTGGATGTGCGCG GGG Intronic