ID: 987292922

View in Genome Browser
Species Human (GRCh38)
Location 5:16525105-16525127
Sequence CCTGCAGGTGGATGTGCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 2, 1: 3, 2: 3, 3: 21, 4: 247}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987292909_987292922 29 Left 987292909 5:16525053-16525075 CCTGCAGGTGGATGTGCGCGGGG 0: 3
1: 3
2: 3
3: 17
4: 160
Right 987292922 5:16525105-16525127 CCTGCAGGTGGATGTGCGTGGGG 0: 2
1: 3
2: 3
3: 21
4: 247
987292912_987292922 -7 Left 987292912 5:16525089-16525111 CCTGCATCCTCCAGCCCCTGCAG 0: 1
1: 1
2: 8
3: 93
4: 767
Right 987292922 5:16525105-16525127 CCTGCAGGTGGATGTGCGTGGGG 0: 2
1: 3
2: 3
3: 21
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987292922 Original CRISPR CCTGCAGGTGGATGTGCGTG GGG Intronic