ID: 987294746

View in Genome Browser
Species Human (GRCh38)
Location 5:16539666-16539688
Sequence TCACATCAGGGCCCCGGTAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 62}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987294746_987294752 17 Left 987294746 5:16539666-16539688 CCGGTACCGGGGCCCTGATGTGA 0: 1
1: 0
2: 0
3: 9
4: 62
Right 987294752 5:16539706-16539728 GCAGAACTCACACCTCTGTCAGG 0: 1
1: 0
2: 0
3: 12
4: 121
987294746_987294751 -5 Left 987294746 5:16539666-16539688 CCGGTACCGGGGCCCTGATGTGA 0: 1
1: 0
2: 0
3: 9
4: 62
Right 987294751 5:16539684-16539706 TGTGACTTCACTATTGCTAAGGG 0: 1
1: 0
2: 0
3: 10
4: 124
987294746_987294750 -6 Left 987294746 5:16539666-16539688 CCGGTACCGGGGCCCTGATGTGA 0: 1
1: 0
2: 0
3: 9
4: 62
Right 987294750 5:16539683-16539705 ATGTGACTTCACTATTGCTAAGG 0: 1
1: 0
2: 0
3: 23
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987294746 Original CRISPR TCACATCAGGGCCCCGGTAC CGG (reversed) Intronic
906795320 1:48692194-48692216 TCACATCAGGGACTTGGTAAAGG - Intronic
919797680 1:201331224-201331246 CCATATCAGGGTACCGGTACCGG + Exonic
1071926335 10:90414369-90414391 ACACATCAGGAACCCTGTACAGG - Intergenic
1079348829 11:19675715-19675737 ACACATTTGGGCCCCGGGACTGG - Intronic
1079386420 11:19984164-19984186 TCCCATCAGGGAGCCGGTTCAGG - Exonic
1085404219 11:76252296-76252318 TCACATCATGCCCTCGGTACAGG - Intergenic
1085752071 11:79170256-79170278 TCACATCAGGAGCCCAGCACTGG + Intronic
1088399981 11:109412787-109412809 TCACAAAAGGGCCCCATTACTGG + Intergenic
1088688624 11:112305699-112305721 TCACATCAGTGCCCTGCTTCGGG - Intergenic
1091147218 11:133290367-133290389 TCACCTCAGGGCTCAGGTACAGG - Intronic
1110916017 13:81021556-81021578 TCATATCAGGGCCCCGTTGCAGG - Intergenic
1113455005 13:110442199-110442221 TCACATCTGGGCCCCAGCCCTGG - Intronic
1113708723 13:112450328-112450350 TCAAATCCGGGCCCCTGTCCTGG - Intergenic
1119319933 14:73724549-73724571 TCACAACAGGGCCCTTGTAGGGG + Intronic
1119616712 14:76103512-76103534 TCACCTCTGGGCCCTGGTATGGG - Intergenic
1119709025 14:76807918-76807940 TCACATCAGGGTCCCAGTGCTGG + Exonic
1119916086 14:78403581-78403603 ACACATCTGGGGCCCGGGACAGG - Intronic
1119973605 14:79000679-79000701 TCACATCAGTGCCCTGCTGCTGG + Intronic
1122314176 14:100815886-100815908 CCAAATTAGGGCCCCGGTATGGG + Intergenic
1122821753 14:104350186-104350208 TCACATCAGGGCGCAGGAGCTGG - Intergenic
1125387553 15:39154519-39154541 TCACTCCAGGGCCCCTCTACTGG + Intergenic
1129224835 15:74163099-74163121 TCACATCAAAGCCCCTGTACTGG + Intergenic
1131548066 15:93332637-93332659 TCCCAGCAGGGCCCGGGTACTGG - Intergenic
1132244135 15:100281200-100281222 CCACATCAGGACCCCGGCTCCGG + Intronic
1134094647 16:11411442-11411464 TCACATCAGTGGCCCAGTTCAGG + Intronic
1138386734 16:56640570-56640592 TCACATCAGTGACCCTGGACAGG - Intronic
1141570819 16:84932672-84932694 TGACCTCAGGGCCCCTGCACTGG - Intergenic
1144682724 17:17206119-17206141 CCGCAGCAGGGCCTCGGTACAGG + Exonic
1157624769 18:49042193-49042215 TCACCTCAGAGCCCATGTACAGG - Exonic
1159395128 18:67846539-67846561 CCACATCATGGCCCCTGTGCTGG + Intergenic
1160948757 19:1655692-1655714 TCCCTCCAGGGCCCTGGTACGGG + Intergenic
1162069018 19:8142644-8142666 TCACATCTGGGCTCATGTACTGG - Intronic
1163777607 19:19227354-19227376 CCACAGCAGGGCCCCTGTCCTGG + Exonic
1165767642 19:38361134-38361156 TCCCATCAGGGCCTCTGCACAGG - Intronic
926913977 2:17876404-17876426 TCACAGCATGCCCCCGGTAATGG + Intergenic
927452865 2:23223886-23223908 TCACAGCAGGGCCCTGATTCTGG + Intergenic
933705737 2:85288658-85288680 TCACAACTGGGCCCGGGTGCGGG + Intronic
1170139588 20:13112264-13112286 GCACATCTGGCCCTCGGTACTGG + Intronic
1178828126 21:36032897-36032919 TCACATCAGCGCCCCACAACAGG - Intergenic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
1181994296 22:26862903-26862925 TCACATCACATCCTCGGTACAGG + Intergenic
1184775272 22:46619989-46620011 CCACATCAGGGCCCGGCTGCTGG - Intronic
1184889691 22:47372155-47372177 TCACAGCAGGGCCCCGTCAATGG - Intergenic
1185207393 22:49547995-49548017 TCACATCCGGCCCCCTGTTCTGG + Intronic
1185295062 22:50049101-50049123 TCACAGCAGGGCCCCTTGACCGG - Intronic
950502083 3:13370997-13371019 CCACCTCTGGGCCCTGGTACAGG + Intronic
950880018 3:16316077-16316099 TCACTTCAGGGCATCGGGACTGG - Exonic
953153860 3:40350970-40350992 TCACATCAGGAACCCTGCACAGG - Intergenic
954155155 3:48681337-48681359 TCACATCCAGGCCTCGGTGCCGG - Exonic
954752881 3:52823582-52823604 GCACATCAGGCCCCCGGTCCTGG + Exonic
955465983 3:59237932-59237954 GCACTTCAGGGCCCCGGAATAGG + Intergenic
978399366 4:108314508-108314530 TCACCTCAGGGCCTTTGTACAGG + Intergenic
985779569 5:1863133-1863155 CCAGATCAGGGCCCGGGAACGGG - Intergenic
987294746 5:16539666-16539688 TCACATCAGGGCCCCGGTACCGG - Intronic
992518399 5:77521394-77521416 TAACAGCAGGGTACCGGTACCGG + Intronic
1002707473 5:181171974-181171996 TCACACCAGGGCACTGCTACTGG - Intergenic
1005838771 6:29726235-29726257 TCACATCAGGGCCCCTGCCCTGG - Intronic
1009340027 6:62542055-62542077 TCACATCTGGGCCTGGGGACTGG + Intergenic
1019494413 7:1331140-1331162 TCACATCTCTGCCCCGGTGCTGG - Intergenic
1024561952 7:50652314-50652336 TCCCATCAGGGCCACGGTTATGG + Intronic
1026732566 7:72924665-72924687 TCACATCATGGCCCAGATATCGG - Intronic
1027111501 7:75443180-75443202 TCACATCATGGCCCAGATATCGG + Intronic
1049599706 8:143501717-143501739 TCACACCAGCGCCCCGGGGCCGG - Intronic
1049655497 8:143795231-143795253 TCACATCAGGGCACTGGAGCGGG - Intronic
1055680760 9:78712663-78712685 TCACATCAGGGACGCAGGACTGG + Intergenic
1056326175 9:85480592-85480614 TCACATCAGGGCCTCTGCACTGG + Intergenic
1059332399 9:113543823-113543845 TCACATCAGGGTCCCAGGTCCGG + Intronic
1059391557 9:114002494-114002516 TGGCATCAGGGGCCCGGTGCGGG + Intronic
1062298936 9:135853140-135853162 TCACCTCAGGGGCAAGGTACTGG - Intronic
1190822427 X:53986004-53986026 TCAGATCATCGCCCCTGTACTGG - Intronic
1195704590 X:107729695-107729717 TCACAACAGGGCCCCGGGGGTGG - Intronic
1198092044 X:133341158-133341180 TCACAGCAGGCCTTCGGTACTGG + Intronic