ID: 987295284

View in Genome Browser
Species Human (GRCh38)
Location 5:16545017-16545039
Sequence CCTTATTTTGAGAGGAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987295284 Original CRISPR CCTTATTTTGAGAGGAAAGC AGG Intronic
901122277 1:6905549-6905571 CTTTATTATGAGAGGGAAGCGGG - Intronic
902417385 1:16248664-16248686 CCTTATTTACAAGGGAAAGCTGG - Exonic
904769869 1:32874980-32875002 AATTAACTTGAGAGGAAAGCAGG + Intergenic
906268402 1:44453488-44453510 CCTGATTTTAAGAGGCAAGCAGG - Intronic
906740487 1:48178241-48178263 CAATTTTTTGAGAGGAAAGAAGG + Intergenic
910761623 1:90738215-90738237 CCTTCTATTGAGATGAAATCTGG + Intergenic
911699535 1:100935675-100935697 AATTTTTTTTAGAGGAAAGCTGG - Intronic
912688538 1:111786123-111786145 CCCTCTTCTGAGAGGAAACCTGG + Intronic
913555367 1:119961335-119961357 TCTTAGTTTGAGGGTAAAGCAGG - Intronic
915155205 1:153869968-153869990 CCTTTTTTTGAGATGAAGTCTGG + Intronic
915244668 1:154547859-154547881 CTCTCTTTTGAGAGGGAAGCTGG - Exonic
915703493 1:157820832-157820854 CCTGATTTTGAGGGAAAAGAGGG - Intergenic
918285873 1:183054543-183054565 TGTTATATTGAGAAGAAAGCAGG + Intronic
921264904 1:213414328-213414350 CCTTATTTGGAAAGGAAATAGGG + Intergenic
921332240 1:214050821-214050843 CTTTATCTTGAGAGGAAATTAGG + Intergenic
921637801 1:217516496-217516518 CCTCATTTTGAGATGAATGCAGG - Intronic
924327029 1:242905827-242905849 CTTTAGTATGAGAGTAAAGCTGG - Intergenic
1063959952 10:11298974-11298996 CCTAATTTTTAAAGGAAAGGTGG - Intronic
1065577423 10:27136153-27136175 CCTTATTATTAGTGGAAAGAAGG + Intronic
1068701694 10:60026666-60026688 CCTTATTTACAGAGGAAAGGAGG + Exonic
1074376706 10:112946854-112946876 GCATATTTTGGGAGGAAGGCAGG - Intergenic
1076174279 10:128355129-128355151 TCATAGTTTGAGAGGAAAGTGGG + Intergenic
1077655047 11:4010615-4010637 CCTAATTTTGAGAGGAAAATAGG + Intronic
1078845785 11:15117341-15117363 CCATTTTTTGAGGGGAATGCTGG + Intronic
1079969623 11:27020270-27020292 CTCTATTGTGAGAGGAAAGAGGG - Intergenic
1080066680 11:28024285-28024307 CCTTGTTTTAAAATGAAAGCAGG + Intronic
1083020948 11:59506421-59506443 CCTTATTTTTAGATAAAAACTGG + Intergenic
1090973437 11:131662240-131662262 CCTAATTTAGAGGGGGAAGCTGG - Intronic
1096043528 12:48541856-48541878 CCTTATAGAGAGAGGACAGCTGG + Intergenic
1101128456 12:101664009-101664031 TCTTATTTTTAGATGAAGGCAGG - Intronic
1103929689 12:124443319-124443341 CCTTGCTTTGGGAGGAAACCTGG - Intronic
1104330768 12:127842659-127842681 CCTTTTTGTGAGAGGAAGGATGG - Intergenic
1105959143 13:25313186-25313208 CCCTATTTAGAGAGCAAAGCAGG + Intronic
1106227997 13:27799484-27799506 CCTTACTTTGTGGGTAAAGCTGG - Intergenic
1107672439 13:42759993-42760015 CCTGAATTTGAGGTGAAAGCAGG + Intergenic
1108348267 13:49566827-49566849 TCTTATTTTCAGAGGAGAGAAGG - Intronic
1113139803 13:107134627-107134649 ACTTATTTTGAGTGGAATTCAGG - Intergenic
1113837493 13:113337994-113338016 CCTATTTTTCAGAGGAAACCAGG + Intronic
1114029239 14:18561362-18561384 CCTTATTGTTAGTGGAAAGAAGG - Intergenic
1114652319 14:24292939-24292961 CCATATTCTGAGAGGAAAACTGG + Intronic
1114732573 14:25009385-25009407 CCTCATTTTGAGATGCAAGTAGG - Intronic
1120882273 14:89422815-89422837 GCTTACTTTAAGAGGGAAGCAGG + Intronic
1121111664 14:91317080-91317102 CCTTATTTTTAGAGGAAGAGGGG - Intronic
1121769847 14:96524101-96524123 CTTTTTTTTGAGAGGAAGGGGGG + Intronic
1202829789 14_GL000009v2_random:15061-15083 CCTTTTTTTGAGGGGGAAGCTGG + Intergenic
1124353539 15:28978132-28978154 TCTTGTAGTGAGAGGAAAGCTGG - Intronic
1126546081 15:49876127-49876149 ACACATTTTGAGATGAAAGCAGG - Intronic
1128458738 15:67850017-67850039 CCTTATTAGAAGAGGAAATCTGG + Intergenic
1129277538 15:74456740-74456762 CCTTATTTTGATTAGATAGCTGG + Intronic
1130251076 15:82300708-82300730 CCCTATTAGGAGAGGAAAACGGG - Intergenic
1131489997 15:92854390-92854412 CCTTATTTTTTGAGGAAATGTGG + Intergenic
1132065862 15:98730566-98730588 CCTCATTTTCACAGGAAAACAGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133657983 16:7885232-7885254 CCTTAATTTGATAAGGAAGCAGG - Intergenic
1134544557 16:15097760-15097782 ACTATTTTTGGGAGGAAAGCAGG - Intronic
1135362181 16:21824468-21824490 ACTATTTTTGGGAGGAAAGCAGG - Intergenic
1139232782 16:65302308-65302330 CCTGATTTTAGCAGGAAAGCTGG - Intergenic
1141663540 16:85454127-85454149 TCTTATTTTTACTGGAAAGCAGG - Intergenic
1143866004 17:9924666-9924688 CCTTATTTTGAAATGTAAGGTGG + Intronic
1145029848 17:19496090-19496112 CCTTTTTTTGTGGGGAAAGGTGG - Intronic
1145210279 17:21007864-21007886 ACTTACTTTGAGATGAAAACAGG + Exonic
1147241761 17:39095171-39095193 CTGTATTTTCAGAGGACAGCTGG - Intronic
1148949363 17:51296429-51296451 ACTTACTTTGAAAGGAAAACAGG + Intronic
1149522424 17:57327770-57327792 CCCTAGTTTGTGAGTAAAGCTGG + Intronic
1149724272 17:58877351-58877373 CCTGTTTTTCAGAGGATAGCTGG + Intronic
1150474863 17:65467218-65467240 TTTTATTTTTAGAGGACAGCTGG + Intergenic
1153092886 18:1368786-1368808 CCTAATTTAGAGAGCAAAGCAGG - Intergenic
1154418498 18:14201037-14201059 TCCTTTTTTGAGGGGAAAGCTGG + Intergenic
1155377317 18:25174476-25174498 GCTTATTTTGAGAGGGCAGGTGG + Intronic
1157123584 18:44934842-44934864 CTTTATTCTGAGAGGAAATGGGG - Intronic
1158510452 18:58085605-58085627 CCTTATTTATAGAAGAAAGAGGG + Intronic
1159913409 18:74167199-74167221 CCTTATAATGAAAGGAAATCTGG + Intergenic
1160014729 18:75131850-75131872 TTTTATTTTCAGAGGAAACCTGG + Intergenic
1160213941 18:76909941-76909963 CCTTATTTTGAAAAGAAAACAGG - Intronic
1161770490 19:6228315-6228337 CATTGTTTTGAGGGGAAAGAAGG - Intronic
1162272872 19:9630568-9630590 CCCTATTTACAGAGGAAAGCAGG + Intronic
1162584537 19:11551107-11551129 CATTATTTTGATGGGAAAACAGG - Intergenic
1202642898 1_KI270706v1_random:112724-112746 CCTTTTTTTGAGGGGGAAGCTGG - Intergenic
925131205 2:1495373-1495395 TCATATTTTGAGAGGAAAGTGGG + Intronic
925624686 2:5831114-5831136 CCACATTTTCAGAGGAAACCAGG + Intergenic
927098866 2:19771438-19771460 CTTTATTCGAAGAGGAAAGCTGG - Intergenic
928709100 2:33984667-33984689 AATTATTTTGAGAGGAAATTTGG + Intergenic
928901289 2:36320305-36320327 CCTGATTGTGAGAGAAAAACAGG - Intergenic
931014200 2:57956700-57956722 CCTTATTTGGAGAAGAAAGTAGG + Intronic
935515481 2:104031556-104031578 CCTTATTTTTAAAAGCAAGCTGG - Intergenic
938566007 2:132519803-132519825 ATTTACTTTGAGAGGAAAGAGGG - Intronic
938603826 2:132872077-132872099 CTTTCTCTGGAGAGGAAAGCTGG - Intronic
939305775 2:140408819-140408841 GCTTATTTTGAGAAATAAGCAGG + Intronic
939387105 2:141514944-141514966 GTTTCTTTTGAGAGGAAACCTGG + Intronic
939908710 2:147952216-147952238 CCTCAATTTGAGTTGAAAGCAGG + Intronic
940904313 2:159155263-159155285 TTTTATTTTGATAGGAAAGCTGG - Intronic
941516297 2:166483743-166483765 AATTATTCTAAGAGGAAAGCTGG + Intronic
942466537 2:176213695-176213717 ACTTATTTTGAGATGAAAAATGG - Intergenic
942738182 2:179140367-179140389 CCTTATAAGGAGAGGAAATCTGG + Intronic
944828211 2:203506127-203506149 CCATGCTTTGAGAGGAAAGGGGG + Intronic
944914971 2:204350341-204350363 CCTTATATGAAGAGGAAGGCAGG - Intergenic
945026670 2:205626065-205626087 CATTATTTAGAGAGTAAAGAGGG + Intergenic
945258269 2:207820526-207820548 CCATATTTTGGGAGCAAAGAAGG - Intergenic
945588486 2:211696978-211697000 CTTTATTTTGAGAGGAATCACGG + Intronic
948087195 2:235261251-235261273 ACTTATTTTCAAAGGAGAGCTGG - Intergenic
948286302 2:236788194-236788216 CCTTATTTTGACAGGGAAATTGG + Intergenic
948707735 2:239805509-239805531 CCATATTTTAAGAGGAAAAGGGG + Intergenic
1170729129 20:18957090-18957112 CCTTAGTCTGGGAGGAAAGTTGG + Intergenic
1170795917 20:19546607-19546629 CCTTTTTTTGAGGGGAAAGGGGG + Intronic
1171890017 20:30702927-30702949 CCTTTTTTTGAGGGGGAAGCTGG - Intergenic
1173409568 20:42797824-42797846 GCTTACTTTGAGATGAAAGAAGG + Intronic
1173732010 20:45335641-45335663 CCTTTTTTTGAGAAGGAAGAAGG + Intronic
1176314542 21:5230237-5230259 AGTTAATTTGAGAGAAAAGCTGG + Intergenic
1176608978 21:8859901-8859923 CCTTTTTTTGAGGGGGAAGCTGG + Intergenic
1177165343 21:17596083-17596105 CCTTTTTTTGAGATTACAGCAGG + Intronic
1177593272 21:23201641-23201663 CCTTATATTTAGATGAAAGGTGG + Intergenic
1177950585 21:27530837-27530859 ACTTAATTTGAGAGGCAAGTAGG + Intergenic
1179390237 21:40982343-40982365 CTGTGTTTTGAGAGTAAAGCAGG - Intergenic
1179792081 21:43761606-43761628 CCTCATTTTGAGCTGCAAGCTGG + Exonic
1180359068 22:11869733-11869755 CCTTTTTTTGAGGGGGAAGCTGG + Intergenic
1180392331 22:12296211-12296233 AGTTAATTTGAGAGGAAATCTGG + Intergenic
1180407415 22:12568559-12568581 AGTTAATTTGAGAGGAAATCTGG - Intergenic
1180453355 22:15488425-15488447 CCTTATTGTTAGTGGAAAGAAGG - Intergenic
1181548956 22:23625128-23625150 CCTAATTTAAAGAGGAAAACTGG + Intronic
1182016080 22:27040846-27040868 GGTTATTGTGAGAGGTAAGCAGG + Intergenic
1182948241 22:34345298-34345320 TCTCATATTCAGAGGAAAGCAGG + Intergenic
1184770819 22:46595530-46595552 CCACATTTTGAGAGAAAAACAGG + Intronic
1184974651 22:48052388-48052410 CCTTATTTTGAGACGAGAAACGG - Intergenic
949961991 3:9319958-9319980 CCTTCTTCTGAGAACAAAGCTGG + Intronic
951407667 3:22320962-22320984 CATTTTTTTGAAATGAAAGCAGG + Intronic
957717368 3:83946091-83946113 CCTTATATAGAGAGGTAAGATGG + Intergenic
959403204 3:105928637-105928659 GCTTCTTTTGAGTGAAAAGCTGG + Intergenic
960087578 3:113607459-113607481 CCCTATTTTTAGATGAAGGCAGG + Intronic
961081276 3:124031270-124031292 ACTTTTTTTGAGAGGAAATTTGG - Intergenic
961488127 3:127231834-127231856 CCTAGTGTTGAGAGGAAAGCTGG - Intergenic
961674578 3:128556654-128556676 CCCAATTTTTAGAGGAAAGTAGG + Intergenic
962694277 3:137932193-137932215 CATTATTTGGACAGGAAAGGAGG + Intergenic
963474272 3:145783532-145783554 CATTAGTTTTAGAGGAAAGAAGG + Intergenic
965509972 3:169557240-169557262 ACTGCTTTTGACAGGAAAGCTGG - Intronic
967186878 3:186951487-186951509 CGTTAGTTTGAGAGGAATTCAGG - Intronic
967493579 3:190120017-190120039 CCTCTTTTTGAGAGAGAAGCTGG + Intronic
967654346 3:192028596-192028618 CCTTATTTATAGAGGAAAAAAGG + Intergenic
969910868 4:10444546-10444568 TCTTATGTTGAGAGGAAATCTGG + Exonic
970118238 4:12723212-12723234 CTTATTTTTGAGAGGAAAACAGG - Intergenic
972591924 4:40496076-40496098 CTTTTTTCTCAGAGGAAAGCAGG - Intronic
974448535 4:62018712-62018734 CCTTCCTCTGAAAGGAAAGCTGG - Intronic
975394107 4:73854959-73854981 CCTCCTTATGAGAGGTAAGCCGG - Intergenic
976921361 4:90448284-90448306 CATTGTTTTGAGTGGAGAGCAGG + Intronic
978397018 4:108291812-108291834 TCTTATTTTAAGAGAAAAGTGGG + Intergenic
980440235 4:132833979-132834001 GATTATTTTGAGAGCACAGCAGG + Intergenic
981660553 4:147161326-147161348 AATTATTTTAAGACGAAAGCTGG + Intergenic
981751860 4:148099960-148099982 CCTCATTATGGGAGGAAATCAGG - Intronic
982656897 4:158161528-158161550 CCTTGTTTTCAGAGGAGAACTGG - Intronic
982724050 4:158886671-158886693 CCTTAGCTTGAGAGAAAAGAGGG + Intronic
983395150 4:167184699-167184721 TCTTATACTCAGAGGAAAGCTGG - Intronic
985432568 4:189895173-189895195 AGTTAATTTGAGAGGAAAGCTGG - Intergenic
1202770266 4_GL000008v2_random:198619-198641 CCTTTTTTTGAGGGGGAAGCTGG - Intergenic
987295284 5:16545017-16545039 CCTTATTTTGAGAGGAAAGCAGG + Intronic
988304627 5:29479085-29479107 CATTATTTTGTGAGAAAACCAGG + Intergenic
989627554 5:43444993-43445015 CCTTATTCTCTGAGGAAAGATGG - Exonic
990908477 5:60828977-60828999 CCTTATTTTTAGAGGTATACTGG + Intronic
991095393 5:62734462-62734484 CCTTATTTTGGGCAAAAAGCGGG - Intergenic
991277411 5:64865626-64865648 CCTTATTTTTAGAGGGAAGATGG + Intronic
992913260 5:81420338-81420360 CCCTCTTTTGTGAAGAAAGCGGG - Exonic
993564000 5:89449896-89449918 CCTTAGGTTGAAAGGAAAGTGGG + Intergenic
993992030 5:94669070-94669092 CATTATTTTGAAATGAAATCTGG - Intronic
996250702 5:121328122-121328144 CCATATTTTGAGACAAAAGAGGG - Intergenic
996795703 5:127344002-127344024 ACTTGTTTTGGGAGAAAAGCAGG + Intronic
997119101 5:131156170-131156192 CGTTATGTTGAGAGGAACTCAGG - Intergenic
997601355 5:135140891-135140913 CCTTGTTTTGAGAAGGAAGCTGG + Intronic
999042194 5:148426907-148426929 GGGTATTTTGAGAGAAAAGCTGG + Intronic
1000753134 5:165121986-165122008 CTTTGTTTTTAAAGGAAAGCAGG + Intergenic
1002028510 5:176411864-176411886 CATTCTTTAGAGAGGGAAGCAGG - Intronic
1002617998 5:180467423-180467445 TCTTATCTTGAGTGCAAAGCAGG - Intergenic
1003469372 6:6414916-6414938 CTTTAATGTGAGAGGAAGGCAGG + Intergenic
1004921272 6:20378460-20378482 TCTTCTATTGAGTGGAAAGCTGG - Intergenic
1006293369 6:33157999-33158021 CCTTATTTCATGAGGAGAGCAGG + Intergenic
1007729077 6:43934935-43934957 CCCTATTCTTAAAGGAAAGCAGG + Intergenic
1008679019 6:53852691-53852713 AGTTATTTTGAGAGGAAGGATGG + Intronic
1012294736 6:97507215-97507237 TCTTTTTCTGAGAGGAAAGGAGG - Intergenic
1016137769 6:140567425-140567447 CCTTCTTATGGGAGGAAAGGAGG - Intergenic
1017082550 6:150683354-150683376 CCTTTTCTTGAGAGGAGAGGGGG + Intronic
1017104809 6:150877359-150877381 TCATTTTTAGAGAGGAAAGCTGG + Intronic
1019275803 7:175004-175026 TTTTTTTTTAAGAGGAAAGCTGG + Intergenic
1026327869 7:69326578-69326600 TTTTATTTTGAGATGAAATCTGG + Intergenic
1027708606 7:81567721-81567743 TCTTAGTTTGAGATGAATGCTGG - Intergenic
1031356812 7:120797143-120797165 CTTTTTTTTGAGATGAAATCTGG - Intronic
1032648365 7:133851026-133851048 TCTTATTTTGAGAGGGACACTGG - Intronic
1033435620 7:141331038-141331060 ACTGAGATTGAGAGGAAAGCAGG + Intronic
1034701445 7:153099634-153099656 CCTCATTTTGAAAGGCAAGGTGG - Intergenic
1036675195 8:10825863-10825885 GCTTATATTTAGAGGAAAACGGG - Intronic
1037371915 8:18189270-18189292 CGTTATTATGAGAGGAAGGGAGG - Intronic
1037926286 8:22846324-22846346 CCTTCTTTTGAGTGGAAAAGGGG + Intronic
1040484526 8:47857480-47857502 CCTTATTAAAAGAGGAAATCAGG + Intronic
1041360950 8:57053528-57053550 CCTTATTTTTAGTGGGAAGATGG + Intergenic
1042442567 8:68845284-68845306 CCTATTTCTGAGAGGAAAGGGGG - Intergenic
1044215724 8:89607897-89607919 CCTTATTTCTAGAGTAAAGGAGG + Intergenic
1044429343 8:92090288-92090310 CCTTATCTTAAGAGGTAACCAGG + Intronic
1044754210 8:95444922-95444944 CCTTCTTTAGAGAGGAAGGCAGG + Intergenic
1047773453 8:128049400-128049422 CCTTCTCTTGAGAGGCAGGCGGG + Intergenic
1048165790 8:132060122-132060144 CCTGATTTTGAAAGGAGAACTGG + Intronic
1048469732 8:134695852-134695874 CCTTGTTTAGAGAGGCAGGCAGG - Intronic
1050019240 9:1266753-1266775 CTTTATTTTGGGAGCAAAGAAGG + Intergenic
1053721755 9:40953385-40953407 AGTTAATTTGAGAGGAAAGCTGG - Intergenic
1054344206 9:63898604-63898626 AGTTAATTTGAGAGGAAAGCTGG + Intergenic
1054359083 9:64095289-64095311 CCTTTTTTTGAGGGGGAAGCTGG + Intergenic
1054370517 9:64390621-64390643 TCTTTTTTTGAGGGGGAAGCTGG + Intronic
1056786701 9:89597709-89597731 CCTGATTTTGTAAGAAAAGCAGG + Intergenic
1059677396 9:116552572-116552594 CATTATTTTGAAAGGAGAGAAGG + Intronic
1060685360 9:125606188-125606210 CATTATGTTTAGAGGAAGGCAGG + Intronic
1062731602 9:138113200-138113222 CCTTCTTTTGAGAGGCATGAGGG + Intronic
1203453406 Un_GL000219v1:142615-142637 AGTTAATTTGAGAGGAAAGCTGG + Intergenic
1203704378 Un_KI270742v1:25126-25148 CCTTTTTTTGAGGGGGAAGCTGG + Intergenic
1203559622 Un_KI270744v1:40696-40718 CCTTTTTTTGAGGGGGAAGCTGG - Intergenic
1188172151 X:26940864-26940886 CCTTATTTTGAGAGAACTTCAGG + Intergenic
1189348904 X:40262638-40262660 CCCTATCTTGACAGCAAAGCCGG + Intergenic
1189484335 X:41417781-41417803 GATTATTTTTAGAGGAAAGATGG - Intergenic
1192792873 X:74400111-74400133 TCTTTTTTTGAGAGGAAGTCTGG - Intergenic
1193240674 X:79165580-79165602 CCTTATTTTAAGAAGAAGGAAGG - Intergenic
1194845355 X:98800661-98800683 CATTATTATAAGAGGAATGCAGG - Intergenic
1195884877 X:109627183-109627205 TTTTTTTTTGAGAGGAAAGGAGG + Intronic
1196213239 X:113019931-113019953 GCATCTTTTGAGAAGAAAGCAGG - Intergenic
1200688360 Y:6278087-6278109 ACTTATTCTGTGAGGCAAGCAGG - Intergenic
1201046911 Y:9896605-9896627 ACTTATTCTGTGAGGCAAGCAGG + Intergenic
1201224469 Y:11804742-11804764 CTTTAGTATGAGAGTAAAGCTGG - Intergenic