ID: 987295943

View in Genome Browser
Species Human (GRCh38)
Location 5:16551491-16551513
Sequence CTGGGCAAGTAGAAATAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 345}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987295943_987295948 6 Left 987295943 5:16551491-16551513 CCTTCTTATTTCTACTTGCCCAG 0: 1
1: 0
2: 3
3: 28
4: 345
Right 987295948 5:16551520-16551542 CATTCTCCCAGGCCCATTCTTGG 0: 1
1: 0
2: 6
3: 21
4: 181
987295943_987295946 -5 Left 987295943 5:16551491-16551513 CCTTCTTATTTCTACTTGCCCAG 0: 1
1: 0
2: 3
3: 28
4: 345
Right 987295946 5:16551509-16551531 CCCAGTAAGGACATTCTCCCAGG 0: 1
1: 0
2: 2
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987295943 Original CRISPR CTGGGCAAGTAGAAATAAGA AGG (reversed) Intronic
900878302 1:5361915-5361937 TTGCTCAAATAGAAATAAGAGGG - Intergenic
900912322 1:5608643-5608665 GTGGCCAAGTAGAACTTAGAGGG - Intergenic
904241825 1:29151684-29151706 CTGGGCATTTAGTAATTAGATGG + Intronic
905097510 1:35486540-35486562 ATGGGAAAATAGAAACAAGAGGG - Intronic
905795145 1:40811752-40811774 CTGGGCAGGGAGAAAGAACATGG + Intronic
906542288 1:46596527-46596549 CTGGGGAAGTAGAAAGCACAGGG + Intronic
906785331 1:48610723-48610745 CTGGGAAAGTAAAAGTTAGAGGG - Intronic
907286701 1:53385034-53385056 CTGAGCAAGTGGAAAACAGAAGG - Intergenic
907389192 1:54145744-54145766 CAGGGGAAGTAGTAAAAAGAGGG + Intronic
908236763 1:62154690-62154712 CTTTGAAAGGAGAAATAAGAAGG + Intronic
908372165 1:63493920-63493942 CTGGTCAACTAGAAACAAAAGGG + Intronic
908893353 1:68870563-68870585 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
909343414 1:74557117-74557139 CTGGGCAAGAAGAATAAAGCTGG + Intergenic
910306793 1:85773311-85773333 CTGGGCAAGAAGAATAAAGCTGG - Intronic
910925399 1:92393030-92393052 CTGGGCAAGAAGAACAAAGCTGG + Exonic
911595664 1:99796059-99796081 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
911690238 1:100824753-100824775 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
913232831 1:116755864-116755886 CTGGGGAAGTAGTGACAAGAAGG + Intronic
913233102 1:116758249-116758271 CTGGGCAGGGAGTGATAAGAAGG + Intronic
913235940 1:116783571-116783593 TTGGAGAAATAGAAATAAGACGG - Intergenic
913509179 1:119546966-119546988 CTGGGCAAGTAAAGAGAACAAGG + Intergenic
915997968 1:160583821-160583843 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
916440313 1:164818521-164818543 CTGGGAAAGAAGGAATGAGAAGG + Intronic
916756318 1:167773520-167773542 ATGGGCAAGTGGAAATCAGTGGG + Intronic
916908469 1:169317169-169317191 CAGGGCAAGTATAAAAGAGATGG + Intronic
916978174 1:170104325-170104347 CTGGGCAAGAACAAATCTGAAGG - Intergenic
917013947 1:170507919-170507941 CTGGGCAAGTAACAAAATGAAGG - Intergenic
918909975 1:190555107-190555129 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
920915544 1:210255233-210255255 CTGGGCAACTTAAAACAAGAAGG - Intergenic
921019136 1:211220569-211220591 CTGAGCAAGTGGAAACATGAAGG - Intergenic
921039237 1:211414496-211414518 CTGAGCAAAAAGAAAAAAGAAGG + Intergenic
921757010 1:218869431-218869453 GTGGGGAACTAGAAATATGATGG - Intergenic
921947832 1:220898906-220898928 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
923226960 1:231947156-231947178 CTGGGCAAGAAGAATGAAGCTGG + Intronic
923665267 1:235993410-235993432 GTGGGGAAGGAGAAAGAAGAGGG + Intronic
923961454 1:239088752-239088774 ATGGGAAAGTTGAAAAAAGAAGG - Intergenic
1065075225 10:22071966-22071988 TTGGGCAAATACAAATCAGAGGG - Intergenic
1066033513 10:31454962-31454984 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1066375486 10:34854504-34854526 ATGGGCAAATATAACTAAGAGGG + Intergenic
1067230721 10:44407148-44407170 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1068646603 10:59475068-59475090 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1070701901 10:78609928-78609950 CTGGGCAGAGAGAAATGAGAGGG - Intergenic
1070782344 10:79145014-79145036 CTGGGCAAGAGGAAGAAAGAAGG - Intronic
1071072057 10:81705715-81705737 CTGAGCAAGGAGATAAAAGATGG - Intergenic
1071193147 10:83125945-83125967 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1071222595 10:83486935-83486957 CTGAGAAAGTAGAAATAGCATGG + Intergenic
1071867281 10:89748469-89748491 TTGGCCAAGTACAAATAACATGG - Intronic
1072245448 10:93539942-93539964 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1072281852 10:93872692-93872714 CTTGGCAATTATGAATAAGATGG + Intergenic
1072517448 10:96199547-96199569 AAGGACAAGTAGAAATGAGATGG + Intronic
1072567569 10:96630182-96630204 CTGAAGAAGTAGAAATAAGGAGG - Intronic
1072660090 10:97358609-97358631 CTGGGCAAGCAGAAAGCAAAAGG - Exonic
1073975715 10:109098614-109098636 CTTGGAAAGTATAAATAATAAGG + Intergenic
1074395771 10:113096875-113096897 CAGAGAAAGAAGAAATAAGAGGG + Intronic
1076393278 10:130119854-130119876 CTGGGAATGTTTAAATAAGAGGG - Intergenic
1076425242 10:130363019-130363041 CTGGGCAAGTAGCAACTTGATGG + Intergenic
1076448472 10:130536844-130536866 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1076661945 10:132061522-132061544 CTTGGCAAGTTGATATAAAAAGG + Intergenic
1079652879 11:22951763-22951785 CTGAGAAAGAAGAAAGAAGATGG - Intergenic
1080092730 11:28367648-28367670 CTGGGCAAGAAGAACAAAGTTGG + Intergenic
1080114921 11:28611359-28611381 GTGGGCTAGTAGATATCAGAGGG - Intergenic
1080236743 11:30078649-30078671 CTGCTCAAGTGGAAATAAGTTGG - Intergenic
1080489051 11:32743097-32743119 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1080737111 11:35027053-35027075 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1084436479 11:69144447-69144469 CAGGGCAAGTAGGCATAGGATGG + Intergenic
1084443532 11:69190065-69190087 CTGGGCAGGTAGAAAGAAGGCGG + Intergenic
1085003826 11:73066054-73066076 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1085594556 11:77797210-77797232 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1087063481 11:94005888-94005910 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1088999363 11:115038198-115038220 CTGGGCAACTGGAAAGAGGAAGG - Intergenic
1089251876 11:117169698-117169720 CTGGGCTACTAAAAATAAAAAGG - Exonic
1093768432 12:22992257-22992279 GTGGGCAGATAGAATTAAGAGGG - Intergenic
1094118578 12:26944230-26944252 CTGGAAAAGAAGAAATAAAACGG - Intronic
1094400040 12:30052729-30052751 CTGGACAAGTAGTAAGATGATGG + Intergenic
1095135790 12:38600942-38600964 TTGGGAAAGTAAAAATGAGATGG + Intergenic
1095216157 12:39551324-39551346 TTGGGCAAATAGATATAACATGG + Exonic
1097514424 12:60586749-60586771 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1099217061 12:79866018-79866040 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1099420204 12:82448721-82448743 GTGGTCAAGTTGAAATTAGAAGG + Intronic
1099895803 12:88645109-88645131 GTGGGTAAGTAGAAACAGGAAGG - Intergenic
1099923210 12:88984776-88984798 CTGAGAAAGAAGACATAAGAAGG + Intergenic
1101072231 12:101087761-101087783 CTGGGCAAGTACAATTAGGAAGG - Intronic
1101127965 12:101658574-101658596 TTGGGAAAGAAGAAATAAAATGG + Intronic
1101600822 12:106208223-106208245 CTGGGCAAGAAGAATAAAGCTGG - Intergenic
1101628191 12:106466893-106466915 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1101906240 12:108828647-108828669 CTGCCCAAGTAGAAATCAGAAGG + Intronic
1104342623 12:127965884-127965906 CTGGCCAAGATGAACTAAGAGGG + Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1107243734 13:38267572-38267594 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1108830823 13:54476139-54476161 CTGGGCAAGCAGAAAGAAAAAGG - Intergenic
1109050769 13:57478484-57478506 CTGGTCAAGAAGAAAAAAGCTGG + Intergenic
1109282672 13:60375114-60375136 CTGGGCAAGAATAAAAAAGCTGG + Intergenic
1110199277 13:72829720-72829742 CTGGGCAAGAAGAAGAAAGCTGG - Intronic
1110560767 13:76908770-76908792 CTGGGGAAGCAGAAAAAAGATGG - Intergenic
1110679367 13:78290325-78290347 CTGGGCAAAAAGAACAAAGACGG - Intergenic
1112707149 13:102083337-102083359 CTGGGCAAGAAGAAAAAAAACGG - Intronic
1114326343 14:21593012-21593034 CAGGACAAGAAGAACTAAGAGGG + Intergenic
1115262865 14:31471371-31471393 CTGGGAAGCTAGAAACAAGATGG - Intergenic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1115752269 14:36505133-36505155 AAGGACAAGTACAAATAAGAGGG + Intronic
1116417634 14:44697933-44697955 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1116554362 14:46284614-46284636 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1116569571 14:46498430-46498452 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1117815030 14:59588739-59588761 CTGGTCAAATAGAAACATGAAGG + Intergenic
1117883766 14:60337787-60337809 CTGGGCAAGAAGAACAAAGCCGG - Intergenic
1118270316 14:64337422-64337444 CTGAGCAAGTGAAATTAAGAAGG - Intronic
1118557565 14:67042670-67042692 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1118893546 14:69927997-69928019 CTGGGCAAGTAGGGAAAGGAGGG + Intronic
1120383852 14:83819086-83819108 GTGGGGAAATAGAAAAAAGAGGG - Intergenic
1121319181 14:92981200-92981222 CTGGTCAGGAAGAAATAGGATGG - Intronic
1122498508 14:102177268-102177290 ATTGGCAAGTAGAAATATGTGGG - Intronic
1124086956 15:26559956-26559978 CTGGGCAGGTGGACAAAAGATGG + Intronic
1125182572 15:36894622-36894644 ATGGGCAAGGAAAAATAAAATGG + Intronic
1125207717 15:37173677-37173699 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1125554169 15:40570278-40570300 CTGTGCAAATAGTAATAATAGGG + Intronic
1126567165 15:50112772-50112794 CTGGGGAGGTGGAAATGAGATGG - Intronic
1126742485 15:51791555-51791577 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1126837961 15:52686888-52686910 CTGTGCAAGTTGAAATAAGAAGG - Intronic
1127168875 15:56277610-56277632 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1128829381 15:70753105-70753127 CTGGCCAAGTAGCAAAAATAAGG + Intronic
1129342858 15:74897489-74897511 CTGGGCAGGAAGAAATGATAAGG - Intronic
1129507515 15:76094557-76094579 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1130307118 15:82720645-82720667 CTAGGCAAGAAGAAAGGAGAAGG - Intergenic
1134561107 16:15210633-15210655 CTGGGCAATTAAAAATAAAATGG - Intergenic
1134921644 16:18122253-18122275 CTGGGCAATTAAAAATAAAATGG - Intergenic
1135793647 16:25421485-25421507 CTGGGCAGGGAGAAGGAAGAGGG + Intergenic
1140507059 16:75480126-75480148 GTGGGTAGGTAGAACTAAGAAGG - Intronic
1141335474 16:83150954-83150976 CTGGGAATGTAAAAAAAAGATGG - Intronic
1141571668 16:84937912-84937934 CTGTGCAAGAAAAAATAAAATGG - Intergenic
1141852721 16:86658468-86658490 GTGGGCAGGTAGAAAGATGAAGG - Intergenic
1144397916 17:14863169-14863191 CTGGGCAAGTGAAGGTAAGAAGG + Intergenic
1146567042 17:33922347-33922369 CTGGGTTTGTAGAAATAAGTTGG - Intronic
1147124665 17:38358252-38358274 CTGGGGAAGAATAAATAACATGG + Intronic
1147759962 17:42791155-42791177 CTGGGTAAGGAGAGAAAAGAGGG - Intronic
1147941219 17:44049710-44049732 CTGGGCATGTGGAAATAAGATGG - Intronic
1148464775 17:47858213-47858235 CTGGGCAAGGAGGAGAAAGATGG - Intergenic
1149446055 17:56714266-56714288 CTGGGCAAAGAGACATAGGAAGG + Intergenic
1153112430 18:1608201-1608223 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1153341028 18:3975021-3975043 CTGGGCAAGGGGAAATAAATGGG + Intronic
1154381822 18:13858731-13858753 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1155383549 18:25251243-25251265 TTTGGCAAATAGAAATGAGAAGG - Intronic
1155450415 18:25957520-25957542 CAGGGCAAAGAGAAATAGGAAGG - Intergenic
1155549871 18:26953551-26953573 CTAGGGAGGTAGAAATGAGAAGG + Intronic
1157116517 18:44867417-44867439 GTGGGCTTGTTGAAATAAGATGG - Intronic
1159097307 18:63918869-63918891 GTGGGCACTTAGAAACAAGAGGG + Intronic
1164035174 19:21447710-21447732 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1165940016 19:39410251-39410273 CGGGGCAAGGAGAAAAAAGAGGG - Intergenic
930323748 2:49886879-49886901 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
930342635 2:50136009-50136031 CTGGGCAAGTAGGAAAAGTAGGG - Intronic
931572210 2:63680781-63680803 CTTCTCAAGTAGAAAGAAGAAGG - Intronic
931594934 2:63931204-63931226 CTGGGCAAGAAGAACAAAGCTGG + Intronic
932006777 2:67935232-67935254 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
932688786 2:73895025-73895047 CCGTGCAGGTAGAAGTAAGAAGG + Intronic
935020214 2:99223065-99223087 CTGTGTAAGTAAAAATAGGATGG - Intronic
935021244 2:99234520-99234542 CTGGGCAAGAAGAACAAAGCTGG + Intronic
935567533 2:104625174-104625196 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
936773174 2:115939395-115939417 CTGGGATAGTAGAAATAAGAAGG - Intergenic
939216338 2:139243243-139243265 AAGGGCAAGTAGAAATAAAAGGG + Intergenic
940105070 2:150090222-150090244 TTCGGCAAGTAGAGATAGGAAGG - Intergenic
940964949 2:159826656-159826678 CTGGACAAGAAGAACAAAGATGG + Intronic
941041037 2:160624034-160624056 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
942069002 2:172298470-172298492 GTGGGCAAGTAGAAAACAGAAGG - Intergenic
942492111 2:176499785-176499807 CTGAACAAGCAGAAATAAGGGGG - Intergenic
942722664 2:178970320-178970342 CTGGGCAAGAAGAACAAAGCTGG + Intronic
942766602 2:179464789-179464811 CTGGGCAAGAAGAACAAAGCTGG - Intronic
942864520 2:180657078-180657100 CTGGGATAGGAGAAATATGAAGG + Intergenic
943046156 2:182864782-182864804 CTGCGCAAGTTGAAAGAGGAAGG + Intronic
944008451 2:194941174-194941196 CTGGGCAAGAAGAACAAAGTTGG + Intergenic
945161439 2:206895656-206895678 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
945347442 2:208734761-208734783 CTGAGCAAGAAGAAAAAAGCTGG - Intronic
946409399 2:219508768-219508790 CTGGGAAGGGAGAAACAAGAGGG + Intergenic
947136571 2:226982082-226982104 CTGGGCAAGAAAAGAAAAGAGGG - Intronic
947301042 2:228688975-228688997 CTGGGAAAGTAAAAATGGGAGGG + Intergenic
1169312549 20:4557868-4557890 TTGGGAAAGAAGAAATAAAATGG + Intergenic
1169979708 20:11370712-11370734 ATGGGCAAGAAGAAAAAGGATGG + Intergenic
1171177978 20:23068386-23068408 ATGGGCAAAGAGAAACAAGAGGG + Intergenic
1172271308 20:33657174-33657196 CTGGCCAAGTAGCAATAATTTGG - Exonic
1172820019 20:37724323-37724345 TTGGGAAGGAAGAAATAAGAAGG + Intronic
1174860318 20:54085220-54085242 CTGGGCCAGGAGAAATGAGCTGG - Intergenic
1175613159 20:60368985-60369007 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1176511117 21:7748876-7748898 CTGGGCAGGAAGAAAGAAGCAGG - Intronic
1177304213 21:19291733-19291755 ATGGGTAAGTCTAAATAAGAAGG - Intergenic
1178160132 21:29902831-29902853 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1178645231 21:34379405-34379427 CTGGGCAGGAAGAAAGAAGCAGG - Intronic
1182087470 22:27571264-27571286 CTGAGCCAGAAGAAATGAGAGGG + Intergenic
1182178101 22:28314413-28314435 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1183279577 22:36924709-36924731 CTGGTCAAGTAGGAAGAAGGCGG - Intronic
1183284036 22:36951596-36951618 CTGGTCAAGTAGGAAGAAGGCGG + Intergenic
1185006908 22:48284386-48284408 CTGGGAAAGAAGAAATAAAATGG + Intergenic
949234174 3:1788753-1788775 CTAGGCATGTAGAAATCAAAAGG + Intergenic
951280658 3:20745127-20745149 TTGGGAAAGTAGAAAAAAAAAGG + Intergenic
952405024 3:32997792-32997814 CTGGGAAAGGAGAACAAAGAAGG - Intronic
952908426 3:38160161-38160183 CTGGGGAAGGGGAAATAAGGAGG + Intergenic
953283184 3:41578773-41578795 CTGGACAAGTGGGAATAATAAGG + Intronic
955475311 3:59330277-59330299 CAGAGCCAGAAGAAATAAGAAGG + Intergenic
955742726 3:62109486-62109508 CTGGGCAAGAAGAACAAAGCTGG - Intronic
955824900 3:62935342-62935364 CTGGACAAGCAGAATTCAGAGGG - Intergenic
958621675 3:96570733-96570755 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
958722533 3:97862206-97862228 ATGAGCAAGTAAAAATAATAGGG + Intronic
958784385 3:98581672-98581694 CTGGACAGGCAGAAATAAAAGGG + Intronic
960656333 3:120008408-120008430 CTGGGCAAGAAGAACAAAGCTGG + Intronic
961907862 3:130281352-130281374 TTGGGCAAGTATTAAGAAGATGG + Intergenic
962068905 3:132012611-132012633 CTGGGCAAATAGAAATTAGCAGG + Intronic
962106533 3:132396034-132396056 CTGGGCAAGGAGAAAAGAGGTGG + Intergenic
962580492 3:136793270-136793292 CTGGGCAAACAGAAAAATGATGG + Intergenic
962914830 3:139891539-139891561 CTGGGCAGGTAGAAGGAAGGAGG + Intergenic
963198194 3:142557655-142557677 CTGGGCTATTAGAGATATGATGG - Intronic
964264574 3:154879677-154879699 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
964265948 3:154895630-154895652 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
965654637 3:170970897-170970919 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
966637496 3:182152139-182152161 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
968323870 3:197795145-197795167 TTGGGCAAGCAGAAACAAGAAGG + Intronic
969100278 4:4763299-4763321 ATGGGCAAATAGAAAGTAGAGGG - Intergenic
970262159 4:14237614-14237636 CTGGGCAAGTTGGAATGGGATGG + Intergenic
971740356 4:30511891-30511913 CTGGGGAAGTTAAAATAAGGAGG - Intergenic
971788936 4:31142352-31142374 TTGGGAAATGAGAAATAAGATGG + Intronic
973313205 4:48731483-48731505 CTGGGCAAGAAGAACAAAGCTGG + Intronic
974584103 4:63847059-63847081 CAGGGCAATTAGACAGAAGAAGG - Intergenic
974641138 4:64632274-64632296 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
974720293 4:65729291-65729313 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
975465076 4:74699556-74699578 CTAGGCAAGAAGAAAAAGGAAGG - Intergenic
975807035 4:78123418-78123440 CTGGGCAAGAAGAACAAAGCTGG - Intronic
976093213 4:81478644-81478666 CTGGGCAAGAAGAACAAAGCTGG + Intronic
976229937 4:82832107-82832129 CTGGGCAAGAAGAACAAAGCTGG + Intronic
976862003 4:89676640-89676662 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
976947298 4:90786143-90786165 CTGGGCAGATAGAAAGACGATGG + Intronic
978967973 4:114766076-114766098 TTGGGCAAATTGAAATAAGTTGG + Intergenic
980426477 4:132633272-132633294 CAGGGCAATTAGACAGAAGAAGG - Intergenic
980803962 4:137788343-137788365 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
980938934 4:139254178-139254200 CTGAGCAAGGAGACAGAAGATGG + Intergenic
981160121 4:141487827-141487849 CCTGGCAAGTAAAAAAAAGATGG + Intergenic
982118690 4:152118674-152118696 CTGGGAAGGTAGCAATGAGAAGG - Intergenic
982627885 4:157790794-157790816 AAGGGAAAGGAGAAATAAGAAGG - Intergenic
983319103 4:166172702-166172724 TTGGGCAAGAAGCAATATGAAGG - Intergenic
983390468 4:167124394-167124416 GTGGGGAACAAGAAATAAGAGGG - Intronic
983788471 4:171763620-171763642 CTGGGCAAGAAGAACAAAGTTGG + Intergenic
983878962 4:172911576-172911598 CTGGGCATGTTGAACTAAAATGG - Intronic
984277245 4:177625949-177625971 TTGTGCAAGGATAAATAAGAAGG - Intergenic
986599803 5:9461426-9461448 CTGGGCCATTAGTAATAACAGGG - Intronic
987295943 5:16551491-16551513 CTGGGCAAGTAGAAATAAGAAGG - Intronic
987944356 5:24585218-24585240 CTGGGCAAATGAGAATAAGATGG - Intronic
988164824 5:27573659-27573681 GTGGGCAAAAAGAAATAATAAGG + Intergenic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
989473235 5:41845233-41845255 CGAGGCAAGTGGAGATAAGAGGG - Intronic
989952219 5:50312811-50312833 TTGGGCTGGTAGAAATAATATGG - Intergenic
990351606 5:54922654-54922676 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
990746487 5:58964220-58964242 CTGGGAAACTAGAAATGGGAAGG - Intergenic
991131696 5:63130199-63130221 CTGGGTAAGCAGATATAGGATGG - Intergenic
991628715 5:68632175-68632197 CTGTTCAAATAAAAATAAGATGG + Intergenic
991961933 5:72053641-72053663 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
992435575 5:76752634-76752656 GTGGCCAAGAAGAAAAAAGATGG - Intergenic
992756895 5:79915646-79915668 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
994110765 5:96001357-96001379 CTGGGGAAGAAGAATCAAGAAGG + Intergenic
995112497 5:108443194-108443216 CTGGGCAAGAAGAACAAAGATGG + Intergenic
995642555 5:114274278-114274300 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
996146777 5:119986594-119986616 CTGGGCAAGAAGAACAAAGTTGG - Intergenic
997378589 5:133418210-133418232 CTGATCAAGAAGAAAAAAGATGG + Intronic
998404501 5:141866472-141866494 CTGGGCAGGGAGAAACATGAGGG + Intronic
998723974 5:144987832-144987854 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1000757267 5:165176712-165176734 CTGGGAGAGTAGAAATTTGAAGG - Intergenic
1001726706 5:173908745-173908767 CTAGGAAAGTAGAAAAATGAAGG + Intronic
1002686279 5:181013195-181013217 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1005009130 6:21319345-21319367 CTGGGCAAGAAGAACGAAGCTGG + Intergenic
1006041992 6:31263842-31263864 CTGGGCAAGAAGAAAAAATATGG + Intergenic
1006549288 6:34807578-34807600 CTGGGCCAGTTGAAAGAACAAGG - Intronic
1007343455 6:41208896-41208918 CAGGGGAAGTAGATCTAAGAGGG + Intergenic
1007397475 6:41585956-41585978 CTGGGCAAGTCATAAGAAGAAGG - Intronic
1008069874 6:47088553-47088575 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1008269823 6:49478070-49478092 CTGTGAAAGTAAAAATAAGGAGG - Intronic
1009577734 6:65488676-65488698 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1010537640 6:77050684-77050706 CTGGGCAAGAAGAATAAAGCTGG + Intergenic
1010838314 6:80616752-80616774 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1011062593 6:83288596-83288618 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1011199441 6:84819012-84819034 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1011228429 6:85133591-85133613 ATGGGCTAATAGAAAAAAGAAGG + Intergenic
1011591302 6:88972810-88972832 CTGGGCAAAAAGAAAAAAAAGGG - Intergenic
1011985243 6:93435604-93435626 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1012766386 6:103371585-103371607 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1012878841 6:104761248-104761270 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1013657042 6:112256805-112256827 CTGGGCAGGCAGACAGAAGAGGG - Intergenic
1014235037 6:118944370-118944392 CTGTGAAAGTAGTACTAAGAGGG + Intergenic
1015041025 6:128718881-128718903 ATAGGCAAGTATAAATAAGCAGG + Intergenic
1016544139 6:145201704-145201726 CTGGGAAAGAAGAAAGAAGAAGG - Intergenic
1017262288 6:152401529-152401551 ATGGGCAAATAGAAAGAGGAAGG + Intronic
1018540588 6:164875391-164875413 CTGGGTAAAAAGAAATAATAAGG + Intergenic
1018590552 6:165416236-165416258 CTGGCCAAGTAGCAAGAACAGGG - Exonic
1020429053 7:8100826-8100848 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1020574004 7:9902545-9902567 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1020810394 7:12844228-12844250 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1021158548 7:17242699-17242721 CTTGGCTGTTAGAAATAAGACGG + Intergenic
1021757291 7:23864887-23864909 GGGGGCAAGGAGAAAAAAGAGGG - Intergenic
1023744277 7:43308456-43308478 CTGGGAAATTAAAAATAAAAAGG + Intronic
1027133690 7:75609491-75609513 TTTGGAAAGTAGAAAGAAGAGGG - Intronic
1027900018 7:84100973-84100995 ATGGGGAAGTAGAAATAGCAGGG - Intronic
1028140201 7:87265050-87265072 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1028295082 7:89119385-89119407 CTGGCCAAATAGAGATAAGAGGG - Intronic
1028742255 7:94288957-94288979 CTGGGGGAGGAGAAAAAAGAAGG + Intergenic
1029371066 7:100151018-100151040 CTGGGCAAGTGGTGGTAAGAAGG + Intronic
1034782677 7:153895223-153895245 CAGGGCAAGTAGAAACAAGGAGG + Intronic
1036438519 8:8758750-8758772 CTGTGAAAGTGGAAATGAGATGG - Intergenic
1036547142 8:9782802-9782824 CTAGGCATGGAGAAAGAAGAGGG - Intergenic
1037737255 8:21577653-21577675 CTTGGGAAATAGAAATGAGAAGG + Intergenic
1038706880 8:29902585-29902607 CGGGAAAAGTGGAAATAAGATGG + Intergenic
1039145596 8:34443047-34443069 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1039408317 8:37331341-37331363 CTGGGCACTTAGAAACAAGGGGG + Intergenic
1039810932 8:41047695-41047717 CTGGGTGAGAAGAAATAAAAAGG + Intergenic
1040670226 8:49680760-49680782 ATGGGGAAGTAGAATTAACAGGG + Intergenic
1041575139 8:59385529-59385551 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1041689343 8:60673913-60673935 CTGGGCTAATAGAGATAAAATGG + Intergenic
1041871067 8:62634885-62634907 CAGGGAAAGTAGAAAGAAGGAGG + Intronic
1041995397 8:64050681-64050703 CTGAGCAAGTAGAACAAAGCTGG + Intergenic
1043107517 8:76133705-76133727 CTGGGCCAGTAGATTTAAAATGG + Intergenic
1043796770 8:84552234-84552256 CTGAGAAAATACAAATAAGATGG + Intronic
1043929925 8:86079028-86079050 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1044022063 8:87117075-87117097 ATGTTCAAGTAGATATAAGATGG - Intronic
1045572721 8:103386182-103386204 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1046379144 8:113431414-113431436 TTGGGAAATTAGAAATAAAATGG - Intronic
1046716864 8:117577484-117577506 CTGGGTAAGAAGAAATAATTGGG - Intergenic
1046887283 8:119381361-119381383 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1047604540 8:126461952-126461974 CTGGGCAAGAAGAATAAAGCTGG + Intergenic
1048083126 8:131150076-131150098 ATGGGCAAGTTGAAATAACCTGG + Intergenic
1048396770 8:134021414-134021436 CTGGGCACTTAAAAATAAGATGG - Intergenic
1048985149 8:139731095-139731117 CTGGGCAGGCAGAACCAAGAGGG + Exonic
1050153539 9:2641708-2641730 TTAGGCAAATAGAAATAAGAAGG + Intronic
1050365584 9:4870584-4870606 CTGGGCTTCTAGAAATTAGAGGG + Intronic
1050438384 9:5633261-5633283 CTGGGAAAATACAAATAAAATGG - Intronic
1050964848 9:11786628-11786650 CTGGAGAAGTAGAAATAATATGG - Intergenic
1051005699 9:12340748-12340770 ATGGGGAAGTAGAAATAGGCTGG - Intergenic
1051354360 9:16228016-16228038 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1052087717 9:24288913-24288935 CTGGGCAAAAAGAAATAAAATGG - Intergenic
1052104004 9:24488779-24488801 CTGGGAAAGGGGAAAAAAGATGG + Intergenic
1052361477 9:27565281-27565303 CTGGGCAAACAGAAAAAAAAAGG + Intronic
1052697746 9:31899849-31899871 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1057414166 9:94846603-94846625 CTGGGCAAAGAGAAAGAAGCTGG + Intronic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1061228607 9:129297542-129297564 CTGGGCAAGAAGAACAAAGCCGG - Intergenic
1061386914 9:130295825-130295847 CAGGGCAAGTAGGAGGAAGATGG - Intronic
1185637298 X:1562172-1562194 CAGGGAAAGTAGAGATGAGAAGG - Intergenic
1186341695 X:8652357-8652379 GTTAGCAAGAAGAAATAAGAGGG + Intronic
1186661336 X:11670266-11670288 TTGGGCAAGTGAAAATAGGATGG - Intergenic
1187247945 X:17570110-17570132 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1187348342 X:18488505-18488527 CTGGTCAACCAGAAAGAAGAAGG + Intronic
1187729993 X:22242980-22243002 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1188004592 X:25008296-25008318 CTGGGCGCATAGAAATCAGAGGG + Intronic
1188008262 X:25032929-25032951 CTGGGCTACTAAAAATAAAAAGG - Intergenic
1188485926 X:30682203-30682225 CTGGGCAATGAGAAATTAGATGG + Intronic
1189070874 X:37862496-37862518 CTGGGCAGGGGGAAATAAGCAGG + Intronic
1189592020 X:42523576-42523598 CTGGGCAAGTACAGGTGAGAGGG + Intergenic
1190575855 X:51837220-51837242 CTGGGCAAGATGGAATAACAGGG - Intronic
1190621393 X:52290011-52290033 CTGGGCAAAAAGAAAAAAGCTGG - Intergenic
1190693180 X:52929302-52929324 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1191824587 X:65351022-65351044 CTGGGCAAGAAGAAAAAAGCTGG + Intergenic
1192957212 X:76084932-76084954 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1193079769 X:77394893-77394915 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1193225440 X:78977204-78977226 CTGGGCAAATAGCAAAATGAAGG - Intergenic
1193477656 X:81986291-81986313 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1193512216 X:82417022-82417044 CTGGGAGAGTAAAAATAAAAAGG + Intergenic
1193734353 X:85138918-85138940 GTAGGCAAGAAGAAATGAGATGG + Intergenic
1194036450 X:88879322-88879344 CCAGGCAAGGAGAAATAATAGGG + Intergenic
1194118508 X:89932935-89932957 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1195309430 X:103616446-103616468 CTGGGCTAGTACAAATTTGAGGG - Intronic
1195414648 X:104606938-104606960 CTGGGCAAGAAGAATAAAGTTGG + Intronic
1195622470 X:106971015-106971037 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1195920003 X:109974263-109974285 CTGAAAAAGTAGAAAGAAGATGG - Intergenic
1196155131 X:112420105-112420127 CTGGGGAAGAAGATATAACAGGG - Intergenic
1196159431 X:112466517-112466539 CTGGGCAAGAAGAACAAAGATGG + Intergenic
1196312803 X:114188169-114188191 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1196589006 X:117463644-117463666 CTGGGCAAGAAGAACCAAGCTGG - Intergenic
1196979537 X:121196239-121196261 TTGGGGAAGTATAAATTAGAAGG - Intergenic
1197594033 X:128445231-128445253 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1197944743 X:131827006-131827028 CTGGGCAAGTAGAATTCAGGTGG + Intergenic
1198072575 X:133164054-133164076 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1198116929 X:133553228-133553250 TTGGCCAAGTCGAATTAAGAAGG + Intronic
1199058975 X:143330513-143330535 CTGGGCAAAAAGAAAAAAGAGGG - Intergenic
1200471389 Y:3590501-3590523 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1201041665 Y:9839717-9839739 CAGGGCAATTAGAAAGGAGAAGG - Intergenic