ID: 987300056

View in Genome Browser
Species Human (GRCh38)
Location 5:16589249-16589271
Sequence GATTATAATCCCACTGGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987300046_987300056 29 Left 987300046 5:16589197-16589219 CCCAGTTTATTTGGATACATTCA 0: 1
1: 0
2: 1
3: 15
4: 196
Right 987300056 5:16589249-16589271 GATTATAATCCCACTGGGTGCGG 0: 1
1: 0
2: 0
3: 6
4: 108
987300047_987300056 28 Left 987300047 5:16589198-16589220 CCAGTTTATTTGGATACATTCAA 0: 1
1: 0
2: 1
3: 13
4: 217
Right 987300056 5:16589249-16589271 GATTATAATCCCACTGGGTGCGG 0: 1
1: 0
2: 0
3: 6
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987300056 Original CRISPR GATTATAATCCCACTGGGTG CGG Intronic
901617894 1:10556313-10556335 GATCAGAATTCCACAGGGTGGGG + Intronic
902621678 1:17654519-17654541 GATTAGAATCCCTGTGGGTGGGG - Intronic
903673770 1:25051961-25051983 TATTATGATCCCCCTGTGTGGGG + Intergenic
904825077 1:33269026-33269048 GATTAGGATCCTACAGGGTGGGG - Intronic
908796620 1:67836223-67836245 GTTTTGAATGCCACTGGGTGAGG - Intergenic
909935506 1:81545988-81546010 GTTTATCCTGCCACTGGGTGCGG + Intronic
913370211 1:118090622-118090644 GATTATAATCCCAGTGCTTTAGG + Intronic
913553915 1:119944561-119944583 GATTATAATGCCTGTTGGTGTGG - Intronic
917740070 1:177953294-177953316 GATGACACTTCCACTGGGTGTGG - Intronic
922391771 1:225151000-225151022 GCTTTTTATCTCACTGGGTGTGG - Intronic
1068674407 10:59755190-59755212 GAATAACATTCCACTGGGTGAGG - Intergenic
1069149310 10:64936575-64936597 TTTTGTAATCCCACTGGGTTCGG - Intergenic
1072740973 10:97909205-97909227 CATTTGAAACCCACTGGGTGGGG - Intronic
1073519920 10:104118727-104118749 GATTAAAATCCACTTGGGTGAGG - Intergenic
1087462680 11:98464564-98464586 GATTATAATCCAACTTCTTGAGG + Intergenic
1089513419 11:119016026-119016048 GCTTATAATCCCACTGCTTTGGG + Intronic
1090311031 11:125740156-125740178 GATTTTAGTCCCTCTGTGTGAGG + Intergenic
1092916089 12:13190525-13190547 AACTATAAACCAACTGGGTGTGG - Intergenic
1096049479 12:48594583-48594605 CATCATGATCCCACTGGTTGAGG - Intergenic
1097576711 12:61402750-61402772 TATTGTAATCCCACTGTGAGGGG - Intergenic
1097776809 12:63656653-63656675 AATTAGAATCCCAGTGGGAGAGG - Intronic
1097914612 12:65007073-65007095 GATTAGAAGACCTCTGGGTGTGG - Intergenic
1103633594 12:122283734-122283756 AATTAGAATCCGGCTGGGTGCGG - Intronic
1107384024 13:39888940-39888962 GAATTTCATGCCACTGGGTGTGG + Intergenic
1108117962 13:47150668-47150690 GATTATTATCCATCTGAGTGTGG + Intergenic
1109162653 13:58994686-58994708 GATTATATTACCATTGAGTGAGG - Intergenic
1111345833 13:86952540-86952562 GATTATAATATGACTTGGTGAGG + Intergenic
1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG + Intronic
1120524330 14:85560158-85560180 GATTTACATCCTACTGGGTGAGG + Intronic
1128333152 15:66769480-66769502 GATGAAATTCACACTGGGTGGGG + Intronic
1129436184 15:75542476-75542498 GATTAATATCCCACTGGGAACGG + Intronic
1129741421 15:77991443-77991465 GGTTATGATCCCAGTGGGGGAGG + Intronic
1129798413 15:78395443-78395465 GATTACAAGCCCACTGGGGAGGG + Intergenic
1129844242 15:78760964-78760986 GGTTATGATCCCAGTGGGGGAGG - Intronic
1130117213 15:81015571-81015593 GATCATAATCACATTGGATGGGG + Intronic
1133120819 16:3606133-3606155 GTCTGTAATCCCACTGGCTGGGG + Intronic
1142516227 17:431250-431272 GATTATAATCCCCACAGGTGGGG - Intergenic
1143192274 17:5048692-5048714 GTTTTTAATTCCACAGGGTGAGG + Intronic
1144383631 17:14728118-14728140 GATTATAACCAAACTGGGTAGGG - Intergenic
1148505221 17:48121872-48121894 GAACATCATCCCACTGGGAGTGG + Exonic
1148962509 17:51405264-51405286 AATTAAAATCCCAGTGGGTGTGG - Intergenic
1152978008 18:242546-242568 GATAATATTCCCATTGGATGGGG + Intronic
1157486296 18:48089872-48089894 GTTTAAAAGCCCGCTGGGTGAGG + Intronic
1160025887 18:75215820-75215842 GGTTGTAATCCCACGGGGAGGGG + Intronic
1165435685 19:35793467-35793489 GATTTTGATCCCCCTGGGTTGGG - Intergenic
1166866276 19:45839544-45839566 GATGTTAAAACCACTGGGTGAGG + Intronic
931693382 2:64854194-64854216 GAAAAAAATCCAACTGGGTGTGG + Intergenic
931825999 2:66001774-66001796 AGTCAAAATCCCACTGGGTGGGG - Intergenic
937097016 2:119242083-119242105 GATTGTAAGCCCTCAGGGTGGGG + Intronic
940883831 2:158971232-158971254 GATTATAGTTCCACTGGCTCAGG - Intronic
941332698 2:164198449-164198471 GATTAGAATACCAATGAGTGGGG + Intergenic
945371988 2:209030239-209030261 GGTAACAATCCCACTGGGGGAGG + Intergenic
946128892 2:217589803-217589825 GATTATAATATATCTGGGTGTGG + Intronic
1175767357 20:61600639-61600661 GATTTTAATACCCCTGGGGGCGG - Intronic
1175807025 20:61835410-61835432 GATGACAATTCCACTGGGTGTGG + Intronic
1178815515 21:35925600-35925622 GGTGTTAATGCCACTGGGTGAGG - Intronic
1181004327 22:20003526-20003548 GAGTAAAATCCCACTTGGTTAGG - Intronic
1181827258 22:25527356-25527378 GAATAAAATCCCAGTGGGTCAGG + Intergenic
950496235 3:13336066-13336088 GACTCTGTTCCCACTGGGTGGGG + Intronic
954851351 3:53603648-53603670 GTTTATAATCCCACTTCATGTGG + Intronic
956098101 3:65738434-65738456 GCTTATAATCCCAGTGCTTGGGG - Intronic
957431043 3:80107059-80107081 GAAGGTAATCACACTGGGTGAGG - Intergenic
962221442 3:133567611-133567633 GAGAATAATCCGGCTGGGTGAGG + Intergenic
965507850 3:169535688-169535710 GATTATAATCTCACTGGAGAAGG + Intronic
969465524 4:7354131-7354153 CATTACAATGCCACAGGGTGGGG - Intronic
975740459 4:77424626-77424648 TATTCTCATCACACTGGGTGAGG + Intronic
975826172 4:78321551-78321573 GATTAGAATCTGACTGGGTTCGG + Intronic
975909907 4:79255144-79255166 GATAATGATCACACTGGGGGTGG + Intronic
977532900 4:98221151-98221173 TATTATAATCCGGCTGGGCGTGG + Intergenic
987300056 5:16589249-16589271 GATTATAATCCCACTGGGTGCGG + Intronic
987568228 5:19621466-19621488 GATTATAATTCTATTGGATGTGG - Intronic
993036812 5:82768201-82768223 AATTATAATCCCACGTGTTGAGG + Intergenic
993571511 5:89545684-89545706 TATGAGAATCCCACTGGATGGGG - Intergenic
1000372442 5:160550035-160550057 GAATATAAACCCACTGGGCTGGG - Intergenic
1000911918 5:167032581-167032603 GTTTATAAGCAGACTGGGTGAGG + Intergenic
1004827962 6:19444633-19444655 CATTATAATCTCACTGATTGTGG + Intergenic
1010239955 6:73606165-73606187 GACTATAATCCCACTGACTCAGG - Intronic
1010635792 6:78257699-78257721 GCCTATAATCCCACTGTTTGGGG - Intergenic
1010759800 6:79709658-79709680 AATTATAATCCCACATGTTGGGG - Intergenic
1011469922 6:87698213-87698235 GTTTATAATACCCCTGGGTATGG - Intronic
1013322274 6:109005783-109005805 GATTATAATCCCACATAGTTGGG - Intronic
1015497819 6:133899157-133899179 GATAATAATACCTCTGGGTCAGG - Intergenic
1016905661 6:149148247-149148269 GATTAGAATCCCTTTGGGTACGG + Intergenic
1017646647 6:156545347-156545369 CATTATAGTCCTACTGGGTGGGG + Intergenic
1019891853 7:3953943-3953965 GATTATAATCCCACGCCCTGTGG + Intronic
1022361613 7:29665126-29665148 AATTAGAATCCCAGTGGGAGAGG + Intergenic
1022699773 7:32748595-32748617 AATTAGAATCCCAGTGGGAGAGG - Intergenic
1023246144 7:38206385-38206407 GTATATAATCCCACAGGGAGAGG + Intronic
1023850850 7:44149495-44149517 AATTATAATCCTGATGGGTGAGG + Intronic
1023956392 7:44890113-44890135 AATAATAATCCGGCTGGGTGTGG - Intergenic
1025750608 7:64290689-64290711 GATTATAATGCCATTGGGCCAGG - Intergenic
1026823466 7:73565607-73565629 GATTATAATCCCAGTGCTTTGGG - Intergenic
1029831683 7:103267046-103267068 AATTAGAATCCCAGTGGGAGAGG - Intergenic
1035869687 8:3124039-3124061 GATTCTAAGCCCAATGGCTGCGG + Intronic
1036147348 8:6266502-6266524 GCTCAGAATCCCCCTGGGTGGGG + Intergenic
1037212893 8:16413787-16413809 CTTTATAAACCCAGTGGGTGTGG - Intronic
1037410024 8:18586527-18586549 GATTGTTATTCCAGTGGGTGGGG + Intronic
1037997005 8:23359957-23359979 GTATCTAATCCCATTGGGTGAGG + Intronic
1044361785 8:91294279-91294301 CATAACAATCCCATTGGGTGAGG + Intronic
1045023805 8:98067173-98067195 GCTTATAATCCCAATGGCTCTGG + Intronic
1047818030 8:128486444-128486466 GGATATAATGCCACTGGGTGTGG + Intergenic
1048767730 8:137862885-137862907 GATCAGCATCCCACTTGGTGGGG - Intergenic
1051735087 9:20189792-20189814 GATTATGATCCCCCTGGAAGAGG + Intergenic
1054979613 9:71189815-71189837 GTATATAATCCCATTGGATGGGG - Intronic
1055141742 9:72884106-72884128 GAATATAGTCCCTCTGGGTGTGG + Intergenic
1056848072 9:90057635-90057657 AAATAAAATCCCACTGGGGGGGG - Intergenic
1059566596 9:115388552-115388574 GATTATAATAAGGCTGGGTGTGG + Intronic
1059832217 9:118109908-118109930 GATCAGAATCCCACTGAGAGGGG + Intergenic
1061839316 9:133348392-133348414 GATTAGAGCCCCACTTGGTGTGG + Intronic
1186171038 X:6877216-6877238 GCTTATAATCCCAATGCTTGGGG - Intergenic
1193751208 X:85346476-85346498 TATTAGAATCACAGTGGGTGAGG + Intronic
1196902230 X:120396282-120396304 TATAGTCATCCCACTGGGTGTGG + Intergenic
1201322309 Y:12713656-12713678 GATTAGAATTACACTGGGTTTGG - Intronic
1201492191 Y:14554362-14554384 GATTTTAAATCAACTGGGTGTGG - Intronic
1201587957 Y:15582091-15582113 GAATATGAACTCACTGGGTGTGG - Intergenic