ID: 987301919

View in Genome Browser
Species Human (GRCh38)
Location 5:16605009-16605031
Sequence ATATGCACCTTGGAAAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 348}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987301919 Original CRISPR ATATGCACCTTGGAAAAAAA TGG Intronic
905059597 1:35128320-35128342 AAAAGCCCCTTGGAAAAAACTGG - Intergenic
905415491 1:37800979-37801001 ATATGCATCTGGGAAAAATTAGG - Exonic
905420306 1:37838374-37838396 AAATGCTTCTTGGAAATAAATGG + Intronic
905823974 1:41015586-41015608 ACATGCACCTGGGACAAGAATGG - Exonic
906220592 1:44075651-44075673 ATATGGACCTTGAACAAAATAGG - Intergenic
907349842 1:53819656-53819678 AAATGCTCTTTGCAAAAAAATGG + Intronic
908604951 1:65787665-65787687 AAGTACACATTGGAAAAAAAAGG - Intergenic
908871067 1:68613144-68613166 ATATGCACCTGGCAAATACATGG - Intergenic
909732059 1:78904649-78904671 AAATGCACCTTCAAAATAAATGG + Intronic
911386715 1:97184844-97184866 ATATTTACATTGGAAAAAAATGG - Intronic
912180111 1:107209092-107209114 AAATGCAGCTCAGAAAAAAAAGG - Intronic
913507203 1:119527783-119527805 ACATGTGACTTGGAAAAAAATGG + Intergenic
914017080 1:143829756-143829778 ATGTGGATCATGGAAAAAAATGG + Intergenic
914160706 1:145131242-145131264 ATGTGGATCATGGAAAAAAATGG - Intergenic
914655692 1:149738298-149738320 ATGTGGATCATGGAAAAAAATGG + Intergenic
916718031 1:167461505-167461527 CTATGGAACTTGGAAAATAAGGG - Intronic
917160655 1:172053531-172053553 GTAAGCTCCTTTGAAAAAAAAGG + Intronic
919210899 1:194484672-194484694 ATATGCACCATGGAATACTATGG + Intergenic
919352968 1:196483414-196483436 ATTTGCGACTTGGAGAAAAATGG - Intronic
919883610 1:201916957-201916979 TTGTGAACCTGGGAAAAAAAGGG + Intronic
919891030 1:201974816-201974838 ATCTGCACAATGGAATAAAAAGG - Intergenic
921375581 1:214470379-214470401 AGATGCGCCTAGGAAAAAGAGGG - Intronic
921419969 1:214935021-214935043 TTATGATACTTGGAAAAAAAAGG + Intergenic
921817718 1:219582634-219582656 AAATACAGATTGGAAAAAAAAGG - Intergenic
922006277 1:221533755-221533777 TTATGAATCTTGGAGAAAAATGG + Intergenic
922419652 1:225450994-225451016 GTGTGCACCTTGGTAAAAGATGG - Intergenic
922637095 1:227185226-227185248 TTAGGCACATAGGAAAAAAAGGG + Intronic
923310797 1:232733262-232733284 ATATGCACTTTTAAAAGAAAAGG + Intergenic
1063074853 10:2704817-2704839 ATATACCCCTTGCAAAAAAAGGG + Intergenic
1063194073 10:3723565-3723587 ACATGGATCTTGGCAAAAAATGG + Intergenic
1063420026 10:5904918-5904940 ATATTCACTTTGGAAGAGAATGG - Intronic
1064158944 10:12926979-12927001 ATTTCCATTTTGGAAAAAAAGGG + Intronic
1064956715 10:20919342-20919364 CTATGCACATTGGAAGAATAAGG + Intronic
1065051612 10:21798387-21798409 ATTTCCACCTTGGCCAAAAAGGG + Intronic
1065223546 10:23520353-23520375 ATATGCTCCAAGGAAAAAAGAGG - Intergenic
1065717895 10:28591387-28591409 AAGAGCACCTTGGAACAAAAAGG - Intronic
1067375282 10:45722191-45722213 ATCTACACTTTGGAAAATAATGG - Intergenic
1067378449 10:45750320-45750342 ATTTACACTTTGGAAAATAATGG + Intronic
1067883091 10:50063811-50063833 ATTTACACTTTGGAAAATAATGG - Intergenic
1067886146 10:50091000-50091022 ATTTACACTTTGGAAAATAATGG + Intronic
1070457291 10:76630010-76630032 AAAGGCACCTTAGAAAAGAAAGG - Intergenic
1072033100 10:91539928-91539950 ACATGCACCTTGGGAACAAAGGG - Intergenic
1073697298 10:105884423-105884445 ATATGCAAATATGAAAAAAATGG + Intergenic
1073876509 10:107928664-107928686 ATATAAAGCTTAGAAAAAAATGG + Intergenic
1079019908 11:16901224-16901246 ATATACTCCTTAGAGAAAAATGG + Intronic
1079314676 11:19397657-19397679 AATTGCACCTTGAATAAAAATGG + Intronic
1079870499 11:25793032-25793054 ATAGGCACCTTAAAAAAAACAGG - Intergenic
1080173867 11:29338820-29338842 ATCTTCACCTTGGAAAGGAATGG + Intergenic
1080319348 11:30988405-30988427 CTATTCAGCTTGAAAAAAAATGG + Intronic
1080529054 11:33156330-33156352 ATATGCACCTTGACTAAAATTGG + Intronic
1081107769 11:39093606-39093628 ATATGCACATAGTACAAAAACGG + Intergenic
1081773231 11:45662427-45662449 AAATGCTCCGTAGAAAAAAATGG + Intronic
1085218465 11:74852340-74852362 ATATCCAGCATGGAAAAAAGAGG - Intronic
1085924026 11:80992797-80992819 ATATGCAAAGTGGCAAAAAACGG + Intergenic
1086247091 11:84766266-84766288 AAATGCACCTTGGATGGAAAGGG - Intronic
1086686212 11:89735778-89735800 ATATCTACTTTGGAAGAAAAGGG + Intergenic
1086860778 11:91922605-91922627 AACTTCACCTTGGAAAGAAATGG - Intergenic
1087203096 11:95365785-95365807 GTTTGCACTTTAGAAAAAAATGG - Intergenic
1087324330 11:96702315-96702337 TTATGTTCCTTTGAAAAAAATGG + Intergenic
1087414145 11:97831166-97831188 ATGTGCATCTTGGCAGAAAAAGG - Intergenic
1087605033 11:100366778-100366800 ATATGCACCTGGATTAAAAATGG + Intergenic
1087655257 11:100914926-100914948 ATATGCCTGTTGGAAAAAAAAGG - Intronic
1088498029 11:110452015-110452037 ATATTCATGTGGGAAAAAAAAGG + Intronic
1089892619 11:121896701-121896723 ATATACAAATTGGAAAACAAAGG - Intergenic
1090684829 11:129104181-129104203 ATATGTACCTCAGAAGAAAAGGG + Intronic
1090779591 11:129995631-129995653 ATAAGAATCTTGAAAAAAAAAGG + Intronic
1092593894 12:9978843-9978865 ATATGCCTATTGGAAAGAAATGG - Intronic
1092787598 12:12041957-12041979 ATATTCAGATTGAAAAAAAAAGG + Intergenic
1093096740 12:14980635-14980657 GTATGCACCTTGCCAAAATACGG - Intronic
1093230171 12:16534277-16534299 ATATGCACATTTGAGATAAAAGG + Intronic
1095359673 12:41321140-41321162 ATATGCACTTTTTAAAAATAAGG + Intronic
1095566161 12:43626287-43626309 ATATGCACATTAAAAATAAAAGG - Intergenic
1096065507 12:48736568-48736590 ATAGGCAGTTTGGGAAAAAATGG - Intergenic
1097471593 12:59999667-59999689 AAAAACCCCTTGGAAAAAAATGG - Intergenic
1097484883 12:60183861-60183883 AGATGGACTTAGGAAAAAAAAGG - Intergenic
1098519031 12:71414616-71414638 ATATACACCATGGAATAAAAAGG + Intronic
1098746894 12:74249343-74249365 ATGTGTACATTTGAAAAAAATGG + Intergenic
1098882573 12:75931249-75931271 ATATGTACCTTGGCAGACAAAGG + Intergenic
1099145404 12:79037282-79037304 GTATGTACCTTGAAAAAAAAAGG - Intronic
1099914561 12:88876049-88876071 CTATGCACCCTGGAATAAACAGG + Intergenic
1101016332 12:100504721-100504743 ATATGAACCTGGGAAAGACATGG - Intronic
1101259786 12:103017295-103017317 ATATGAAACTTGAAAAAAAAAGG - Intergenic
1103458114 12:121082800-121082822 ATATGAATCTCAGAAAAAAAGGG + Intergenic
1103607150 12:122095675-122095697 AAATGCAACTTGAAAAGAAAAGG - Intronic
1104078239 12:125409312-125409334 ATTTGCAATTTGGAAAATAAGGG - Intronic
1106367845 13:29100611-29100633 AAATGGACCTTGGAAGAGAAAGG - Intronic
1106501163 13:30330387-30330409 ATATGTACCTTGGGAGCAAAGGG + Intergenic
1106535253 13:30635352-30635374 CTATGCAAATGGGAAAAAAATGG - Intronic
1107391039 13:39964518-39964540 CTATGCACCATGGAAAATCAGGG - Intergenic
1107756339 13:43627146-43627168 ATATGCACATTGAAAATAAAAGG - Intronic
1108890603 13:55253370-55253392 ATCTGCATCTCAGAAAAAAAGGG + Intergenic
1109210022 13:59524522-59524544 ATATGCTACTCAGAAAAAAAAGG - Intergenic
1110020940 13:70471291-70471313 ATATGCCCCTCTGAGAAAAATGG + Intergenic
1110358709 13:74599958-74599980 ATATACACCTTGGAATACTATGG - Intergenic
1110370363 13:74733134-74733156 ATATTCTCCTTGGAATAAAAAGG + Intergenic
1112469796 13:99677025-99677047 CTAAGGACCTGGGAAAAAAAGGG - Intronic
1113189926 13:107733043-107733065 ATCGGCACCCTGGAAAAGAAGGG + Intronic
1113277242 13:108744746-108744768 ATATGAACGTGGGTAAAAAATGG - Intronic
1114947963 14:27710899-27710921 ATTTACCCCTTGGAAGAAAAGGG - Intergenic
1120401374 14:84036748-84036770 ATCTGCATCTTTAAAAAAAAGGG + Intergenic
1120424485 14:84329768-84329790 AGAAGCCCCTGGGAAAAAAAGGG + Intergenic
1120547879 14:85832286-85832308 ATATCGACTTTGGAAACAAAAGG - Intergenic
1121132590 14:91462030-91462052 AAATGTATGTTGGAAAAAAATGG - Exonic
1122004923 14:98694971-98694993 ATATGGACCATGGCCAAAAATGG - Intergenic
1122518571 14:102326375-102326397 GTATGCAAGTTGGAAATAAATGG - Exonic
1122645676 14:103192104-103192126 AGATGCAACTGGGGAAAAAAAGG - Intergenic
1124261000 15:28191049-28191071 ATTTCCACCTAGGAAAAAATGGG + Exonic
1125198429 15:37075654-37075676 ATCTGCACCTTGGAAAAGCAGGG + Intronic
1126481644 15:49129469-49129491 ATAAGTACCTTAGAAATAAAAGG + Exonic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1127651890 15:61017091-61017113 ATATTCAACTTGGAAAAGAAAGG - Intronic
1127824121 15:62688864-62688886 ATATGCAAGTTGAAAATAAAAGG - Intronic
1128939113 15:71772644-71772666 AAATGCAGCTTTGAAAATAATGG - Intronic
1130638805 15:85650946-85650968 CTATGTGCCTTGGAAAATAATGG - Intronic
1131733158 15:95303543-95303565 ATATGAACCTTGGGAATAAAAGG - Intergenic
1134320538 16:13158693-13158715 TTATGGGCCTTGGAAAGAAATGG - Intronic
1134647783 16:15884178-15884200 AAGGACACCTTGGAAAAAAAGGG - Exonic
1136227941 16:28871765-28871787 ATATGCCCCTGGAAAAAAAAAGG - Exonic
1137041707 16:35619103-35619125 AAATTCACTTTGGAAAAGAATGG - Intergenic
1137887894 16:52126356-52126378 ACATTTACCTTGGAAAATAATGG + Intergenic
1138100488 16:54248305-54248327 GTATGCATCTTGGAACAAAGTGG - Intronic
1140974693 16:80047898-80047920 ATATACACCATGGAAAACAGTGG + Intergenic
1141216139 16:82025579-82025601 ATATGATCCTTGGAGAAACAGGG - Intergenic
1148614797 17:48993614-48993636 ATATTCACATTGGAGGAAAATGG + Intergenic
1149073192 17:52568212-52568234 ATTTCCTCCTTAGAAAAAAAGGG - Intergenic
1149100647 17:52902460-52902482 ATATGCACCTTGTAGAAGTAAGG - Intergenic
1149710171 17:58734529-58734551 ATAGGCAACTGGGAAAGAAAGGG - Exonic
1149804773 17:59606011-59606033 AAAAGCCCCTTGGAAACAAAGGG - Intronic
1149836371 17:59916588-59916610 ATATGCCTCTGGGAAATAAATGG - Intronic
1150786178 17:68164677-68164699 ATATCCACTTTGGAAACAAAAGG + Intergenic
1151570734 17:74924150-74924172 AAATTCACCTTGGAGAAAGATGG + Intergenic
1153174746 18:2358036-2358058 ATATGCAGCATACAAAAAAATGG + Intergenic
1155529957 18:26756921-26756943 ATGTTCACCTTGGAAGAAAAAGG - Intergenic
1155643676 18:28051068-28051090 ATATGCATATTGTAAAAAATAGG + Intronic
1156636083 18:39031191-39031213 ATGTGCAACCTGGAAAAAAGAGG - Intergenic
1156719698 18:40054928-40054950 CTCTGCTCCTTGCAAAAAAATGG - Intergenic
1156945446 18:42824512-42824534 TTATGCATCTTTGAGAAAAAAGG - Intronic
1157739248 18:50077726-50077748 AAATGCACTTTGGGAAACAAAGG + Intronic
1158099672 18:53816599-53816621 ATATGTGCCTTTGAAAGAAAGGG - Intergenic
1158773958 18:60554846-60554868 ATATGCAGATTTCAAAAAAAAGG + Intergenic
1159775081 18:72595144-72595166 ATAAGCACCTATGAGAAAAAAGG - Intronic
1163541271 19:17912190-17912212 ATATGCACCAGTGAAAAACAGGG - Intergenic
1165250793 19:34532125-34532147 AAAGGCAACTTGGAAACAAAGGG - Intergenic
1166351428 19:42200216-42200238 ATAAGTGCCTTGGACAAAAATGG - Intronic
1166493581 19:43281719-43281741 ATAGCCACTGTGGAAAAAAATGG + Intergenic
926287305 2:11499767-11499789 ATATGCACATTTTACAAAAAAGG + Intergenic
926448936 2:12978723-12978745 ATATACAAATTGGAATAAAAAGG - Intergenic
927818326 2:26240596-26240618 ATAAGCACCTAAGCAAAAAAAGG + Intronic
929046861 2:37798702-37798724 AAATGTTCCCTGGAAAAAAATGG - Intergenic
929210332 2:39349846-39349868 ATATGTATTTTGTAAAAAAATGG - Intronic
929237550 2:39622473-39622495 ATTTGCACCTTGGGAAACCATGG + Intergenic
930240061 2:48927176-48927198 TTATGCAGCTGGGAATAAAATGG + Intergenic
930445914 2:51472033-51472055 ATCTGCATCTTGAAATAAAAGGG - Intergenic
930593673 2:53358795-53358817 AAATGCATATAGGAAAAAAAGGG + Intergenic
931007682 2:57870602-57870624 AAATGCACCTTACAAAAAACTGG - Intergenic
931999643 2:67872931-67872953 ATATGGGCCATAGAAAAAAAGGG - Intergenic
932445715 2:71779778-71779800 ATATGCACCTGGAAGAAAATAGG - Intergenic
933299925 2:80530142-80530164 AAGGTCACCTTGGAAAAAAAGGG + Intronic
935380069 2:102442645-102442667 ATATTCCTCATGGAAAAAAATGG + Intronic
935787243 2:106560341-106560363 ATAATCACCTGGGAAAAAAGAGG - Intergenic
937488102 2:122336807-122336829 AACTTCAACTTGGAAAAAAAAGG - Intergenic
938306810 2:130262296-130262318 ATATGCACATTGGAAATAACAGG + Intergenic
938307729 2:130266397-130266419 AGATGGACCCTGGAAGAAAAAGG - Intergenic
938447609 2:131390444-131390466 AAATGGACCCTGGAAGAAAAAGG + Intergenic
938912289 2:135897224-135897246 ATATGCACCTGGGAAAAAGTAGG + Intergenic
939159087 2:138564621-138564643 ATTTGCAACTTGGAAAATAAGGG - Intronic
939418828 2:141938808-141938830 ATATTCAACTTTGAAAAAGAAGG + Intronic
940430646 2:153586201-153586223 ATATTCACCTTGAATATAAATGG + Intergenic
940741373 2:157513023-157513045 ATAAGCCCCTGGAAAAAAAAGGG - Intergenic
940775634 2:157880783-157880805 GTATGTACCTTTTAAAAAAAAGG - Intronic
941019543 2:160393195-160393217 AAATGCACCTGGAAGAAAAATGG + Intronic
941322896 2:164077459-164077481 AGTGGCACCTTGGAAAATAAAGG - Intergenic
941883688 2:170506858-170506880 AAATGCACCATTGAAAGAAAAGG + Intronic
942736620 2:179121769-179121791 ATATGCAGCTTAGAAAACAAAGG - Exonic
942752187 2:179300608-179300630 ATTTGCAACTTGAAAAAAATAGG + Intergenic
943071383 2:183144448-183144470 AAATGAAACTTGGAAAAAAGAGG - Intronic
943508862 2:188799640-188799662 ATATGCAACTAGGGAAAATATGG + Intergenic
943852227 2:192738594-192738616 ATATGAAGCATGGAACAAAATGG - Intergenic
943878824 2:193111533-193111555 ATTTGTACCTTAGAAAAAAAGGG - Intergenic
944285185 2:197941658-197941680 ATTTTCACCTTGGAACAAGAAGG + Intronic
946954807 2:224917589-224917611 ATCTGAACCTTGAAAAAAATAGG + Intronic
947390008 2:229629139-229629161 ATTTGCAGCTTGGAAAACAGAGG - Intronic
948178872 2:235964668-235964690 ATAGATATCTTGGAAAAAAAAGG - Intronic
1169070367 20:2724300-2724322 ATATGCAGCTTTAAAAAATAGGG - Intronic
1169255652 20:4095491-4095513 AAATGCACAGAGGAAAAAAAAGG + Intergenic
1170322249 20:15112920-15112942 TTATCCAGCCTGGAAAAAAAAGG - Intronic
1174946075 20:54987225-54987247 ATATCCAGTTTGGAAACAAATGG + Intergenic
1175532537 20:59684038-59684060 ATGAGAACCTTGGAAAGAAAGGG + Intronic
1177618569 21:23557152-23557174 TTATGCAGCTTGCACAAAAACGG - Intergenic
1177646374 21:23904249-23904271 ACATGCACCTAGAAATAAAAGGG + Intergenic
1178621435 21:34180508-34180530 GTCTGCACTTTGGAAAGAAAGGG - Intergenic
1178853591 21:36232986-36233008 ATCTGCAGCTTGCCAAAAAAAGG - Exonic
1180521701 22:16214525-16214547 ATATGCACATTTGAACAAGATGG - Intergenic
1181963556 22:26640508-26640530 ATATGCACAATGGCTAAAAAAGG - Intergenic
1182209283 22:28660934-28660956 CTATGCAACTTTGAAATAAAGGG - Intronic
1183572033 22:38660682-38660704 CTATGCACCTTGGGAAAATTGGG + Intronic
1184963420 22:47948578-47948600 AAATGAATCTTGGAGAAAAATGG - Intergenic
949906712 3:8864109-8864131 ATTTGCACCTAGGAAAGGAAGGG + Intronic
951684199 3:25326096-25326118 ATCTCCCCCTTGGAAAGAAAGGG + Intronic
951797636 3:26558452-26558474 AAATGCACCCTGGAAATACAGGG - Intergenic
951869646 3:27347029-27347051 ATTTGTACTTTGGAAAAAACAGG - Intronic
952000906 3:28784915-28784937 ATATTCACCTGAGAAAAAATGGG + Intergenic
952483279 3:33784222-33784244 ATTTGCAACTTGAAAAATAAAGG + Intergenic
955770163 3:62377781-62377803 ATTTGCACCACGGAAGAAAAAGG + Intergenic
957213261 3:77288742-77288764 ATATGTACTGGGGAAAAAAAAGG + Intronic
957423933 3:80010747-80010769 ACATTCACCTTGTGAAAAAAGGG - Intergenic
957463248 3:80550778-80550800 ATAAGCATGTTGGAATAAAATGG - Intergenic
957475288 3:80714548-80714570 ATATACACCATGGAACAGAACGG + Intergenic
957662534 3:83179294-83179316 ATATGCTGCTTGGAAATCAAAGG - Intergenic
957717764 3:83953064-83953086 AAATACATCTAGGAAAAAAATGG - Intergenic
957853517 3:85843145-85843167 AAATGCATTTTGGAAAAACATGG + Intronic
958666208 3:97140828-97140850 ATATTAACCTTGAAAATAAATGG + Intronic
958863421 3:99471546-99471568 ATCTCAACCTTTGAAAAAAAAGG + Intergenic
959362961 3:105417919-105417941 ATATTCATTTTTGAAAAAAAGGG - Intronic
960454315 3:117851944-117851966 ATATGCACATTAGAAATGAAAGG + Intergenic
962819771 3:139037219-139037241 AGAGGCACCTTAGAAAAAAATGG - Intronic
963207011 3:142646975-142646997 TTATGTACCTTAGAAAAGAAGGG - Intronic
964010157 3:151883502-151883524 ATATGTACCTTGTAAACAAGAGG + Exonic
964229904 3:154453793-154453815 ATATGCACCTTGGAATAACGTGG - Intergenic
964980473 3:162671042-162671064 ATAAGCACGTTGAAAGAAAAAGG - Intergenic
965107971 3:164382890-164382912 AAAAGCACCTTGGAAAACATAGG + Intergenic
965124506 3:164608165-164608187 ATTTGCACTATGGAATAAAAAGG + Intergenic
965642757 3:170848011-170848033 AGATGAACCTGGGAAAAATAGGG + Intronic
965834486 3:172836800-172836822 ATTTGCACCTTTTAAAAACACGG + Intergenic
966109056 3:176375103-176375125 AAATGCAGCTGGTAAAAAAATGG - Intergenic
966407645 3:179614930-179614952 ATATGAACCTTGTATAAAACAGG + Intronic
966493864 3:180557544-180557566 ACAAGAACCTTGAAAAAAAAAGG + Intergenic
966836039 3:184050190-184050212 ATAGGCGCCCTGGAAAAAAATGG - Intergenic
967348723 3:188488378-188488400 AGATGCAACTTGGAAAACAGGGG + Intronic
969783276 4:9429323-9429345 ATATACACCTTGGAGGAAATAGG - Intergenic
971331772 4:25687549-25687571 ATATCGACTTTGGAAACAAAAGG - Intergenic
972091052 4:35284199-35284221 ATAATCACATTGAAAAAAAATGG - Intergenic
973134048 4:46683814-46683836 ATATGCATATTGGAGAAAAATGG - Intergenic
973817204 4:54630154-54630176 ATATTCTCCTTGGTAAAATAAGG + Intergenic
974065768 4:57075749-57075771 ATTTTCACATTTGAAAAAAAAGG + Intronic
974788798 4:66658163-66658185 ATAAGCTACTCGGAAAAAAAAGG + Intergenic
975057932 4:69958587-69958609 ATATCCACCTTGGAAATAAGAGG + Intronic
975172396 4:71246986-71247008 ACATGCACCCAGGAAAAAGAGGG - Intronic
975310995 4:72903854-72903876 ATATGCACAGAGGAAAAATAAGG - Intergenic
975398031 4:73900439-73900461 ATATATACCTTGGAGAGAAATGG + Intergenic
975472050 4:74781178-74781200 AAATGGAGCTTGGAAAAAAGTGG - Intronic
975540903 4:75510930-75510952 ATATGTACACTGGAAAAGAAAGG + Intronic
976700344 4:87963358-87963380 AAATGCATTTTTGAAAAAAAAGG - Intergenic
977474594 4:97489606-97489628 ATATTCACCTTGGGAAGAAAAGG + Intronic
977713228 4:100150848-100150870 ATATGCACTTTGGAACAAGGAGG - Intergenic
977820786 4:101470831-101470853 ATCAGGACCTTGGAAAAAACAGG + Intronic
977893806 4:102342566-102342588 ATAATTACCTTGGAAAGAAAAGG - Intronic
978679592 4:111363512-111363534 ATAAGCATCTTGGTAAAACATGG - Intergenic
978897137 4:113902779-113902801 ATATACACCAAGGCAAAAAATGG - Exonic
979061850 4:116072857-116072879 ATATGTAACTTGGAAGAAATAGG - Intergenic
979203748 4:118009893-118009915 AAATTCACCTTTGAAAAGAAAGG + Intergenic
979744835 4:124199257-124199279 ATAGGTGCCTTGGAAAATAAAGG + Intergenic
979893038 4:126123515-126123537 CTATATACATTGGAAAAAAAGGG + Intergenic
981237132 4:142431732-142431754 ATATTCACCTTGCCAAAACATGG - Intronic
981709618 4:147696135-147696157 ATAAGTACCTTAGAAAAGAAAGG + Intergenic
982095384 4:151917483-151917505 ATCAGCACTTTTGAAAAAAAAGG - Intergenic
982914213 4:161184822-161184844 AGATGCACCCTGGGCAAAAAAGG - Intergenic
983160105 4:164402785-164402807 AAATGCTCCTTGGAACAAAGAGG + Intergenic
983294954 4:165855220-165855242 TTAATCAGCTTGGAAAAAAATGG - Intergenic
983826851 4:172273174-172273196 ATTTGCACCTTAGAATAAACAGG + Intronic
983972698 4:173893989-173894011 ATATGCAGGTTTGAAAGAAAGGG - Intergenic
985757685 5:1728954-1728976 ATATGCGGCGTGGAAATAAAGGG + Intergenic
986139368 5:5015535-5015557 ATTTTCACCATGGAAATAAAAGG - Intergenic
986904644 5:12480659-12480681 ATTTGCCCAGTGGAAAAAAATGG + Intergenic
987301919 5:16605009-16605031 ATATGCACCTTGGAAAAAAATGG + Intronic
987380503 5:17281057-17281079 ATATGGACCTTAGGAAAAAATGG - Intergenic
988857233 5:35239983-35240005 ATATGCAACTTGACAAAATAGGG - Intergenic
989772270 5:45158766-45158788 ATATACACCATGGAAAAGAATGG - Intergenic
989846175 5:46145282-46145304 ATTTGCATATTGGACAAAAACGG - Intergenic
989850677 5:46205940-46205962 ATATGCAAAATGGACAAAAATGG - Intergenic
990815280 5:59777820-59777842 ATATGCGCTTTTGAAAAAAATGG - Intronic
991313351 5:65270917-65270939 ATATATACATTTGAAAAAAATGG - Intronic
991659626 5:68937064-68937086 AGATGCACACTGGAAATAAAGGG + Intergenic
992428089 5:76679164-76679186 ATATCCACATGCGAAAAAAATGG + Intronic
993230354 5:85227234-85227256 ATATACACCACGGAATAAAAAGG - Intergenic
993351476 5:86855457-86855479 CTCTGCACCTTGGAAAGAACAGG - Intergenic
994150458 5:96441616-96441638 AGTGGCACCTTAGAAAAAAAGGG + Intergenic
994466650 5:100142874-100142896 ATTTGCATATTTGAAAAAAATGG - Intergenic
994822670 5:104674211-104674233 ATATTCAACATGGAAAAATAGGG - Intergenic
995011680 5:107262755-107262777 GTATGAACAATGGAAAAAAAAGG - Intergenic
997558748 5:134825018-134825040 ATAAGCAGCTATGAAAAAAAGGG - Intronic
998790247 5:145758717-145758739 ATCTACAAATTGGAAAAAAAAGG + Intronic
999030708 5:148288006-148288028 CTATTCTCCTTGGACAAAAAAGG - Intergenic
999344484 5:150804098-150804120 ATAAGCTCCTTGCAACAAAATGG - Intergenic
999546620 5:152636242-152636264 AAATGCATCTTTGAAATAAAGGG + Intergenic
1000455255 5:161440831-161440853 ATAGGCACCTTTGTCAAAAATGG - Intronic
1001006231 5:168052847-168052869 GTATGCAAGTTGGAAAAAAATGG + Intronic
1001783749 5:174393669-174393691 AAATATATCTTGGAAAAAAATGG - Intergenic
1003946672 6:11082225-11082247 ATATTTACAATGGAAAAAAAAGG - Intergenic
1004323087 6:14648212-14648234 AGAAGCACCTTGGAGAAAAATGG - Intergenic
1004477527 6:15987731-15987753 ATATGTGCCTTTGAATAAAAGGG + Intergenic
1004559007 6:16729219-16729241 ATATACACCTTGGGAGAATAAGG - Intronic
1007487212 6:42189322-42189344 ATATGCTCCTGGGGAAAAGAGGG + Intronic
1008017586 6:46539126-46539148 ATGTGCACCTTTGAAACATAGGG + Intergenic
1008446367 6:51596894-51596916 ACATACAACTTGGAAAAAAAAGG - Intergenic
1009303204 6:62053242-62053264 CTATGCACCAGAGAAAAAAATGG + Intronic
1009609496 6:65922565-65922587 ATATACACCCTGGAATAACATGG + Intergenic
1009694696 6:67087312-67087334 ATATTAACCTTGGACATAAATGG - Intergenic
1010379678 6:75209692-75209714 ACAAGCCCCTTGGAATAAAAGGG + Intergenic
1011670352 6:89677477-89677499 ATTTGCACATTGCAAAAATAGGG - Intronic
1012809414 6:103938612-103938634 ATATTGACTTTGGAAACAAAAGG + Intergenic
1013884244 6:114942809-114942831 TCATGGACCATGGAAAAAAATGG - Intergenic
1014393816 6:120898787-120898809 ATATTTAACTTGGAAAAAATAGG + Intergenic
1014643396 6:123943232-123943254 ATAAGCACCTTAGAAAAATCTGG - Intronic
1015917180 6:138229080-138229102 CTATGTATCTTGGAAAATAAGGG + Intronic
1016259197 6:142147423-142147445 AAATGCAACTGGGAAAGAAAGGG - Intronic
1016307463 6:142698769-142698791 AGATGCATCTTGGAAATCAATGG - Intergenic
1016884305 6:148944869-148944891 ATATACAGCTTTGAAAAATAGGG + Intronic
1017232568 6:152089198-152089220 ATATGTACATTGCACAAAAATGG + Intronic
1017539085 6:155381471-155381493 ATATACACCTCTGAAAAATAAGG + Intergenic
1020229326 7:6305578-6305600 AGATCCTCCCTGGAAAAAAAGGG - Intergenic
1020656057 7:10929543-10929565 ATATAAAACTTGGAAAGAAAAGG - Intergenic
1020843011 7:13244359-13244381 AGATGCACTATGGAAATAAAAGG - Intergenic
1020858758 7:13461345-13461367 ATTTGCAACTAGTAAAAAAAAGG + Intergenic
1021020253 7:15588818-15588840 ATATGCATTTTGGAAAATAATGG + Intergenic
1021023768 7:15638830-15638852 ATATGCACCATGGAATATTATGG - Intronic
1021189600 7:17604543-17604565 AAAGGCAACTAGGAAAAAAAAGG + Intergenic
1021745369 7:23735451-23735473 ATATGATGCTTGGAAAAAATGGG + Intronic
1022287814 7:28971804-28971826 AAATTCACCTTTTAAAAAAAGGG + Intergenic
1022675054 7:32491644-32491666 ATATACCCATTGGAAAAAATGGG + Intronic
1024280972 7:47719570-47719592 TTATTCACCTTTGAAAAGAAAGG + Intronic
1024432055 7:49300554-49300576 GCATGCTCCTTTGAAAAAAAAGG - Intergenic
1024756495 7:52539390-52539412 ATTTGCACTTTAGAATAAAAAGG - Intergenic
1026636376 7:72085569-72085591 ATATGCCCCTTGGATAAGGAGGG + Intronic
1028816220 7:95148462-95148484 ATTTACACCTTGGAAAAAATTGG - Intronic
1030402276 7:109067063-109067085 ATGTGCTGCTTAGAAAAAAAGGG + Intergenic
1030750034 7:113220676-113220698 ATAAGCAACTTTGAAAAAAATGG + Intergenic
1033518207 7:142130851-142130873 AAATTCTCCTTGGAATAAAATGG + Intronic
1033842994 7:145397714-145397736 ATAAGCACTTTGGAAAGTAAAGG - Intergenic
1033854314 7:145539111-145539133 ATAAGCAATTTTGAAAAAAATGG - Intergenic
1033925019 7:146447914-146447936 ATACGCACATTTGAAAAAATGGG + Intronic
1036835776 8:12064747-12064769 ATATACACCTTGGAGGAAATAGG + Intronic
1036857619 8:12311320-12311342 ATATACACCTTGGAGGAAATAGG + Intergenic
1039095335 8:33878683-33878705 AACTATACCTTGGAAAAAAATGG - Intergenic
1039256564 8:35725345-35725367 ATATTTGGCTTGGAAAAAAATGG + Intronic
1042055968 8:64765310-64765332 AAGTTCACATTGGAAAAAAATGG + Intronic
1042109566 8:65366805-65366827 GTATGCACCTGGAATAAAAATGG - Intergenic
1043345810 8:79296698-79296720 ATTTGCACCTTGGGAAACCACGG - Intergenic
1043605738 8:81997123-81997145 ATATGCACATTTGTAAAAAGTGG - Intergenic
1044160623 8:88910077-88910099 ACAAGGACTTTGGAAAAAAAAGG + Intergenic
1044201454 8:89443106-89443128 ATATCAACTTTGGAAACAAAAGG + Intergenic
1044807051 8:96019063-96019085 ATACACACCTTAGCAAAAAAAGG - Intergenic
1045653472 8:104364330-104364352 AAATTCACCTTGAAAAGAAAAGG + Intronic
1045813596 8:106253707-106253729 ATATGCATCCTGGGAAAAAGAGG - Intergenic
1047256883 8:123220632-123220654 ATATGCTCTTTGAAACAAAAAGG - Intronic
1047808226 8:128380654-128380676 TTGTGCACCCTGGAAAGAAAAGG - Intergenic
1048967087 8:139623265-139623287 ATTTGCAGATGGGAAAAAAATGG - Intronic
1050125361 9:2351831-2351853 ATATGGTCCTTAGAAATAAAAGG - Intergenic
1050224525 9:3437052-3437074 ATTTGCTGCTTGGAAAATAATGG - Intronic
1050347956 9:4711560-4711582 TTAAGTACCTGGGAAAAAAACGG + Exonic
1050385537 9:5086368-5086390 ATCTGCACCATGGAGGAAAAAGG - Intronic
1050439290 9:5643580-5643602 TTAAGCACCTTGCATAAAAAGGG - Intronic
1051146573 9:14033372-14033394 CTATGTACCTTAGAAAAAATAGG - Intergenic
1051847091 9:21464124-21464146 ATATGAACCTTGAAAGCAAATGG - Intergenic
1052031414 9:23633578-23633600 ATATGCACTGTGGATAAAAAAGG - Intergenic
1052120705 9:24713007-24713029 AAATTCAACTTGGAATAAAATGG + Intergenic
1054852151 9:69858283-69858305 ATATGCAGAATGGTAAAAAAGGG + Intronic
1058582831 9:106477729-106477751 ATCTTCACCTTGGCAACAAATGG + Intergenic
1059504798 9:114788764-114788786 ATTTGCTCCTTGGAAACAAATGG + Exonic
1061821455 9:133229064-133229086 AGATTCATCATGGAAAAAAAGGG + Intergenic
1061833984 9:133317299-133317321 AGATTCATCATGGAAAAAAAGGG - Intergenic
1062237791 9:135521000-135521022 AGATTCATCATGGAAAAAAAGGG - Intergenic
1185810356 X:3103140-3103162 TCATGCACCTTGAAAACAAATGG - Intronic
1187308520 X:18119058-18119080 ATGTGTTCCTTGTAAAAAAAAGG - Intergenic
1188268362 X:28106958-28106980 ATATGCAGGTTGGAAACACATGG - Intergenic
1189140442 X:38599771-38599793 ATATGCAACATGGAAGAAACAGG - Intronic
1189342441 X:40214596-40214618 ACATGCACTTTGGAGACAAATGG - Intergenic
1189539427 X:41970926-41970948 ATAAGCTGCTTGGAAAAGAAAGG + Intergenic
1191642674 X:63444799-63444821 AGATGCTCCCTGGAAGAAAAAGG - Intergenic
1193077243 X:77367175-77367197 AACTACACCTTGGAAAATAATGG + Intergenic
1193245913 X:79229502-79229524 ATATGCACCATAGAACAAATGGG - Intergenic
1195131452 X:101857968-101857990 ATATGTACTTTGAAAACAAACGG + Intergenic
1195494628 X:105516189-105516211 ATATGCACCTGGTGAAAACATGG - Intronic
1195534741 X:105998565-105998587 GTATGCACCATGGAATAATATGG + Intergenic
1195903678 X:109823675-109823697 ATATCAACTTTGGAAACAAAAGG + Intergenic
1196009546 X:110872322-110872344 ATATGCACCATGGAAGATCAGGG - Intergenic
1196130968 X:112155769-112155791 ATAAGAACACTGGAAAAAAATGG - Intergenic
1196329594 X:114455425-114455447 ATATACACTGTGGAAAAAAGTGG - Intergenic
1197324683 X:125077802-125077824 ATAAGCACCTTGGACATAAGTGG - Intergenic
1197585304 X:128339508-128339530 ATCTGCAGATTGGAAAAAAGGGG + Intergenic
1199271831 X:145892785-145892807 ATATTAACCTTGAAAATAAATGG - Intergenic
1199732755 X:150652771-150652793 ATATATTCCCTGGAAAAAAATGG - Intronic
1200368257 X:155691258-155691280 ATATCAACTTTGGAAACAAAAGG + Intergenic
1200789389 Y:7286215-7286237 AAGGGAACCTTGGAAAAAAAGGG - Intergenic
1201246230 Y:12006493-12006515 TTATGAGCCTTGGAAAAATATGG + Intergenic
1202069916 Y:20980226-20980248 ATATACACCATGGAATAATATGG - Intergenic