ID: 987303449

View in Genome Browser
Species Human (GRCh38)
Location 5:16617087-16617109
Sequence CCCCAGCCGCCTGTGCCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 321}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987303449_987303464 26 Left 987303449 5:16617087-16617109 CCGCGGGGCACAGGCGGCTGGGG 0: 1
1: 0
2: 1
3: 40
4: 321
Right 987303464 5:16617136-16617158 GGGGAGCCGCCCGGGAAAGTGGG 0: 1
1: 0
2: 0
3: 4
4: 124
987303449_987303463 25 Left 987303449 5:16617087-16617109 CCGCGGGGCACAGGCGGCTGGGG 0: 1
1: 0
2: 1
3: 40
4: 321
Right 987303463 5:16617135-16617157 GGGGGAGCCGCCCGGGAAAGTGG 0: 1
1: 0
2: 2
3: 13
4: 219
987303449_987303458 7 Left 987303449 5:16617087-16617109 CCGCGGGGCACAGGCGGCTGGGG 0: 1
1: 0
2: 1
3: 40
4: 321
Right 987303458 5:16617117-16617139 GACGCCACAGGCCACGGAGGGGG 0: 1
1: 0
2: 2
3: 12
4: 150
987303449_987303457 6 Left 987303449 5:16617087-16617109 CCGCGGGGCACAGGCGGCTGGGG 0: 1
1: 0
2: 1
3: 40
4: 321
Right 987303457 5:16617116-16617138 TGACGCCACAGGCCACGGAGGGG 0: 1
1: 0
2: 0
3: 13
4: 130
987303449_987303462 18 Left 987303449 5:16617087-16617109 CCGCGGGGCACAGGCGGCTGGGG 0: 1
1: 0
2: 1
3: 40
4: 321
Right 987303462 5:16617128-16617150 CCACGGAGGGGGAGCCGCCCGGG 0: 1
1: 0
2: 0
3: 16
4: 193
987303449_987303460 17 Left 987303449 5:16617087-16617109 CCGCGGGGCACAGGCGGCTGGGG 0: 1
1: 0
2: 1
3: 40
4: 321
Right 987303460 5:16617127-16617149 GCCACGGAGGGGGAGCCGCCCGG 0: 1
1: 0
2: 3
3: 14
4: 203
987303449_987303456 5 Left 987303449 5:16617087-16617109 CCGCGGGGCACAGGCGGCTGGGG 0: 1
1: 0
2: 1
3: 40
4: 321
Right 987303456 5:16617115-16617137 GTGACGCCACAGGCCACGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 132
987303449_987303452 -5 Left 987303449 5:16617087-16617109 CCGCGGGGCACAGGCGGCTGGGG 0: 1
1: 0
2: 1
3: 40
4: 321
Right 987303452 5:16617105-16617127 TGGGGGCCTTGTGACGCCACAGG 0: 1
1: 0
2: 1
3: 8
4: 123
987303449_987303455 4 Left 987303449 5:16617087-16617109 CCGCGGGGCACAGGCGGCTGGGG 0: 1
1: 0
2: 1
3: 40
4: 321
Right 987303455 5:16617114-16617136 TGTGACGCCACAGGCCACGGAGG 0: 1
1: 0
2: 0
3: 6
4: 110
987303449_987303454 1 Left 987303449 5:16617087-16617109 CCGCGGGGCACAGGCGGCTGGGG 0: 1
1: 0
2: 1
3: 40
4: 321
Right 987303454 5:16617111-16617133 CCTTGTGACGCCACAGGCCACGG 0: 1
1: 0
2: 0
3: 7
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987303449 Original CRISPR CCCCAGCCGCCTGTGCCCCG CGG (reversed) Intergenic