ID: 987303453

View in Genome Browser
Species Human (GRCh38)
Location 5:16617111-16617133
Sequence CCGTGGCCTGTGGCGTCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 109}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987303453_987303472 27 Left 987303453 5:16617111-16617133 CCTTGTGACGCCACAGGCCACGG 0: 1
1: 0
2: 0
3: 4
4: 109
Right 987303472 5:16617161-16617183 CGGCCGAGTTCGCGCAGGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 51
987303453_987303473 28 Left 987303453 5:16617111-16617133 CCTTGTGACGCCACAGGCCACGG 0: 1
1: 0
2: 0
3: 4
4: 109
Right 987303473 5:16617162-16617184 GGCCGAGTTCGCGCAGGGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 120
987303453_987303465 7 Left 987303453 5:16617111-16617133 CCTTGTGACGCCACAGGCCACGG 0: 1
1: 0
2: 0
3: 4
4: 109
Right 987303465 5:16617141-16617163 GCCGCCCGGGAAAGTGGGTGCGG 0: 1
1: 0
2: 0
3: 13
4: 150
987303453_987303460 -7 Left 987303453 5:16617111-16617133 CCTTGTGACGCCACAGGCCACGG 0: 1
1: 0
2: 0
3: 4
4: 109
Right 987303460 5:16617127-16617149 GCCACGGAGGGGGAGCCGCCCGG 0: 1
1: 0
2: 3
3: 14
4: 203
987303453_987303470 23 Left 987303453 5:16617111-16617133 CCTTGTGACGCCACAGGCCACGG 0: 1
1: 0
2: 0
3: 4
4: 109
Right 987303470 5:16617157-16617179 GGTGCGGCCGAGTTCGCGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 15
987303453_987303471 24 Left 987303453 5:16617111-16617133 CCTTGTGACGCCACAGGCCACGG 0: 1
1: 0
2: 0
3: 4
4: 109
Right 987303471 5:16617158-16617180 GTGCGGCCGAGTTCGCGCAGGGG 0: 1
1: 0
2: 0
3: 1
4: 30
987303453_987303463 1 Left 987303453 5:16617111-16617133 CCTTGTGACGCCACAGGCCACGG 0: 1
1: 0
2: 0
3: 4
4: 109
Right 987303463 5:16617135-16617157 GGGGGAGCCGCCCGGGAAAGTGG 0: 1
1: 0
2: 2
3: 13
4: 219
987303453_987303469 22 Left 987303453 5:16617111-16617133 CCTTGTGACGCCACAGGCCACGG 0: 1
1: 0
2: 0
3: 4
4: 109
Right 987303469 5:16617156-16617178 GGGTGCGGCCGAGTTCGCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 51
987303453_987303462 -6 Left 987303453 5:16617111-16617133 CCTTGTGACGCCACAGGCCACGG 0: 1
1: 0
2: 0
3: 4
4: 109
Right 987303462 5:16617128-16617150 CCACGGAGGGGGAGCCGCCCGGG 0: 1
1: 0
2: 0
3: 16
4: 193
987303453_987303474 29 Left 987303453 5:16617111-16617133 CCTTGTGACGCCACAGGCCACGG 0: 1
1: 0
2: 0
3: 4
4: 109
Right 987303474 5:16617163-16617185 GCCGAGTTCGCGCAGGGGCGGGG 0: 1
1: 0
2: 0
3: 5
4: 71
987303453_987303464 2 Left 987303453 5:16617111-16617133 CCTTGTGACGCCACAGGCCACGG 0: 1
1: 0
2: 0
3: 4
4: 109
Right 987303464 5:16617136-16617158 GGGGAGCCGCCCGGGAAAGTGGG 0: 1
1: 0
2: 0
3: 4
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987303453 Original CRISPR CCGTGGCCTGTGGCGTCACA AGG (reversed) Intergenic