ID: 987303459

View in Genome Browser
Species Human (GRCh38)
Location 5:16617121-16617143
Sequence GGCTCCCCCTCCGTGGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 256}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987303459_987303478 30 Left 987303459 5:16617121-16617143 CCACAGGCCACGGAGGGGGAGCC 0: 1
1: 0
2: 1
3: 26
4: 256
Right 987303478 5:16617174-16617196 GCAGGGGCGGGGCCGGGCGCCGG 0: 1
1: 5
2: 44
3: 480
4: 2315
987303459_987303473 18 Left 987303459 5:16617121-16617143 CCACAGGCCACGGAGGGGGAGCC 0: 1
1: 0
2: 1
3: 26
4: 256
Right 987303473 5:16617162-16617184 GGCCGAGTTCGCGCAGGGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 120
987303459_987303469 12 Left 987303459 5:16617121-16617143 CCACAGGCCACGGAGGGGGAGCC 0: 1
1: 0
2: 1
3: 26
4: 256
Right 987303469 5:16617156-16617178 GGGTGCGGCCGAGTTCGCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 51
987303459_987303476 23 Left 987303459 5:16617121-16617143 CCACAGGCCACGGAGGGGGAGCC 0: 1
1: 0
2: 1
3: 26
4: 256
Right 987303476 5:16617167-16617189 AGTTCGCGCAGGGGCGGGGCCGG 0: 1
1: 0
2: 2
3: 18
4: 208
987303459_987303477 24 Left 987303459 5:16617121-16617143 CCACAGGCCACGGAGGGGGAGCC 0: 1
1: 0
2: 1
3: 26
4: 256
Right 987303477 5:16617168-16617190 GTTCGCGCAGGGGCGGGGCCGGG 0: 1
1: 0
2: 3
3: 38
4: 307
987303459_987303465 -3 Left 987303459 5:16617121-16617143 CCACAGGCCACGGAGGGGGAGCC 0: 1
1: 0
2: 1
3: 26
4: 256
Right 987303465 5:16617141-16617163 GCCGCCCGGGAAAGTGGGTGCGG 0: 1
1: 0
2: 0
3: 13
4: 150
987303459_987303471 14 Left 987303459 5:16617121-16617143 CCACAGGCCACGGAGGGGGAGCC 0: 1
1: 0
2: 1
3: 26
4: 256
Right 987303471 5:16617158-16617180 GTGCGGCCGAGTTCGCGCAGGGG 0: 1
1: 0
2: 0
3: 1
4: 30
987303459_987303470 13 Left 987303459 5:16617121-16617143 CCACAGGCCACGGAGGGGGAGCC 0: 1
1: 0
2: 1
3: 26
4: 256
Right 987303470 5:16617157-16617179 GGTGCGGCCGAGTTCGCGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 15
987303459_987303464 -8 Left 987303459 5:16617121-16617143 CCACAGGCCACGGAGGGGGAGCC 0: 1
1: 0
2: 1
3: 26
4: 256
Right 987303464 5:16617136-16617158 GGGGAGCCGCCCGGGAAAGTGGG 0: 1
1: 0
2: 0
3: 4
4: 124
987303459_987303472 17 Left 987303459 5:16617121-16617143 CCACAGGCCACGGAGGGGGAGCC 0: 1
1: 0
2: 1
3: 26
4: 256
Right 987303472 5:16617161-16617183 CGGCCGAGTTCGCGCAGGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 51
987303459_987303474 19 Left 987303459 5:16617121-16617143 CCACAGGCCACGGAGGGGGAGCC 0: 1
1: 0
2: 1
3: 26
4: 256
Right 987303474 5:16617163-16617185 GCCGAGTTCGCGCAGGGGCGGGG 0: 1
1: 0
2: 0
3: 5
4: 71
987303459_987303463 -9 Left 987303459 5:16617121-16617143 CCACAGGCCACGGAGGGGGAGCC 0: 1
1: 0
2: 1
3: 26
4: 256
Right 987303463 5:16617135-16617157 GGGGGAGCCGCCCGGGAAAGTGG 0: 1
1: 0
2: 2
3: 13
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987303459 Original CRISPR GGCTCCCCCTCCGTGGCCTG TGG (reversed) Intergenic