ID: 987303463

View in Genome Browser
Species Human (GRCh38)
Location 5:16617135-16617157
Sequence GGGGGAGCCGCCCGGGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 219}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987303459_987303463 -9 Left 987303459 5:16617121-16617143 CCACAGGCCACGGAGGGGGAGCC 0: 1
1: 0
2: 1
3: 26
4: 256
Right 987303463 5:16617135-16617157 GGGGGAGCCGCCCGGGAAAGTGG 0: 1
1: 0
2: 2
3: 13
4: 219
987303453_987303463 1 Left 987303453 5:16617111-16617133 CCTTGTGACGCCACAGGCCACGG 0: 1
1: 0
2: 0
3: 4
4: 109
Right 987303463 5:16617135-16617157 GGGGGAGCCGCCCGGGAAAGTGG 0: 1
1: 0
2: 2
3: 13
4: 219
987303449_987303463 25 Left 987303449 5:16617087-16617109 CCGCGGGGCACAGGCGGCTGGGG 0: 1
1: 0
2: 1
3: 40
4: 321
Right 987303463 5:16617135-16617157 GGGGGAGCCGCCCGGGAAAGTGG 0: 1
1: 0
2: 2
3: 13
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987303463 Original CRISPR GGGGGAGCCGCCCGGGAAAG TGG Intergenic