ID: 987309556

View in Genome Browser
Species Human (GRCh38)
Location 5:16669101-16669123
Sequence CCAAACCTGGACAAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987309547_987309556 11 Left 987309547 5:16669067-16669089 CCCCATATGAAGGGGCTAACAAC 0: 1
1: 0
2: 0
3: 2
4: 61
Right 987309556 5:16669101-16669123 CCAAACCTGGACAAGCAGGAGGG 0: 1
1: 0
2: 0
3: 16
4: 182
987309549_987309556 9 Left 987309549 5:16669069-16669091 CCATATGAAGGGGCTAACAACAC 0: 1
1: 0
2: 0
3: 2
4: 54
Right 987309556 5:16669101-16669123 CCAAACCTGGACAAGCAGGAGGG 0: 1
1: 0
2: 0
3: 16
4: 182
987309548_987309556 10 Left 987309548 5:16669068-16669090 CCCATATGAAGGGGCTAACAACA 0: 1
1: 0
2: 0
3: 4
4: 107
Right 987309556 5:16669101-16669123 CCAAACCTGGACAAGCAGGAGGG 0: 1
1: 0
2: 0
3: 16
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987309556 Original CRISPR CCAAACCTGGACAAGCAGGA GGG Intronic
900773166 1:4562021-4562043 CCAAATCTGGGCTGGCAGGAAGG + Intergenic
901787480 1:11634326-11634348 CCAAACCTGGAGAGGGAGGCAGG + Intergenic
902205541 1:14865648-14865670 CCAACCCAGTACAGGCAGGATGG - Intronic
902252144 1:15160967-15160989 CCAAACTTGGAGAGTCAGGAAGG + Intronic
904251463 1:29227609-29227631 CCACACCTCTGCAAGCAGGAGGG - Intronic
904457403 1:30655942-30655964 CCAAACCTGGCCAGTGAGGAAGG - Intergenic
904488418 1:30843149-30843171 CAAAACCTGAACAAAGAGGAGGG + Intergenic
904493710 1:30875378-30875400 ACAGACTTGGCCAAGCAGGAAGG - Intronic
905056710 1:35100954-35100976 CAAAAACTGGACAGGCAGGGTGG - Intronic
905337803 1:37257472-37257494 ACAAAACTGGAAAAGCTGGATGG + Intergenic
905690258 1:39937570-39937592 CCAAGCCTGCACATTCAGGAGGG + Intergenic
906852956 1:49271714-49271736 CCAAAGATGGAGAAGAAGGAGGG - Intronic
907444364 1:54498589-54498611 CCCCACCTAGACCAGCAGGAAGG + Intergenic
911776764 1:101823540-101823562 CTAAGCCTGGAGAAGCAGAAGGG + Intronic
915434099 1:155890343-155890365 CCAAACATTGACAAGGAGGATGG + Intergenic
915613695 1:157017098-157017120 GCAAATATGGACAATCAGGATGG + Intronic
916312510 1:163412614-163412636 CCAACTCTGGACAAGGAGGAAGG + Intergenic
918410154 1:184249912-184249934 CCAAACCTGCACAAGGCAGAAGG + Intergenic
920299410 1:204979090-204979112 CCAAAGCTGGAAAAGAGGGACGG + Intronic
922225260 1:223640491-223640513 GGAAACCTGGACAAGAAGGCAGG - Intronic
922452873 1:225750869-225750891 CAAAGCCTGTACAATCAGGAGGG + Intergenic
924608353 1:245554039-245554061 CCAGACCTGGAAAAGTAGGTGGG - Intronic
1067938664 10:50633925-50633947 CCACACCTGGAGAACTAGGAAGG - Intergenic
1068306224 10:55211981-55212003 GCAAACCTAGACAAGCAAGTTGG + Intronic
1068549110 10:58385875-58385897 CCAAAGCTGGACAGTGAGGAGGG - Intronic
1068978533 10:63036454-63036476 CCAAATCTGAACAACAAGGAGGG + Intergenic
1071505007 10:86226919-86226941 CCAAATCAGGAAAAGCAGCAAGG - Intronic
1071741964 10:88369445-88369467 CAACACCTGGCAAAGCAGGAAGG - Intronic
1073215893 10:101836048-101836070 CCAGAGCTGGACAAGAGGGAGGG - Intronic
1073665078 10:105522567-105522589 CCAAACATGGAAAAGAAGAAGGG + Intergenic
1075000624 10:118794520-118794542 CCTAGCCTGGACAAGCACCAGGG + Intergenic
1075695714 10:124433692-124433714 CCACACCTGCACAAGCAAGCTGG - Intergenic
1076690631 10:132222367-132222389 GCACACCTGGGCAAGCACGAAGG + Intronic
1077122279 11:915124-915146 CAAATCCAGGGCAAGCAGGAGGG + Intergenic
1078157491 11:8811246-8811268 CACAACCTGGACAGGCAGCAAGG - Exonic
1079456630 11:20642225-20642247 CCACACCTGGCCACCCAGGAGGG + Intronic
1080434103 11:32224002-32224024 CCCAAACAGGACAATCAGGATGG - Intergenic
1080780560 11:35425491-35425513 CCAAACATGGTCAAGATGGATGG - Intergenic
1083887681 11:65580838-65580860 AAAAGCCTGGACAAGCAGCAGGG - Intronic
1084157078 11:67319209-67319231 CCACACCTGGCTAGGCAGGATGG + Intronic
1088353854 11:108921097-108921119 CCATTCCTGGACTAGCAGGCAGG + Intronic
1095744876 12:45646775-45646797 CAAAACCTGGGCAAGCATAATGG - Intergenic
1097621097 12:61940616-61940638 TCACAGCTGGACAAGCAGGCAGG - Intronic
1102114131 12:110388586-110388608 GCAAACCTGTACAAGAAGGCTGG - Exonic
1103037969 12:117671811-117671833 CCACTCCTGGGCAGGCAGGATGG - Intronic
1104046675 12:125168136-125168158 CCAAACATGGCAAAGAAGGATGG + Intergenic
1104579153 12:129997054-129997076 CCCAAATTGGACAAGCAGGCTGG - Intergenic
1104842452 12:131831557-131831579 CAAAACCAAGACAGGCAGGAGGG + Intronic
1106790573 13:33151618-33151640 ATAAGCCTGGACAAGCAGGCAGG + Intronic
1108746195 13:53397136-53397158 CCAAAACTAGCCAAGCAGGGTGG - Intergenic
1110449931 13:75629890-75629912 CCAAATCAGGAAAGGCAGGAGGG + Intronic
1110569693 13:76990942-76990964 CCAAACCTGGAGCAGCAAGTGGG + Exonic
1113474264 13:110569069-110569091 GCAGACATGGACAAGCAGGCTGG + Intergenic
1114694650 14:24615079-24615101 CCAGACCTGGATAATAAGGAGGG - Intergenic
1114804645 14:25820833-25820855 CCAGTCTTGGACAAGCAGCATGG + Intergenic
1115836352 14:37409022-37409044 CCAATCCTTGATAAGCAGCAAGG + Intronic
1116394618 14:44432505-44432527 CCAAAAATAGACAAGCAGTAAGG - Intergenic
1116855846 14:49951646-49951668 CCAAAGCTGGAGAAGCAGCAAGG + Intergenic
1119104623 14:71912505-71912527 CCAAAACTGAAGAAGGAGGAAGG + Intergenic
1119157252 14:72422617-72422639 CCAATCTTGGACAAGGACGAGGG - Intronic
1119701139 14:76755649-76755671 CCAGGCCTTGACAAGCAGCAAGG - Intergenic
1122207763 14:100156705-100156727 CCAGACCTGGCCCAGCTGGATGG - Intronic
1123411472 15:20064374-20064396 CCAATACTGGACAAGAAGGAAGG - Intergenic
1123520822 15:21071493-21071515 CCAATACTGGACAAGAAGGAAGG - Intergenic
1126064927 15:44819396-44819418 CCAAACCTCGAGGACCAGGAGGG - Intergenic
1126531261 15:49713479-49713501 CCAACCCTGCACAGGCAGAATGG - Intergenic
1126600021 15:50418829-50418851 CCACACTTGGAAAAGCATGAGGG - Intergenic
1127913470 15:63437129-63437151 CCAAACCTGGTGAATCAGGCTGG - Intergenic
1130415080 15:83686007-83686029 CCAGACCAGGAGAAGGAGGAGGG - Intronic
1131500344 15:92957750-92957772 CCAAAACTGGACAATGATGATGG - Intronic
1131975051 15:97935955-97935977 CCAATAATGGACAAGTAGGAAGG + Intergenic
1132055743 15:98649258-98649280 TCAAACCCGGAGAGGCAGGAAGG - Exonic
1132419503 15:101652925-101652947 TCAGGCCTGGAGAAGCAGGATGG + Intergenic
1134262166 16:12660125-12660147 CCAAACCATATCAAGCAGGAAGG + Exonic
1136281949 16:29218422-29218444 GCTAACCTTGGCAAGCAGGAGGG + Intergenic
1136599191 16:31272875-31272897 CGAGACCTGGAAAAGCAGCAGGG - Intronic
1137498934 16:48995732-48995754 CAAAAGCTGTACAAACAGGAGGG - Intergenic
1137787057 16:51148718-51148740 CCAACGCTGGACATACAGGAGGG - Intronic
1138561540 16:57803484-57803506 CCATCCCCTGACAAGCAGGAAGG - Intronic
1139622254 16:68155177-68155199 CCAAGGCTGGACAAGTAGGCGGG + Intronic
1141281734 16:82635312-82635334 CCAAATCTGGAGGAGCAGTAGGG + Intronic
1141352659 16:83312560-83312582 CCAAACCTGCCCAAGAAGGGTGG - Intronic
1141853569 16:86665253-86665275 CCAAACCGGGTCAGGCAAGAGGG + Intergenic
1141965886 16:87443018-87443040 GCAAACTTGGACCATCAGGAAGG + Intronic
1142086325 16:88184338-88184360 GCTAACCTTGGCAAGCAGGAGGG + Intergenic
1143487710 17:7263562-7263584 CCAAAGCAGGAAAGGCAGGAAGG - Intronic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1149867351 17:60158119-60158141 CCAAACCTGGTGAGTCAGGATGG + Exonic
1150113087 17:62519446-62519468 CCAATCCTGAAAAAGCAGGAAGG - Intronic
1152770283 17:82163326-82163348 CCCAAGCTGGTCAAGCCGGAGGG - Exonic
1153826009 18:8875537-8875559 CCAAACCGAGACAAGGAGGCTGG + Intergenic
1155638606 18:27985106-27985128 GCAAACCTTCACACGCAGGATGG + Exonic
1161486381 19:4538106-4538128 CCAAACTGGGACATGCGGGATGG - Exonic
1164666995 19:30046823-30046845 TCAAACCTGGAGCAGCAGGGGGG - Intergenic
1164738405 19:30559387-30559409 CCAAGCCTGTACAAGAAGTAGGG + Intronic
1166142655 19:40813352-40813374 CCAAGCAGGGACAGGCAGGAGGG - Intronic
1166892180 19:46000442-46000464 CCAAATCTGGGAGAGCAGGATGG + Intronic
926005492 2:9370491-9370513 CCAAACCTAGAGAGGCAGTAGGG + Intronic
926230970 2:11003544-11003566 CAGAACCTGGAGAGGCAGGAAGG + Intergenic
929551743 2:42897687-42897709 CCTAACTAGGCCAAGCAGGATGG - Intergenic
931140624 2:59453660-59453682 CCAGACCGGGAGAAGGAGGAAGG - Intergenic
932752356 2:74379474-74379496 TCACACCTGGAACAGCAGGATGG + Intronic
933836573 2:86250730-86250752 CAAAGCCTGGACAAGAGGGAAGG - Intronic
935725031 2:106016275-106016297 ACATACCTGAACCAGCAGGAAGG + Intergenic
935903432 2:107817300-107817322 CCAAAACTGGAGAAGCAGTGGGG - Intergenic
942595401 2:177587409-177587431 CCACACCTGTACAGCCAGGAAGG - Intergenic
943374289 2:187055528-187055550 CCACAGCTGCACAAGCAGTATGG + Intergenic
944955013 2:204798632-204798654 CCCAACCTCCTCAAGCAGGATGG - Intronic
948822400 2:240556791-240556813 ACAAACAGGGACAAGCACGATGG + Intronic
1172813843 20:37670870-37670892 CCCAACCTGGACATGCAGTGTGG + Intergenic
1173921036 20:46745119-46745141 TCAAACCAGGAGAGGCAGGATGG - Intergenic
1174226790 20:49007085-49007107 CCAAACCTGGACAACTACAATGG - Intronic
1174870270 20:54174626-54174648 CCAAACATGAAACAGCAGGAAGG - Intergenic
1177873135 21:26597830-26597852 CCAAACCCAGACAAGAAGGAGGG - Intergenic
1180007730 21:45030960-45030982 CCAAACCTTCACGAACAGGAGGG - Intergenic
1180021216 21:45128762-45128784 CCACCCCAGAACAAGCAGGAGGG - Intronic
1180109364 21:45640936-45640958 CCAGCCCATGACAAGCAGGAAGG + Intergenic
1181341066 22:22180399-22180421 GCAAACCTGGGCCAGGAGGAGGG - Intergenic
1183186281 22:36293323-36293345 CCAAACCTGGGCATGGAGGGTGG + Exonic
1184114562 22:42414813-42414835 CCTGCCCAGGACAAGCAGGAAGG - Intronic
1185276902 22:49953777-49953799 CCCAACATGGTCAAGCAGGAAGG + Intergenic
951352656 3:21625316-21625338 CCAAAGGAGGACAATCAGGAAGG + Intronic
952803565 3:37322220-37322242 ATAAACCTGGACAAGCAGAAAGG - Intronic
955741702 3:62097969-62097991 TCAAACCTGGGAAAGCATGATGG - Intronic
956568273 3:70664396-70664418 CCAAGCTTGGACAAACAGAAAGG - Intergenic
957293853 3:78311137-78311159 CCAATGCTGGAGCAGCAGGAGGG - Intergenic
961119533 3:124361950-124361972 TCACACCTGGACCAGCAGGAAGG - Intronic
961778446 3:129306925-129306947 CCACACCTAGACAGGCAGGTGGG - Intergenic
964683951 3:159374297-159374319 GCAAACAGGGATAAGCAGGAAGG + Intronic
965732485 3:171787161-171787183 CCAGAGGTGGACAAGCAGAATGG - Intronic
966880560 3:184347635-184347657 CCAAACCTGGCCAGCCAGGTAGG - Intronic
967214429 3:187198583-187198605 CTGAACCAGGGCAAGCAGGAAGG - Intronic
967322979 3:188212516-188212538 CCAAATATGGAGAAGCAGGCTGG - Intronic
967965368 3:194956411-194956433 CCACACCTGGCCTATCAGGAGGG - Intergenic
968533501 4:1109462-1109484 CCAAACCTGAACAAGCCCGGTGG + Intronic
968574772 4:1360493-1360515 CCAGGCCTGGACAAGGAGGCCGG - Intronic
969449173 4:7263359-7263381 CCCAGCCTGGAGGAGCAGGAAGG + Intronic
970446288 4:16125800-16125822 GCAACCTTGGGCAAGCAGGAAGG - Intergenic
971577255 4:28291408-28291430 TAAATCCTAGACAAGCAGGAAGG + Intergenic
971714692 4:30160368-30160390 ACAAACTTGGACAAGCAGGCTGG + Intergenic
974746308 4:66082459-66082481 CCCAAGCTGGAGAAGGAGGAAGG + Intergenic
975315284 4:72945206-72945228 CAAAACTTGGAGAATCAGGAGGG + Intergenic
977435175 4:96986202-96986224 CAAACCCTGGAGAAGCAGCAGGG - Intergenic
982399872 4:154954453-154954475 CCAAACTTGGCCAAGTAGGCGGG - Intergenic
983628139 4:169824031-169824053 TCAGACCAGGTCAAGCAGGATGG - Intergenic
984039711 4:174716060-174716082 CTAAACGTGGAAAAGCAGGGTGG + Intronic
984309028 4:178032967-178032989 CCAAAATTCGACAAGTAGGATGG - Intergenic
984384744 4:179041657-179041679 CCAAATCTGGTCAATCATGAGGG + Intergenic
984538168 4:181002965-181002987 CAAAACATTGCCAAGCAGGAAGG - Intergenic
986155894 5:5175701-5175723 CCAGACCAGGGCAAGCTGGAGGG - Intronic
987309556 5:16669101-16669123 CCAAACCTGGACAAGCAGGAGGG + Intronic
990554526 5:56917864-56917886 CCAAACTTGGATAGGAAGGAGGG + Intergenic
992831678 5:80599292-80599314 CTAAAGCTGGAGATGCAGGAGGG + Intergenic
995242638 5:109902378-109902400 ACAAAGTTGGACAAGCAGGTGGG - Intergenic
998059066 5:139104927-139104949 CCAATCCTAGAGAAGAAGGAAGG + Intronic
999230210 5:150057366-150057388 CTAGACCTGGACAAGGAGGATGG - Exonic
999368551 5:151038835-151038857 ACAAACCCTGACAAGCAGGGTGG + Intronic
1001820705 5:174707951-174707973 CCAAACCCGATCATGCAGGATGG + Intergenic
1003132066 6:3403329-3403351 CCACACCTGGACAGACAGGATGG - Intronic
1006929066 6:37676609-37676631 CCAAACCTGGCCCAGCATGATGG + Intronic
1007059156 6:38921369-38921391 GCCAACCTGGCCAAGCAGGAAGG + Exonic
1011092201 6:83616212-83616234 ACAAAGCAGGACAAGGAGGATGG + Intronic
1013621312 6:111892363-111892385 CTGAGCCTAGACAAGCAGGAAGG - Intergenic
1013854197 6:114552207-114552229 TCAAGCCTGGACCAACAGGAGGG - Intergenic
1014431971 6:121381751-121381773 ACAAACCTAAACTAGCAGGATGG - Intergenic
1016312477 6:142748819-142748841 GCAAACCTGGACAAAGAGGTGGG + Intergenic
1016830965 6:148432684-148432706 TCACAGCTGGAAAAGCAGGAGGG - Intronic
1019721250 7:2572942-2572964 CCCAACCAGTAAAAGCAGGAAGG - Intronic
1023357540 7:39382395-39382417 TCAGACCTGGGCCAGCAGGATGG + Intronic
1023536336 7:41216333-41216355 CCAAAACTGCAGAAGCATGAAGG - Intergenic
1024060175 7:45691522-45691544 CCAAACCTGCACAAACAGATAGG + Intronic
1024253839 7:47525142-47525164 CCCAACATGGACAAGCAGCGGGG - Intronic
1026269325 7:68822726-68822748 CCAACGCTGGACAGGGAGGAAGG - Intergenic
1032042293 7:128573387-128573409 CCAATCCTGAAAAAGTAGGAAGG - Intergenic
1032483499 7:132265231-132265253 TGAAACCTGGACAATCAGGCAGG - Intronic
1035447943 7:158955838-158955860 ACAAAGCTGGAGAAGCATGAGGG + Intronic
1035690163 8:1554733-1554755 CCAGAACTTGGCAAGCAGGAAGG + Intronic
1039565338 8:38547819-38547841 CCAAACCTGGAAAGAGAGGAAGG - Intergenic
1041494934 8:58475590-58475612 CCAAACATAGACAAACAGCATGG - Intergenic
1045352227 8:101352466-101352488 GCTAACTTGGCCAAGCAGGAAGG - Intergenic
1045956268 8:107911329-107911351 CCTAACCTGGAGAAGTAGCAGGG + Intronic
1047192571 8:122691452-122691474 CAAAACATGGGAAAGCAGGATGG - Intergenic
1048250615 8:132863928-132863950 CCCCACCTGGAGAAGCAGCAAGG - Intergenic
1049368872 8:142253950-142253972 CCAAGACTGGACTAGGAGGAAGG + Intronic
1049598062 8:143493474-143493496 CCACACCTGGAGAAGGTGGAAGG + Intronic
1052876378 9:33569741-33569763 CCACACCTGGCCAAGCACAAAGG - Intronic
1057567305 9:96176996-96177018 CCAGATCTTGACAAGTAGGAGGG + Intergenic
1058985675 9:110207095-110207117 CCATACCTGGGCTAGCAGGGGGG + Intronic
1059037074 9:110765986-110766008 AAAAATCTGAACAAGCAGGATGG - Intronic
1060033012 9:120231821-120231843 CCACGCCTGGAAAACCAGGAAGG + Intergenic
1062533720 9:137012585-137012607 CCATACCTGGGCAGGCAGGTGGG + Exonic
1187651106 X:21407564-21407586 CCAAATCTTGCCAAGAAGGAGGG - Intronic
1192619403 X:72662438-72662460 CCAACCCTGGACCAGCCTGACGG + Intronic
1194505280 X:94726806-94726828 GCAAGCCTGGAAAAACAGGATGG - Intergenic
1197714541 X:129697005-129697027 TCAAAGCAGGACAAGCAGCAAGG - Intergenic
1199663485 X:150077968-150077990 CCATACCTGGACACCTAGGATGG + Intergenic
1199686783 X:150272187-150272209 CCAGACATGGAGAAGCAGAATGG + Intergenic
1200929642 Y:8685455-8685477 CAACACCAGGAAAAGCAGGAGGG + Intergenic
1202202681 Y:22370466-22370488 CCAAACCTGGAAACTAAGGAAGG - Intronic